ID: 1185045850

View in Genome Browser
Species Human (GRCh38)
Location 22:48528400-48528422
Sequence GTGAGGAGGCACCCCTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045843_1185045850 -1 Left 1185045843 22:48528378-48528400 CCTGTGTATAGCCAAGGCCATAG No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238
1185045838_1185045850 12 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238
1185045840_1185045850 6 Left 1185045840 22:48528371-48528393 CCCGATGCCTGTGTATAGCCAAG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238
1185045841_1185045850 5 Left 1185045841 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238
1185045839_1185045850 7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045850 Original CRISPR GTGAGGAGGCACCCCTGGAA GGG Intronic
900557774 1:3288788-3288810 GGGAGCAGACATCCCTGGAAGGG + Intronic
900901268 1:5517941-5517963 GTGAGGAGGCACCTTATGAAAGG - Intergenic
904128783 1:28260389-28260411 GCCGGGAGGCACCCCAGGAAGGG - Intronic
907208364 1:52795326-52795348 GTAAGGAAGCACCACTGGGAAGG - Intronic
907372451 1:54012098-54012120 GTGTGGGGGAACCCCTGGGAGGG + Intronic
907388280 1:54139871-54139893 GCGAGGAGGCACCCCTGCTGGGG - Exonic
907552833 1:55318801-55318823 CTGAGGAGACACCCTTGGGATGG + Intergenic
907679282 1:56548589-56548611 GTGAGGAGTCTCCCCTTCAAAGG - Intronic
909743621 1:79065099-79065121 TTGAGGATGCACAGCTGGAATGG - Intergenic
910213660 1:84819775-84819797 GTGAGAAGGCATTCCTGGCACGG - Intronic
913043866 1:115056885-115056907 GTGAGGAGACAGCACGGGAAGGG - Intronic
914796818 1:150926658-150926680 GGTAGGACGCACCCCTAGAATGG + Intronic
914825133 1:151134111-151134133 GGGAGGAAGGACCCCTGGAAGGG - Intronic
915552879 1:156645351-156645373 GGGAGGAGGCAGCCAAGGAAGGG + Intronic
915693848 1:157718435-157718457 ATTAGGAGGTACCCCTGGAGAGG - Intergenic
916851872 1:168712312-168712334 GTGAGGAGGTAGCCCTGCACGGG - Intronic
917241315 1:172951494-172951516 GGAAGGTGGCACACCTGGAAAGG + Intergenic
920719184 1:208371063-208371085 GTGATGAGGGATGCCTGGAAAGG - Intergenic
1063313407 10:4978276-4978298 GGGAGGAGGCATCCCTGTGAGGG + Exonic
1063314545 10:4989441-4989463 GGGAGGAGGCATCCCTGTGAGGG - Exonic
1063579958 10:7297360-7297382 GTGAGGAAACACACCTGGAGAGG - Intronic
1067087415 10:43250260-43250282 GAGAGGAGGGCCACCTGGAATGG + Intronic
1067222828 10:44356439-44356461 GGGAGGATGCACCTGTGGAATGG + Intergenic
1067797790 10:49333367-49333389 GTGAGGAGTGACCCCTGCACAGG + Intergenic
1069888248 10:71637343-71637365 GAGAGGAGGCATCCCTGGGAAGG - Intronic
1070668528 10:78362208-78362230 GAGAGGAGCCACCACTGGGACGG - Intergenic
1070779099 10:79127230-79127252 GGGAGGAGCCACACCTGGAGAGG - Intronic
1071492077 10:86143076-86143098 GTGAGGAGCCACCGCTGGCAAGG - Intronic
