ID: 1185045849

View in Genome Browser
Species Human (GRCh38)
Location 22:48528399-48528421
Sequence AGTGAGGAGGCACCCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045841_1185045849 4 Left 1185045841 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254
1185045843_1185045849 -2 Left 1185045843 22:48528378-48528400 CCTGTGTATAGCCAAGGCCATAG No data
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254
1185045839_1185045849 6 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254
1185045840_1185045849 5 Left 1185045840 22:48528371-48528393 CCCGATGCCTGTGTATAGCCAAG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254
1185045838_1185045849 11 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045849 Original CRISPR AGTGAGGAGGCACCCCTGGA AGG Intronic
900557773 1:3288787-3288809 AGGGAGCAGACATCCCTGGAAGG + Intronic
900757330 1:4445392-4445414 AGTGAGGAAGCACAGCTGCAGGG + Intergenic
902368894 1:15993460-15993482 AAGGACGAGGCACCCATGGAGGG - Intergenic
902414249 1:16229805-16229827 GCTGAGAAGGCAGCCCTGGATGG + Intergenic
903173687 1:21568690-21568712 AGGGAGGAGGCAGCGCTGGATGG + Intronic
903265384 1:22154921-22154943 AGAGAGGTGGCACTGCTGGAAGG + Intergenic
903739451 1:25550145-25550167 AGGGATGAGGCCCCACTGGAAGG + Intronic
904043599 1:27598052-27598074 AGCGAGTGGGCACCCTTGGAAGG - Intronic
904045288 1:27604674-27604696 AGTGAGGAAGCAGCGCTGGCTGG - Intergenic
904128784 1:28260390-28260412 AGCCGGGAGGCACCCCAGGAAGG - Intronic
904912677 1:33947174-33947196 GGTGAGGCTGCACACCTGGAAGG + Intronic
905937600 1:41837227-41837249 ACTGAGGAGGTAACCCTTGAGGG - Intronic
907372450 1:54012097-54012119 AGTGTGGGGGAACCCCTGGGAGG + Intronic
907388281 1:54139872-54139894 AGCGAGGAGGCACCCCTGCTGGG - Exonic
907427375 1:54388934-54388956 AGTGAGAAGGCACCACTGCTAGG + Intronic
912579528 1:110707543-110707565 TGGGAGGTAGCACCCCTGGAGGG - Intergenic
912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG + Intronic
913043867 1:115056886-115056908 AGTGAGGAGACAGCACGGGAAGG - Intronic
914825134 1:151134112-151134134 AGGGAGGAAGGACCCCTGGAAGG - Intronic
915107257 1:153542282-153542304 AGTGGGGAGGCCCCCCAGGCTGG - Intergenic
915121690 1:153633524-153633546 AGTGAGGAGGAAAACATGGACGG + Intronic
915300493 1:154948665-154948687 AGTTTGGAGGCAACCCAGGAGGG - Intronic
915552878 1:156645350-156645372 AGGGAGGAGGCAGCCAAGGAAGG + Intronic
915830485 1:159124951-159124973 AGAGAGGAGGCATCACTCGAAGG - Intronic
916851873 1:168712313-168712335 GGTGAGGAGGTAGCCCTGCACGG - Intronic
917535680 1:175872831-175872853 AGTGAGGAGGGCCCCCAGAATGG - Intergenic
918263916 1:182822406-182822428 AGAGAGGAGCCATCCCTGTATGG - Intronic
