ID: 1185045848

View in Genome Browser
Species Human (GRCh38)
Location 22:48528395-48528417
Sequence CCATAGTGAGGAGGCACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045843_1185045848 -6 Left 1185045843 22:48528378-48528400 CCTGTGTATAGCCAAGGCCATAG No data
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045840_1185045848 1 Left 1185045840 22:48528371-48528393 CCCGATGCCTGTGTATAGCCAAG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045841_1185045848 0 Left 1185045841 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045838_1185045848 7 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045839_1185045848 2 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045848 Original CRISPR CCATAGTGAGGAGGCACCCC TGG Intronic
No off target data available for this crispr