1071590540 10:86868586-86868608 GCGGGGAGGGACCCCTGGAAAGG + Intronic
1072643452 10:97232573-97232595 GTGAAAAGGCAACCCTGGATTGG - Intronic
1073395815 10:103216590-103216612 GGGAGGGGGCATGCCTGGAACGG + Intergenic
1075318173 10:121468603-121468625 GGGAGCAGGCACCCCTGGGGTGG + Intergenic
1076300813 10:129424973-129424995 GGGAGGAAGCTTCCCTGGAAGGG + Intergenic
1076947092 10:133658842-133658864 GTCACGAGACACCCCTGGCAAGG + Intergenic
1077170148 11:1162472-1162494 GTGAGGAGAGACCCCAGGCAGGG - Intronic
1077672468 11:4168318-4168340 CTGGAGAGGCACCCCTGGGAGGG - Intergenic
1080642005 11:34163697-34163719 GTGAGGAGGAGCCCTTGGGAGGG - Intronic
1081754639 11:45535904-45535926 GTGAGGAGACACTCCTGGAGGGG - Intergenic
1081869757 11:46377904-46377926 GTGATGTGGCACCCCTGCAGAGG - Intronic
1083451945 11:62752177-62752199 GAGAGGCTGCACCCCTAGAAGGG + Exonic
1084074399 11:66761957-66761979 GTGAGGAGGAACCCTCGCAAGGG - Intronic
1085013585 11:73158030-73158052 GAAAGGAGGCAACCCTGGAGGGG + Intergenic
1087156926 11:94913930-94913952 GGGAGGGGGCATACCTGGAATGG + Intergenic
1087846353 11:102977900-102977922 GTAAGGAGTCACTCCTGGAAAGG + Intergenic
1088139640 11:106600156-106600178 GTGAAAAGGCAACCATGGAATGG + Intergenic
1088798138 11:113282077-113282099 AAGAGGAGGCCACCCTGGAAAGG - Intergenic
1089631968 11:119789488-119789510 GTGAGCTGTCACCCCGGGAAGGG + Intergenic
1090826308 11:130389066-130389088 TTGAGAGGGCTCCCCTGGAAAGG - Intergenic
1090830225 11:130416073-130416095 GTGAGGAGGCACAGCTGGAGGGG + Intronic
1091012375 11:132014829-132014851 GTGAAGAGACACCTGTGGAATGG - Intronic
1091352098 11:134906000-134906022 GTGGGGAGGCGATCCTGGAATGG + Intergenic
1091750296 12:3018019-3018041 GTGAGGAGACAGCTCTGAAAAGG - Intronic
1092547851 12:9467188-9467210 GTGAGGAGGCCCACCTGTGAGGG - Intergenic
1092673005 12:10884314-10884336 GCGAGGAGGCCCACCTGGTAGGG - Intronic
1092676715 12:10929155-10929177 GCGAGGAGGCCCACCTGGTAGGG + Intronic
1093929098 12:24937248-24937270 GTGATAAGGCACCCCTGGATGGG + Intronic
1095976014 12:47941712-47941734 GTGAGGAGGCGGCTGTGGAAGGG + Intronic
1096800523 12:54107364-54107386 GTGAGGAGGCACCGCTAAGACGG - Intergenic
1098243896 12:68496387-68496409 GTCAGGAGGATCTCCTGGAAGGG - Intergenic
1100641894 12:96489962-96489984 CAGAGGAGGGACCCCTGGAAAGG + Intronic
1101219128 12:102618349-102618371 GTGATGTGGCCCCTCTGGAAAGG - Intergenic
1101578150 12:106016796-106016818 GGGAGGGGGCATGCCTGGAATGG + Intergenic
1102713480 12:114949319-114949341 CTGGGGAGGCACCCGTGGGATGG + Intergenic
1103248269 12:119477121-119477143 GTGAGGAGGCCCACAGGGAAAGG - Intronic
1105254580 13:18734473-18734495 GTGAGGAGGACACACTGGAAGGG + Intergenic
1105933028 13:25070030-25070052 GTGAGGAGGAAGGACTGGAAAGG - Intergenic
1108413404 13:50172976-50172998 GGGAGGGGGCATACCTGGAATGG + Intronic