919739317 1:200972728-200972750 ACAGAGGAGGCGGCCCTGGAGGG + Intronic
921383580 1:214549226-214549248 AGTGAAGAGACACCCTTGAAAGG + Intronic
923000348 1:230002016-230002038 AGTGCAGAGGCTCCCTTGGAGGG - Intergenic
923472862 1:234307795-234307817 AGTGAGGAGGCACTGCTTCATGG - Intronic
923637697 1:235717458-235717480 AGTGAGGATTCATTCCTGGAGGG - Intronic
924451787 1:244185051-244185073 AGTGAGGAGGCCTTCCTGGCTGG + Intergenic
1063920433 10:10926967-10926989 AGAGAGGAGGGAAACCTGGAGGG - Intergenic
1063978927 10:11438140-11438162 GGTGAGGAGGCGACCCAGGATGG + Intergenic
1064316882 10:14265870-14265892 TGTGATGAGGCACCCCAGGAGGG - Intronic
1065120816 10:22529003-22529025 AGGGAAGAAGCACCTCTGGAAGG - Intergenic
1065330119 10:24587024-24587046 AGTGAGAACCCACCCCAGGAAGG + Intronic
1067533110 10:47088712-47088734 AGTAAGGAGACATCCCTGGCTGG - Intergenic
1067763826 10:49070509-49070531 GGTGAAGGGGCACCCCAGGAAGG + Intronic
1068944864 10:62719707-62719729 AGTTAGGAGGAAACCCAGGAGGG - Intergenic
1070162106 10:73873069-73873091 ACAGAGAAAGCACCCCTGGAGGG + Exonic
1072674663 10:97456846-97456868 AGTGAGCAGTCACCCAGGGAGGG - Exonic
1075933405 10:126319214-126319236 AGTTACGCTGCACCCCTGGATGG - Intronic
1076000804 10:126911581-126911603 AATGAGGAGGCGCCCGAGGAGGG + Intronic
1076854862 10:133111126-133111148 GGAGAGGAGGCACCCCTGGCGGG - Intronic
1077170149 11:1162473-1162495 AGTGAGGAGAGACCCCAGGCAGG - Intronic
1077317862 11:1927311-1927333 AGTGAGGAGGCCCCCTGGGTGGG + Intronic
1077407382 11:2388733-2388755 GGTGAGGAGGCACCCGGGGGGGG - Intronic
1077443324 11:2578732-2578754 CGTGAGGAGGCACCTAAGGATGG - Intronic
1077978402 11:7274200-7274222 AATGAGGGGGCTCCACTGGAAGG - Intronic
1078074001 11:8140662-8140684 AGTGAGGTGGCAGCAGTGGAGGG - Intronic
1078100382 11:8327090-8327112 AGTGAGGAGGCAGAAATGGAGGG + Intergenic
1078583760 11:12561890-12561912 AGACAGGAGCCAGCCCTGGAGGG + Intergenic
1079480512 11:20874704-20874726 AGGGAAGGGGCACTCCTGGAAGG - Intronic
1080781356 11:35432728-35432750 AGTGATGTGGGACTCCTGGAAGG + Exonic
1081754640 11:45535905-45535927 AGTGAGGAGACACTCCTGGAGGG - Intergenic
1083143618 11:60741070-60741092 AGTGAGGATGAACTCCAGGAGGG - Exonic
1084434019 11:69127484-69127506 AGTGGGAAGGCACCCTCGGAAGG + Intergenic
1084564155 11:69920124-69920146 AGGGAGGACGCATCCCAGGAGGG - Intergenic
1084564276 11:69920524-69920546 AGGGAGGACTCACCCCAGGAGGG - Intergenic
1085013584 11:73158029-73158051 AGAAAGGAGGCAACCCTGGAGGG + Intergenic
1085031332 11:73272656-73272678 AGGGACGAGGCACCGCAGGACGG + Intronic
1085759243 11:79227600-79227622 ACTGGGGAGGCAGCCCTAGAAGG + Intronic
1089054800 11:115576920-115576942 ATTCAGGATTCACCCCTGGAGGG + Intergenic
