ID: 1185045850

View in Genome Browser
Species Human (GRCh38)
Location 22:48528400-48528422
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045841_1185045850 5 Left 1185045841 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG No data
1185045840_1185045850 6 Left 1185045840 22:48528371-48528393 CCCGATGCCTGTGTATAGCCAAG No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG No data
1185045838_1185045850 12 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG No data
1185045839_1185045850 7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG No data
1185045843_1185045850 -1 Left 1185045843 22:48528378-48528400 CCTGTGTATAGCCAAGGCCATAG No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type