1109546709 13:63842324-63842346 GTGAGGAGGCACCCCCCGCGAGG + Intergenic
1114647993 14:24266368-24266390 GTGAGGTGCCACCCTGGGAAGGG - Intronic
1118615953 14:67574505-67574527 GTGAGGAGGCTCCCAGAGAAAGG - Intronic
1122372340 14:101235599-101235621 GCGAGGTGGCCCACCTGGAAGGG - Intergenic
1122408945 14:101516395-101516417 GTGGGCAGGGACCCCAGGAAGGG + Intergenic
1122807745 14:104269117-104269139 GAGAGCAGGCACCCTGGGAAGGG - Intergenic
1202921156 14_KI270723v1_random:31397-31419 GTCACGAGACACCCCTGGCAAGG + Intergenic
1202923754 14_KI270724v1_random:6183-6205 GTCACGAGACACCCCTGGCAAGG - Intergenic
1123804124 15:23853979-23854001 ATAAGGAGGCAGCCCAGGAAAGG - Intergenic
1124013488 15:25858399-25858421 GAGATGAGGCTCACCTGGAAGGG + Intronic
1128072813 15:64807926-64807948 TTGAGGGGGCACCCCTGGGGCGG + Intergenic
1129160552 15:73745284-73745306 GTGAGGAGGCAGGCCTGGCAGGG - Intronic
1130122199 15:81060745-81060767 TTGTGGAGGGAGCCCTGGAATGG - Intronic
1131308495 15:91266805-91266827 GAGAGGAAGCAACCCTGGAGGGG + Intronic
1132301903 15:100781256-100781278 GTGAGAAAGAAGCCCTGGAAGGG - Intergenic
1132478243 16:153179-153201 GTGAGGAGGGAACCGTGGAGAGG + Intronic
1134138903 16:11699642-11699664 GCAAGGGGGCACCCCTGGAGTGG + Intronic
1134629011 16:15743546-15743568 GTTAGGAGGCAGCCCAGGGAAGG - Intronic
1134680507 16:16121823-16121845 GTGAGTGGGCACCCCTGTGAGGG + Intronic
1136062544 16:27736654-27736676 GTCAGCAGGCACCCCTGAAGGGG + Intronic
1136389203 16:29951697-29951719 GGGAGGACGCAGTCCTGGAAGGG - Intronic
1141331709 16:83117163-83117185 ATGAGGAGTGAGCCCTGGAAGGG - Intronic
1142168669 16:88608202-88608224 GTGTGGAGGCACCCCCTGACTGG - Intronic
1143171994 17:4935742-4935764 GAGAGGAGGCACCCCAGGCAGGG - Intergenic
1143239880 17:5434894-5434916 GTGAGGAGGAACCCTCGCAAGGG - Exonic
1143402949 17:6657624-6657646 GTGATGAGGCTCTCCTGGCAGGG + Intergenic
1148127592 17:45244900-45244922 GTGAGGAGGGGCCCCTGGCTTGG + Intronic
1148515266 17:48211013-48211035 GGGGGGAGGCACCCCAGGAATGG + Intronic
1149672503 17:58427749-58427771 GTGAGGAGGCACCCCTTGTGGGG - Intronic
1151335550 17:73437713-73437735 ATGAGGTGGCACCGCTGGAGGGG - Intronic
1152630713 17:81409626-81409648 GTGAGGAGGGACACCTGGGGAGG + Intronic
1203170992 17_GL000205v2_random:147800-147822 GTCACGAGACACCCCTGGCAAGG + Intergenic
1153765260 18:8368579-8368601 GTAATGAGGCTTCCCTGGAAGGG + Intronic
1154057624 18:11026429-11026451 CTGAGGAGCCACTCCGGGAACGG - Intronic
1155830838 18:30513530-30513552 GAGAGGAGGCAGCCCTGGGGTGG + Intergenic
1156512530 18:37652611-37652633 GTGAAGATGCAACCCTGGGAGGG + Intergenic
1160115650 18:76076750-76076772 GTGAGGAGGCCCCCTTTGCATGG + Intergenic
1160694393 19:475541-475563 GTGAGGAGGCAGCCGTGCAGAGG + Intergenic