1089611673 11:119672779-119672801 AGTGAGTAGGCAGGGCTGGAGGG - Intronic
1090306917 11:125699169-125699191 AGTGAGGAGGGATACTTGGAGGG - Intergenic
1090830224 11:130416072-130416094 TGTGAGGAGGCACAGCTGGAGGG + Intronic
1093929097 12:24937247-24937269 GGTGATAAGGCACCCCTGGATGG + Intronic
1096411961 12:51383462-51383484 AGTCAGGAGGCCTTCCTGGAGGG - Exonic
1096455328 12:51780304-51780326 AGTGAGGAAGTTCCACTGGAAGG - Intronic
1098243897 12:68496388-68496410 AGTCAGGAGGATCTCCTGGAAGG - Intergenic
1098463260 12:70757986-70758008 AGTGAGCAGGCACCCCAGTGGGG - Intronic
1101593234 12:106140432-106140454 AGTGAGGAGGCTCCCGGGGAGGG - Intergenic
1102020256 12:109677383-109677405 AGTGATGAGGCTCACCTGCATGG - Intergenic
1102073022 12:110037361-110037383 GGTGAGGAGGCTCTCCTGGATGG - Exonic
1102487671 12:113269109-113269131 AGCGAGGAAGCAGCTCTGGAAGG - Intronic
1102506088 12:113385314-113385336 AGTGAGGTGGATGCCCTGGAGGG - Intronic
1103826701 12:123744843-123744865 AGTGAGGAGGCTGACCTGGGAGG - Intronic
1103893176 12:124254980-124255002 AGTTTGGAGGCACCCCAGGAAGG + Intronic
1104856648 12:131905330-131905352 AATCAGAAGGCACCCCTGGTGGG - Intronic
1105306160 13:19170417-19170439 AGGGAGGATGCAGTCCTGGATGG + Intergenic
1105968600 13:25406705-25406727 AGTGAGGTGGATCCCCAGGAGGG - Intronic
1106456805 13:29935015-29935037 AGTGATGAGGTGCTCCTGGAAGG - Intergenic
1110832769 13:80050539-80050561 ACTGAGGAGGCAGCCCTGTTTGG - Intergenic
1112188384 13:97150250-97150272 AGTGAGGAGGCATCTCAGCATGG - Intergenic
1114647994 14:24266369-24266391 AGTGAGGTGCCACCCTGGGAAGG - Intronic
1114702215 14:24690652-24690674 AGTGAAGAGTGACCCCTGGAGGG - Intergenic
1119449962 14:74701082-74701104 AGTTGGGAGCCAACCCTGGATGG + Intronic
1119852468 14:77875792-77875814 ATTGAGGAGGAAGCCCAGGAGGG + Intronic
1121126191 14:91408239-91408261 GGAGAGGAGGAACCACTGGAGGG - Intronic
1121578150 14:95005778-95005800 AGTGAAGAGACAGCTCTGGAAGG - Intergenic
1121741268 14:96254018-96254040 AGTGAGGGGGCACTCCAGGCAGG - Intronic
1124013487 15:25858398-25858420 AGAGATGAGGCTCACCTGGAAGG + Intronic
1127904653 15:63367437-63367459 AATGAGGAGCCACCCTGGGAAGG + Intronic
1128449697 15:67798167-67798189 ACTGAGGACTCACCCCTGAAAGG - Intronic
1129160553 15:73745285-73745307 GGTGAGGAGGCAGGCCTGGCAGG - Intronic
1130049118 15:80468457-80468479 GGTGAGGAGGCAGGCCTAGACGG - Intronic
1131051826 15:89353493-89353515 AGTGAGTAGACAAGCCTGGAAGG - Intergenic
1131308494 15:91266804-91266826 GGAGAGGAAGCAACCCTGGAGGG + Intronic
1132715650 16:1288779-1288801 GGCCAGGAGGCACCCCTGGCAGG - Intergenic
1133303816 16:4798049-4798071 GGTGAGGAGGGACCCCTGCCCGG - Exonic