1161025057 19:2032935-2032957 TTGGGGAGGCCCCGCTGGAAGGG + Intronic
1162585717 19:11557163-11557185 GGGAGGAAGGACCTCTGGAATGG - Intronic
1162998405 19:14350860-14350882 GGGAGGAGGCACTTCTGGAAGGG - Intergenic
1163327853 19:16616782-16616804 GGGAGCAGGCACCACTGGAAAGG + Intronic
1165090551 19:33385983-33386005 GTGAGAAGGCAAACCTGGAATGG + Intergenic
1165106691 19:33474221-33474243 CTGAGGGGGCACCCGTGGAGTGG - Intronic
1166412011 19:42561695-42561717 GTGAGAAGGAACCCCTGCCAGGG + Intergenic
1167274031 19:48524406-48524428 GTGAGGAGGCCCACATGGAGAGG + Intergenic
928341472 2:30447039-30447061 GAGAGGAGGGACCCACGGAACGG - Intergenic
928540321 2:32278235-32278257 GTGAGGCTGAGCCCCTGGAAGGG + Intronic
929267138 2:39930662-39930684 GTGATGAGGCAGCTCTGGAGAGG - Intergenic
929468070 2:42163877-42163899 GTGAGGACGCTGCCCTGGAGTGG + Intergenic
929605325 2:43230232-43230254 GTGAGGAGGAACCTGGGGAAAGG - Intergenic
929873543 2:45777676-45777698 GAGGGTAGGCACCCCTGTAAAGG + Intronic
932339842 2:70956335-70956357 GTCAGGGGGCAGCCCTGGAATGG - Intronic
935087708 2:99864572-99864594 GTGGGCAGGCAGCCCTTGAATGG - Intronic
936523748 2:113228829-113228851 ATGACCAGGCACCCCTTGAAGGG - Intronic
938139709 2:128785487-128785509 GAGAGGACGCTGCCCTGGAAAGG - Intergenic
940520306 2:154737101-154737123 GTGAGGAGGAACCACTCAAAGGG + Intronic
947926698 2:233927628-233927650 GTGACGAAGCACCTCTGGGAGGG + Intronic
948080175 2:235199200-235199222 GTGAGGAGGCAGCACTGGGTAGG + Intergenic
948761107 2:240191529-240191551 GTGCGCAGGTACCTCTGGAAAGG - Intergenic
1170714981 20:18823717-18823739 CTCTGGAGGCACCCCTGTAAAGG - Intronic
1171795929 20:29566988-29567010 GTGAGGAGGCACCGCTAAGATGG + Intergenic
1171852305 20:30317169-30317191 GTGAGGAGGCACCGCTAAGATGG - Intergenic
1172271283 20:33657072-33657094 GACAGGAGGCAACACTGGAAGGG + Exonic
1172565962 20:35930712-35930734 GTAAGGAGCCAACCCTGCAAAGG + Intronic
1172792631 20:37516439-37516461 CTGAGGAGTCATACCTGGAAAGG - Intronic
1175208504 20:57330089-57330111 CTGAGGAGGCACCCCTTGGCGGG + Intronic
1175771447 20:61627178-61627200 CAGAGGACACACCCCTGGAACGG - Intronic
1175942828 20:62545873-62545895 GTGAGGAGGCAGCCCTGCCCGGG + Intergenic
1175946070 20:62559341-62559363 GTGAGGAGGTACCCGAGGGAGGG - Intronic
1176326976 21:5509631-5509653 GTCACGAGACACCCCTGGCAAGG + Intergenic
1176330732 21:5546580-5546602 GTCACGAGACACCCCTGGCAAGG - Intergenic
1176397025 21:6274371-6274393 GTCACGAGACACCCCTGGCAAGG + Intergenic
1176400781 21:6311320-6311342 GTCACGAGACACCCCTGGCAAGG - Intergenic
1176436376 21:6677784-6677806 GTCACGAGACACCCCTGGCAAGG + Intergenic
1176440132 21:6714733-6714755 GTCACGAGACACCCCTGGCAAGG - Intergenic
1176460638 21:7004854-7004876 GTCACGAGACACCCCTGGCAAGG + Intergenic
1176464394 21:7041802-7041824 GTCACGAGACACCCCTGGCAAGG - Intergenic