1133318597 16:4899175-4899197 AGGGAGGAGGCAGCCCTGGAAGG - Intronic
1133623811 16:7551362-7551384 AGTGAGCTGGGGCCCCTGGAGGG - Intronic
1136062543 16:27736653-27736675 GGTCAGCAGGCACCCCTGAAGGG + Intronic
1136389204 16:29951698-29951720 AGGGAGGACGCAGTCCTGGAAGG - Intronic
1137009472 16:35308900-35308922 AGGGAGGAGGCACAACAGGATGG - Intergenic
1137247377 16:46716904-46716926 AGAGAGGGGGCACCCAGGGAAGG + Intronic
1138193087 16:55032522-55032544 AGTGAGGTGGCAGCCTTGGGTGG + Intergenic
1138438588 16:57020693-57020715 CATGAGGAGCCAGCCCTGGAGGG - Exonic
1141798990 16:86294618-86294640 CGTGAGGAGGCCCAGCTGGAAGG + Intergenic
1142029164 16:87829830-87829852 TGTGAGCACGCACCCCTCGAGGG - Intergenic
1143171995 17:4935743-4935765 GGAGAGGAGGCACCCCAGGCAGG - Intergenic
1143402948 17:6657623-6657645 AGTGATGAGGCTCTCCTGGCAGG + Intergenic
1144710690 17:17399643-17399665 AGGGAGGTGGGAGCCCTGGAGGG - Intergenic
1146113369 17:30112023-30112045 AGTGATGAGGCAACCCTGGGTGG + Intergenic
1149672504 17:58427750-58427772 AGTGAGGAGGCACCCCTTGTGGG - Intronic
1151335551 17:73437714-73437736 AATGAGGTGGCACCGCTGGAGGG - Intronic
1152078230 17:78171398-78171420 AGTGTGGAGGCTCCCCCGGGAGG + Intronic
1153389915 18:4544733-4544755 AGGCAGGAGCCAGCCCTGGACGG - Intergenic
1153880518 18:9418191-9418213 AGTGAGCAGGCAGGCCTGGCAGG + Intergenic
1153892086 18:9526668-9526690 AGTGATGAGGGTCACCTGGAAGG + Intronic
1156512529 18:37652610-37652632 AGTGAAGATGCAACCCTGGGAGG + Intergenic
1156859770 18:41822279-41822301 GGTGAGGTGGCCCACCTGGATGG + Intergenic
1157134142 18:45037694-45037716 AGTCAGGAGGTGCCCCTGTAAGG - Intronic
1157744337 18:50121633-50121655 AGTGAGGAGGCACACAGGGCAGG - Intronic
1157852664 18:51071203-51071225 AGATAGCATGCACCCCTGGAAGG + Intronic
1158615005 18:58979203-58979225 ACTCAGGAGGAACCTCTGGAAGG + Intronic
1160189799 18:76706557-76706579 AATGAGGAGCCCCCACTGGAGGG - Intergenic
1160222207 18:76985599-76985621 AGGGAGGAGGCAGGCCTGGCTGG + Intronic
1160432051 18:78819261-78819283 AGGGAGGATGAGCCCCTGGAGGG + Intergenic
1161210659 19:3063541-3063563 AGTGAGGTAGGAGCCCTGGAAGG + Intergenic
1161222877 19:3126092-3126114 AGGGAGGTGGGAGCCCTGGAGGG + Intergenic
1161481148 19:4511302-4511324 AGTGTCCAGGCCCCCCTGGACGG + Exonic
1161544235 19:4870253-4870275 AGTGAGGAGGCCCCAGTGGCTGG + Intergenic
1161949589 19:7460358-7460380 AGGGAGGAGGAAGCTCTGGAAGG - Intronic
1162152360 19:8655472-8655494 GGTGCGGGGACACCCCTGGAGGG + Intergenic
1162536360 19:11264847-11264869 AGTGAGGTGGGAGCCATGGAAGG - Intergenic
1162836009 19:13318454-13318476 AGTGAGGGGGGAGCCGTGGAGGG + Intronic
1162998406 19:14350861-14350883 AGGGAGGAGGCACTTCTGGAAGG - Intergenic
1163000142 19:14362115-14362137 AGTGAGGTGGGAGCCCTGGAGGG + Intergenic
1163517594 19:17774478-17774500 TGTGAGGAAGCACCCCTGCCCGG + Exonic
1164938247 19:32231340-32231362 ACTGAGAAGGCACCCTTGGTGGG - Intergenic
1165345638 19:35247754-35247776 AGTGAGGAGGAGCCACAGGAGGG + Intergenic
1165884721 19:39069825-39069847 AGTGAAGAGGCACCTCAGGATGG + Intergenic
1167158340 19:47752618-47752640 ACTGAGGAGGGAGGCCTGGACGG - Intronic
924970455 2:122143-122165 AGTGAGGAGGCTGTCATGGAAGG + Intergenic
930071516 2:47369767-47369789 AGTGAGGCTGCTCCCCGGGACGG - Intronic
934697438 2:96410157-96410179 AGTCAGGAGGCAGCCCAGGGTGG - Intergenic
937921445 2:127134579-127134601 GAAGCGGAGGCACCCCTGGAGGG + Intergenic
938295083 2:130172857-130172879 AGGGAGGATGCACTCCTGGATGG + Exonic
938461543 2:131500978-131501000 AGGGAGGATGCACTCCTGGATGG - Intergenic
939558878 2:143710485-143710507 AACGAGGAGGCACTGCTGGAAGG - Intronic
940200794 2:151147929-151147951 AGTGAGGAGGCAAAGCTAGAAGG - Intergenic
946179373 2:217940647-217940669 TGTGAGGGGGCTCCCCTGGTCGG + Intronic
946180953 2:217948608-217948630 AGTGAGGAGGCCCCACTAGGGGG - Intronic
947549619 2:231037331-231037353 CGGGAGGAGCCACCCTTGGAGGG + Intergenic
947926697 2:233927627-233927649 AGTGACGAAGCACCTCTGGGAGG + Intronic
948313122 2:237004620-237004642 AGTGAGGATGCAGCGCTAGACGG + Intergenic
948829850 2:240593324-240593346 AGAGAGGAGGGTCTCCTGGAAGG - Intronic
1168877465 20:1181338-1181360 AGTGAGGAGACACCCCCAGGGGG + Exonic
1172271282 20:33657071-33657093 AGACAGGAGGCAACACTGGAAGG + Exonic
1174363234 20:50041249-50041271 AGTGGGGTGGGAACCCTGGAGGG - Intergenic
1175208503 20:57330088-57330110 GCTGAGGAGGCACCCCTTGGCGG + Intronic
1175302861 20:57955274-57955296 AATGATGAGGCACCGCTGTATGG + Intergenic
1175825588 20:61934790-61934812 GGTCAGGCGGCAGCCCTGGAAGG - Intronic
1175908160 20:62391966-62391988 AGAGCAGAGGCACACCTGGACGG + Intronic
1175940101 20:62533849-62533871 AGTGACGAGGCATCCCTGCTTGG + Intergenic
1175942827 20:62545872-62545894 GGTGAGGAGGCAGCCCTGCCCGG + Intergenic
1177324909 21:19573113-19573135 AGTGAGGAGGTAGCTCTGGAAGG - Intergenic
1178266823 21:31151099-31151121 AATGAGGAGGAACTGCTGGAGGG + Intronic
1179437047 21:41369299-41369321 AGTGAGGAGGGACCCCAGGTGGG + Intronic
1180154903 21:45973009-45973031 AGGGAGGAGGCTTCCCGGGAAGG - Intergenic
1180252801 21:46600600-46600622 GGTGGGGAGGCACCTGTGGATGG + Intronic
1182424851 22:30266549-30266571 AGAGAAGGGGCATCCCTGGAAGG - Intronic
1182693463 22:32179558-32179580 TGGGAGGAGGCAGCTCTGGAGGG - Intergenic
1183056824 22:35311927-35311949 ACTGAGGAGCCAACCCTGGGTGG + Intronic
1183442309 22:37830140-37830162 AGTGGGCAGGCTCACCTGGAGGG + Intergenic