1176484199 21:7386632-7386654 GTCACGAGACACCCCTGGCAAGG + Intergenic
1176487955 21:7423581-7423603 GTCACGAGACACCCCTGGCAAGG - Intergenic
1179135870 21:38679071-38679093 GTGTGGAGGTACCCAGGGAAGGG + Intergenic
1179437048 21:41369300-41369322 GTGAGGAGGGACCCCAGGTGGGG + Intronic
1179477395 21:41656327-41656349 CTGAGCAGGAACCCATGGAATGG - Intergenic
1180079038 21:45477932-45477954 GAGGGACGGCACCCCTGGAAGGG + Exonic
1180154902 21:45973008-45973030 GGGAGGAGGCTTCCCGGGAAGGG - Intergenic
1180252802 21:46600601-46600623 GTGGGGAGGCACCTGTGGATGGG + Intronic
1181572244 22:23773879-23773901 GTGAGGAGGCAGGCCTGGCCAGG + Intronic
1182080402 22:27524725-27524747 GTGAGAAGCCAGCCTTGGAAGGG - Intergenic
1183880805 22:40827155-40827177 GGGAGGGGGCATGCCTGGAATGG - Exonic
1183977880 22:41523682-41523704 AGGAGGAGGCAACCCTGGCAGGG + Intronic
1184244143 22:43227388-43227410 GGGAGGCGGCTCCACTGGAACGG - Exonic
1184249229 22:43250791-43250813 GGGTGGTGGGACCCCTGGAATGG + Intronic
1184680073 22:46067180-46067202 GTGGGCAGGCACCCGTGAAAAGG - Intronic
1184690073 22:46113544-46113566 GGGAGATGGCACCCCAGGAAGGG - Intronic
1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG + Intronic
1185312384 22:50163213-50163235 GTGAGGAGGCTGCCCTGGAGGGG + Intergenic
949616551 3:5760015-5760037 GTGCTGAGGCAATCCTGGAAGGG - Intergenic
950557839 3:13706017-13706039 CTGAGGAAACACCCCTGCAAGGG + Intergenic
951333247 3:21390790-21390812 GTGATAAGGCATCCCTAGAAAGG - Intergenic
952509524 3:34039172-34039194 GTGAAGAGGCCCCCCTCCAAAGG - Intergenic
953351048 3:42216294-42216316 GTGAGGAGGGAGCCCTGACACGG - Intronic
953551728 3:43908502-43908524 CTCAGGCAGCACCCCTGGAAGGG - Intergenic
954124369 3:48520114-48520136 TTGAGGAGGAACCCCTGGCTTGG + Intronic
954400357 3:50316411-50316433 GTGAGGTGGTAACACTGGAAAGG - Intergenic
954591882 3:51789942-51789964 ATGAGGAGGAACCTTTGGAAGGG - Intergenic
957080367 3:75631574-75631596 GTCACGAGACACCCCTGGGAAGG - Intergenic
963293350 3:143517308-143517330 GGGAGGGGGCATGCCTGGAATGG - Intronic
968107521 3:196013145-196013167 CGGAGGAGGCACCTCTGGGACGG + Intergenic
968131006 3:196192791-196192813 GGGAGGAGGCAAGCGTGGAAAGG + Intergenic
968504493 4:965605-965627 GTGAGATGTCACCCCTGGACAGG - Intronic
968764119 4:2459259-2459281 GTGAGGATGCAGTCCTGGACGGG + Intronic
969598462 4:8161929-8161951 TTCAGGAGGCACCCCTGGCCTGG + Intergenic
970569926 4:17369657-17369679 GTTAATAGGCACTCCTGGAATGG + Intergenic
974769804 4:66397332-66397354 GTGAAGAGACAACCATGGAATGG - Intergenic
984878589 4:184390947-184390969 GTGAGGAGGCTCCCTTGGCCAGG + Intronic
985450553 4:190059641-190059663 GTCACGAGACACCCCTGGCAAGG + Intergenic
985854145 5:2412003-2412025 GTGAGGAGGCGCCCTGGGAAGGG - Intergenic