1184888715 22:47366534-47366556 GGTGAAGACGCACCCCTCGAGGG + Intergenic
1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG + Intronic
1185312383 22:50163212-50163234 AGTGAGGAGGCTGCCCTGGAGGG + Intergenic
950494288 3:13324402-13324424 AGGCAGGAGGCACACCTGGGTGG - Intronic
950557838 3:13706016-13706038 ACTGAGGAAACACCCCTGCAAGG + Intergenic
950642934 3:14360096-14360118 TCTGAGGAGGAACCCCTGGAAGG - Intergenic
950670160 3:14521150-14521172 AGTGAGGAGGCTGCCGTGGTTGG - Intronic
952175803 3:30861394-30861416 AGTAAGGAGGCAACCCTTCAAGG + Intronic
953378845 3:42451327-42451349 AGTGAACAGGCAACCCTGGTTGG - Intergenic
953603602 3:44391669-44391691 AGTGAAGAGGCCCTCCTGGAAGG + Intronic
954324841 3:49857931-49857953 ACTGGGGAGGAGCCCCTGGAAGG - Intergenic
954628043 3:52033404-52033426 AGTGGGGAGGGAGCCCTTGAAGG - Intergenic
960307464 3:116079253-116079275 AGTGAGGAGGCATCTCCGAAGGG - Intronic
961672140 3:128541190-128541212 ACTAAGGATGCACCCCTGAATGG + Intergenic
962160663 3:132996405-132996427 AGTAAGATGGCAGCCCTGGATGG + Intergenic
962342915 3:134600439-134600461 AGTGAGGAGGCTGTCCTGGTAGG + Intronic
965140626 3:164829342-164829364 AGAGGGGAGCCACCCATGGAAGG - Intergenic
968531454 4:1094122-1094144 ACTGAGGATGGACCCCTGCATGG - Intronic
968764118 4:2459258-2459280 GGTGAGGATGCAGTCCTGGACGG + Exonic
969033813 4:4234681-4234703 ACTGAGGCTGCAGCCCTGGAAGG - Intergenic
969251580 4:5971878-5971900 AGTGAGGAGCAGCCCTTGGAAGG + Intronic
969316941 4:6388139-6388161 AGGGAGGAGGCACCTCAGGGGGG - Intronic
969585258 4:8087861-8087883 TGTGAGGAGGCAGCCAGGGATGG - Intronic
977260303 4:94789036-94789058 AGTGCCCAGGTACCCCTGGATGG + Intronic
979588680 4:122451129-122451151 TGTGAGGAGGCTCACCTGTATGG - Intergenic
983412558 4:167418703-167418725 AGGGATTAGGCACCACTGGATGG - Intergenic
985246297 4:187982925-187982947 AGTGAAGGGGCAGCTCTGGAGGG + Intergenic
985428432 4:189854665-189854687 AGTGAGGATGGACTGCTGGATGG + Intergenic
985854146 5:2412004-2412026 AGTGAGGAGGCGCCCTGGGAAGG - Intergenic
986559285 5:9044520-9044542 GGTGAGGAGGCAGCCGAGGATGG + Exonic
987081200 5:14427168-14427190 GGTGAGGAGGCAGTCCTGGAGGG - Intronic
988773282 5:34452646-34452668 CATAAGGAGGCAGCCCTGGATGG - Intergenic
990173720 5:53083771-53083793 AGAGTGGAGGAACCCCTAGAGGG - Intronic
991387511 5:66106342-66106364 TGTGAGGCGGCAACCCTGGCTGG + Intergenic
992796497 5:80258573-80258595 AGTGGGGAGGCACCACAGGTAGG - Intergenic
993333136 5:86624240-86624262 AGGCAGGAGGATCCCCTGGAGGG - Intergenic
998013605 5:138714959-138714981 AGAGAGGAGGGTGCCCTGGAGGG + Intronic
999373100 5:151068171-151068193 TCAGAGGAGCCACCCCTGGAGGG + Intronic