988773281 5:34452645-34452667 ATAAGGAGGCAGCCCTGGATGGG - Intergenic
990992898 5:61702412-61702434 TTAAGGAGGCACCCCCGGACAGG - Intronic
991387512 5:66106343-66106365 GTGAGGCGGCAACCCTGGCTGGG + Intergenic
997234640 5:132265750-132265772 GTGAGAAGGCAGGCCAGGAAGGG - Intronic
997796706 5:136817903-136817925 GTGAGGAGGTAGCCTTGGACTGG + Intergenic
998799594 5:145856074-145856096 GAGAGGAGACACCACTGGCAAGG - Intergenic
999891806 5:155986016-155986038 GTGTCGAGGCACCCCAGGAGAGG + Intronic
1001053795 5:168433078-168433100 GTGAGGAGACACAGCTGGAAGGG - Intronic
1002018177 5:176342691-176342713 ATGAGGAGGCAACCATGCAAAGG - Intronic
1002058380 5:176611537-176611559 GTGAGGAAGCAGCCCTGGTGTGG - Intergenic
1002060021 5:176620556-176620578 GGGAGGAGGCAACACTGGAGGGG + Exonic
1006154895 6:32008690-32008712 GTGAGCTGGTACCACTGGAAGGG - Intergenic
1006161208 6:32041425-32041447 GTGAGCTGGTACCACTGGAAGGG - Exonic
1006358354 6:33573706-33573728 TTGAGGGGGGACCCCTGCAAGGG + Exonic
1007701345 6:43768272-43768294 GTGAGGAGGCCTGCCTGGGAGGG + Intergenic
1007785869 6:44279044-44279066 GAGAGCAGGCACTCCTGGACTGG + Exonic
1008147188 6:47906181-47906203 GTGTGTAGGCACTCTTGGAATGG - Intronic
1010198487 6:73263140-73263162 GCGAGCCGGGACCCCTGGAAGGG - Exonic
1012529700 6:100220716-100220738 GAGAGCTGGCATCCCTGGAACGG - Intergenic
1014227217 6:118862041-118862063 GTGGGGTGGCACCCCTGGCCAGG + Intronic
1015979988 6:138828897-138828919 TTGAGGAGGCTCCCCTGGCCAGG - Intronic
1018798088 6:167202762-167202784 GTGAGGGGACGGCCCTGGAAGGG + Intergenic
1018814624 6:167321414-167321436 GTGAGGGGACGGCCCTGGAAGGG - Intergenic
1019003391 6:168775463-168775485 GTGAGGAGTCTCCTCTGGAAGGG - Intergenic
1020366182 7:7382886-7382908 TTTACGAGGCACTCCTGGAAGGG + Intronic
1022525892 7:31037061-31037083 GCCAGGAGGCAGCCCTGGGAGGG + Intergenic
1023012648 7:35937677-35937699 GGCAGGAGGTCCCCCTGGAATGG + Intergenic
1024082476 7:45866384-45866406 CTGAGGAGGCAGCCCTGGGTTGG - Intergenic
1024143030 7:46481066-46481088 GAGAGAAGGCAGCCCAGGAAGGG - Intergenic
1025854281 7:65264429-65264451 GTTATGAGCCACCCCTGGCAAGG - Intergenic
1026341597 7:69438948-69438970 GAGAGGTCACACCCCTGGAATGG - Intergenic
1029274699 7:99397208-99397230 ATGAGGAAGCAGGCCTGGAAAGG - Intronic
1029642300 7:101828902-101828924 GAGAGGAGCCACCCCAGGCAGGG + Intronic
1032759733 7:134928783-134928805 AAGAGGAGGCAGCCCGGGAACGG + Exonic
1033448080 7:141439294-141439316 CTGAGGAGGCAGCTCTGGCATGG - Intronic
1034088743 7:148344691-148344713 GTGAGGAGGCAGAGCTGGCATGG + Intronic
1034470342 7:151251526-151251548 GTGAGGAGGGAGCCCTGGCCCGG - Intronic
1035284831 7:157799482-157799504 GTGAGGAGGGAGCCCTGGGCTGG - Intronic
1035293699 7:157855592-157855614 GTGATGGGGCTTCCCTGGAAGGG + Intronic