999437138 5:151571570-151571592 AGAGAGAATGCACCCTTGGATGG + Intergenic
1001053796 5:168433079-168433101 TGTGAGGAGACACAGCTGGAAGG - Intronic
1001287789 5:170436319-170436341 AGTCAGGAGGCTACCCTGCAGGG + Intronic
1002060020 5:176620555-176620577 TGGGAGGAGGCAACACTGGAGGG + Exonic
1002360693 5:178668465-178668487 CGTGAGGAGGAGCCTCTGGAGGG - Intergenic
1004484900 6:16057279-16057301 AGTGAGGAGGCCACTGTGGAAGG - Intergenic
1004752202 6:18573927-18573949 AGTGAGGATACTCCCGTGGAAGG + Intergenic
1006154896 6:32008691-32008713 AGTGAGCTGGTACCACTGGAAGG - Intergenic
1006161209 6:32041426-32041448 AGTGAGCTGGTACCACTGGAAGG - Exonic
1007124632 6:39415421-39415443 AGGGAGGAGACACACCTGTAAGG - Intronic
1007501968 6:42305270-42305292 AGTAAAGAGGCAGCCCTGGAGGG + Intronic
1007609946 6:43142858-43142880 ACTGAGGAGGCCCCCTTGGTGGG + Intronic
1010359818 6:74979576-74979598 GGTGAAGAGACACACCTGGAGGG + Intergenic
1013012752 6:106134842-106134864 AGTGACCAGGCCCCCGTGGAGGG + Intergenic
1013177821 6:107692299-107692321 AGTTAGGAGCCACTCCTAGATGG + Intergenic
1018580208 6:165301824-165301846 AGAAAGGAGGCCCTCCTGGACGG - Exonic
1018790182 6:167142317-167142339 AGGGCAGAGGCACCCCTGGAAGG - Intergenic
1018798087 6:167202761-167202783 AGTGAGGGGACGGCCCTGGAAGG + Intergenic
1018814625 6:167321415-167321437 AGTGAGGGGACGGCCCTGGAAGG - Intergenic
1019003392 6:168775464-168775486 GGTGAGGAGTCTCCTCTGGAAGG - Intergenic
1020090259 7:5334808-5334830 AGAGAGGAGGCTCACGTGGAAGG + Intronic
1020366181 7:7382885-7382907 ATTTACGAGGCACTCCTGGAAGG + Intronic
1021923561 7:25512684-25512706 AGTGATGAGGCACTTCTGGGAGG + Intergenic
1021947622 7:25743646-25743668 TGTGAGCAGGCAACCCTGCAGGG - Intergenic
1022614677 7:31917070-31917092 AATGAGGCAGTACCCCTGGATGG + Intronic
1024143031 7:46481067-46481089 AGAGAGAAGGCAGCCCAGGAAGG - Intergenic
1025099471 7:56123154-56123176 AGTGGGCAGGCTCACCTGGAGGG - Intergenic
1025741117 7:64196577-64196599 AGTAAGTAGGCACAGCTGGAAGG - Intronic
1025990356 7:66492642-66492664 AGTGGGCAGGCTCACCTGGAGGG - Intergenic
1027213009 7:76165634-76165656 AGTGGGCAGGCTCACCTGGAGGG - Intergenic
1029443876 7:100602479-100602501 AGTGAGGAGGGGCCCCAGGAGGG - Exonic
1031282990 7:119828456-119828478 AATGAGAAGGCAGCCATGGAGGG + Intergenic
1031374107 7:121003704-121003726 AGAGTGGAGGCACCTCTCGAGGG + Intronic
1031634960 7:124091399-124091421 AGTGAGGAAGGACTCCTAGAAGG - Intergenic
1032022743 7:128418929-128418951 AGTGAGCAGGCCGTCCTGGATGG + Intergenic
1032933179 7:136697620-136697642 AGTGGAGATGCACCCTTGGAAGG + Intergenic
1033028841 7:137805415-137805437 AGAGAGGAGCTACCCCTGAATGG + Intronic
1033530019 7:142252471-142252493 AGGAAGGAGGCAGCCCTGCAAGG - Exonic