1037650711 8:20835881-20835903 GTGAGGAGGTACAACAGGAAGGG + Intergenic
1039951410 8:42175729-42175751 GGGAGGAGGCATTCCTGGAGAGG + Exonic
1041749404 8:61243403-61243425 ATGAGGAGGGACTCCTGTAAAGG - Intronic
1042199349 8:66265956-66265978 GTGAAGAGGCAACCGAGGAATGG + Intergenic
1043809126 8:84712901-84712923 GTGAAGAGACAACCATGGAATGG - Intronic
1049357845 8:142197535-142197557 GTGGGGAGCCACCCCTAGAAAGG + Intergenic
1049421956 8:142520973-142520995 GTGAGGATGGACCCCAGGAGGGG + Intronic
1049744880 8:144259061-144259083 GTAGGGAGGCACCCCTGCAGAGG + Intronic
1053736616 9:41106840-41106862 GGGAGGAGGCACCCCTCGCGAGG + Intergenic
1053790090 9:41680447-41680469 GTGAGGAGGCACCGCTAAGACGG - Intergenic
1054155050 9:61634310-61634332 GTGAGGAGGCACCGCTAAGACGG + Intergenic
1054178430 9:61892136-61892158 GTGAGGAGGCACCGCTAAGACGG - Intergenic
1054474839 9:65565418-65565440 GTGAGGAGGCACCGCTAAGACGG + Intergenic
1054659099 9:67688688-67688710 GTGAGGAGGCACCGCTAAGACGG + Intergenic
1054691755 9:68324560-68324582 GGGAGGAGGCACCCCTCGCGAGG - Intergenic
1056813961 9:89786889-89786911 GTGAGGAGGAACTCCAGAAAGGG + Intergenic
1057412068 9:94825541-94825563 GGGAGGGCGCTCCCCTGGAAGGG - Intronic
1058816182 9:108684715-108684737 GTGAGGAGAAGCCCCAGGAATGG + Intergenic
1060000988 9:119958505-119958527 ATGAGGGGGCAACCCTGCAAGGG - Intergenic
1060583185 9:124770520-124770542 GGGAGGAGGAACCCCTGTAGGGG + Intronic
1061060016 9:128245453-128245475 GGGAGGAGGTACCCCAGGATGGG - Intronic
1061830549 9:133290931-133290953 ATAAGGAGGCACAGCTGGAAAGG + Intergenic
1062044923 9:134420525-134420547 GTGAGAAGGCCCCCGAGGAATGG - Intronic
1062366462 9:136211759-136211781 GGTGGGAGGCGCCCCTGGAAGGG - Intronic
1062372458 9:136247140-136247162 GGGAGGAGGCACACATGCAAAGG + Intergenic
1062459111 9:136655485-136655507 GTGGGGACGCACACCTGGCAGGG + Intergenic
1062484952 9:136770055-136770077 GTGAGGAGGCTGCCCAGGGAAGG - Intergenic
1062500275 9:136849133-136849155 GTCCGGTGGCACCCTTGGAACGG - Exonic
1203431363 Un_GL000195v1:93746-93768 GTCACGAGACACCCCTGGCAAGG + Intergenic
1186813891 X:13216764-13216786 GTTAGGAGGTACCCTAGGAAGGG - Intergenic
1189960848 X:46323618-46323640 ATGAGGAAGAACTCCTGGAAAGG - Intergenic
1190864189 X:54370831-54370853 GGAAGGTGGCACCCCTGGAGAGG - Intergenic
1192448187 X:71225769-71225791 GTGTGGAGGCATCTCTGGAGTGG - Intergenic
1193152547 X:78139927-78139949 GTGAGGAGGGACCCCCGCAAAGG - Intergenic
1193947251 X:87754081-87754103 GTGAGGATGCAACCCCAGAAAGG + Intergenic
1194388535 X:93287921-93287943 GGGAGGGGGCATGCCTGGAATGG - Intergenic
1196199276 X:112867259-112867281 GAGGGGAGCCACCCCAGGAAAGG - Intergenic
1200074464 X:153544260-153544282 ATGAGGAGGCAGCCCAGGCAGGG - Intronic
1201256985 Y:12117611-12117633 GTAAATAGTCACCCCTGGAAGGG + Intergenic