1034449728 7:151130840-151130862 GGTGAGGTGGCAGCCCCGGAGGG - Intronic
1035293698 7:157855591-157855613 AGTGATGGGGCTTCCCTGGAAGG + Intronic
1037584885 8:20269459-20269481 ACTAAGTGGGCACCCCTGGAAGG + Intronic
1038483246 8:27915950-27915972 AGAGGGGAGGCAGCCCAGGAGGG - Intronic
1039849312 8:41348575-41348597 AGTGAGGAAGATCTCCTGGATGG + Intergenic
1043706322 8:83355811-83355833 AATAAGGAGGCACAGCTGGAAGG + Intergenic
1045643082 8:104273163-104273185 AGTGAGGAGGCACATCCGTAGGG + Intergenic
1047251618 8:123185361-123185383 GGTGAGGAAGGATCCCTGGAAGG + Intronic
1048899494 8:139023994-139024016 GGTGAGGAGGGACACGTGGAGGG + Intergenic
1048938569 8:139377213-139377235 AGTGAGGAGGGAGCAGTGGAGGG - Intergenic
1049421955 8:142520972-142520994 GGTGAGGATGGACCCCAGGAGGG + Intronic
1049666002 8:143842972-143842994 AGTGAGAAGGGACCACTGGGGGG - Intergenic
1054831888 9:69634309-69634331 ACTCAGGTGGCACCCATGGAGGG + Intronic
1055985644 9:82055310-82055332 AGTGAGTAGGCCCCACTGAATGG - Intergenic
1056585688 9:87925812-87925834 AGTGAGTAGGCCCCACTGAATGG + Intergenic
1056813960 9:89786888-89786910 AGTGAGGAGGAACTCCAGAAAGG + Intergenic
1057412069 9:94825542-94825564 AGGGAGGGCGCTCCCCTGGAAGG - Intronic
1057743163 9:97730180-97730202 AGAAAGGAGGCAACCCTGGGTGG + Intergenic
1057780780 9:98048293-98048315 AATAAGCAGGCACACCTGGAAGG - Intergenic
1058303498 9:103407334-103407356 AGTGATGTGCCAGCCCTGGATGG + Intergenic
1060000989 9:119958506-119958528 AATGAGGGGGCAACCCTGCAAGG - Intergenic
1060306728 9:122420495-122420517 AATAAGGAGGCACAGCTGGAAGG + Intergenic
1060583184 9:124770519-124770541 TGGGAGGAGGAACCCCTGTAGGG + Intronic
1061060017 9:128245454-128245476 AGGGAGGAGGTACCCCAGGATGG - Intronic
1061412438 9:130428916-130428938 ACTTAGGTGCCACCCCTGGATGG + Intronic
1062011425 9:134269008-134269030 AGTGAGGAGGCGGTCCTGGTGGG + Intergenic
1062366463 9:136211760-136211782 AGGTGGGAGGCGCCCCTGGAAGG - Intronic
1203787663 EBV:136801-136823 AGTAAGGAGGCACGGGTGGAGGG - Intergenic
1186659747 X:11657686-11657708 AGTGAGGAGTCTCCCCCAGAGGG + Intronic
1190137632 X:47811780-47811802 AGTAAGCAGGCACAGCTGGAAGG + Intergenic
1190212657 X:48460392-48460414 AGGGAGGAGGCACAGATGGATGG - Intronic
1190303471 X:49069264-49069286 AGTCAGGAGGCCCCACAGGAGGG + Intronic
1191691812 X:63947309-63947331 AGTGAGGAGGCAGTTCTAGAGGG + Intergenic
1192639416 X:72847894-72847916 AGTGAAGAAACACCCCTGGAGGG + Intronic
1192642295 X:72872911-72872933 AGTGAAGAAACACCCCTGGAGGG - Intronic
1197557765 X:127976858-127976880 ACATATGAGGCACCCCTGGATGG - Intergenic
1199484900 X:148337115-148337137 AGTGAGTAAGCACACCTGGAGGG + Intergenic