ID: 1185050958

View in Genome Browser
Species Human (GRCh38)
Location 22:48553705-48553727
Sequence CAGCCCGGAGAGAGAGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185050958_1185050971 19 Left 1185050958 22:48553705-48553727 CCCACGGCTCTCTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1185050971 22:48553747-48553769 CCTGACCTGGGGTGCAGCCCTGG No data
1185050958_1185050964 6 Left 1185050958 22:48553705-48553727 CCCACGGCTCTCTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1185050964 22:48553734-48553756 CCCTCCCTGTCTGCCTGACCTGG 0: 1
1: 0
2: 0
3: 38
4: 394
1185050958_1185050973 28 Left 1185050958 22:48553705-48553727 CCCACGGCTCTCTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1185050973 22:48553756-48553778 GGGTGCAGCCCTGGCATGCCCGG 0: 1
1: 0
2: 1
3: 44
4: 426
1185050958_1185050967 8 Left 1185050958 22:48553705-48553727 CCCACGGCTCTCTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1185050967 22:48553736-48553758 CTCCCTGTCTGCCTGACCTGGGG 0: 1
1: 0
2: 9
3: 47
4: 398
1185050958_1185050966 7 Left 1185050958 22:48553705-48553727 CCCACGGCTCTCTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1185050966 22:48553735-48553757 CCTCCCTGTCTGCCTGACCTGGG 0: 1
1: 0
2: 4
3: 56
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185050958 Original CRISPR CAGCCCGGAGAGAGAGCCGT GGG (reversed) Intronic
901404235 1:9035522-9035544 TGGCCGGGAGAGAGAGCAGTGGG - Exonic
902256623 1:15193254-15193276 CAGCCTGGAGAGGGAGGCCTAGG - Intronic
903907308 1:26696217-26696239 CAGCCCGGAGCCTGAGCCGGCGG + Exonic
904690736 1:32291938-32291960 CAGCCCGGAGAGGCCGCCGAGGG - Intergenic
911717657 1:101152772-101152794 CTGCCCTGAGACAGAGCCATGGG + Intergenic
915842320 1:159224435-159224457 CAGCCCAGACAGAGAGGAGTGGG + Intergenic
917837508 1:178952940-178952962 CAGCCCAGGGAGAGAACAGTGGG + Intergenic
920237221 1:204516252-204516274 TAGTCCGGGGAGAGAGTCGTGGG - Intergenic
920406458 1:205716798-205716820 CAGTCAGGAGATAGATCCGTAGG - Exonic
922536153 1:226382379-226382401 CAGCCTGGAGAGTGAGGCCTGGG + Intronic
1062790481 10:301207-301229 CTGTCAGGAGAGAGGGCCGTGGG + Intronic
1063266439 10:4456365-4456387 CAGCCCGGAGGCAGAGCCACTGG + Intergenic
1065286901 10:24195113-24195135 CAGCCCAGAGAGAGAGTCAAGGG - Intronic
1070160431 10:73863510-73863532 GTGCCCAGAGAGAGGGCCGTGGG - Intronic
1074881823 10:117665543-117665565 CAGGAAGGAGAGAGAGCCTTAGG + Intergenic
1075548952 10:123378151-123378173 GAGGCCCGAGAGAGAGCCGTGGG - Intergenic
1076871593 10:133197494-133197516 CTGCCTGGAGAGGGAGCCGTTGG - Intronic
1077174396 11:1182069-1182091 CAGACCGGTGACAGAGCCGCAGG + Intronic
1078883105 11:15472581-15472603 CAGCCAGGAGAGACAGCTGTCGG - Intergenic
1082784394 11:57308944-57308966 CAGGCCAGAGAGAGTGGCGTGGG - Exonic
1084500389 11:69531591-69531613 CAGCCAGGAGAGGAAGCCGTCGG + Intergenic
1092211197 12:6647419-6647441 CAAGCCGCAGAGAGAGCCGCAGG + Exonic
1096252844 12:50044440-50044462 CAGCCTGGAGTGAGAGTGGTTGG - Intergenic
1103339916 12:120215819-120215841 GAGCCCTGAGAGAGAGGCCTAGG + Intronic
1104010434 12:124926388-124926410 CAGCCCCGAGGGAGGGCCCTTGG - Intergenic
1106561912 13:30854169-30854191 CAGCCCAGAGAGAGGGCTTTTGG + Intergenic
1113891833 13:113740016-113740038 CAGCACCGAGAGAGAGCCCAGGG - Intergenic
1114259232 14:21025343-21025365 CAGCCCTGAGAGGGATCCCTCGG + Intronic
1119325936 14:73759624-73759646 CGGCCCGGAGAGGGGGCCGCGGG - Intronic
1122205518 14:100146109-100146131 CAGCCAGGCAAGGGAGCCGTGGG + Exonic
1122357908 14:101135076-101135098 CAGACCCCAGAGAGAGCCCTGGG + Intergenic
1124383855 15:29190130-29190152 CAGCCCAGAGAGAGGGCAGGTGG - Intronic
1124459021 15:29871724-29871746 CAGCCCCAAGAGAGACCCGAGGG + Intronic
1127018540 15:54717962-54717984 GAGCCAGGAGAGGGAGCCTTGGG + Intergenic
1129325523 15:74798477-74798499 CTGCCCGGAGAACGAGCCCTGGG - Intronic
1130098514 15:80874054-80874076 GAGCCAGGAGAAGGAGCCGTGGG + Intronic
1131228251 15:90642656-90642678 CAGGCGTGGGAGAGAGCCGTGGG - Exonic
1131536427 15:93241455-93241477 CAGCCAGGATGGAGAGCCATGGG - Intergenic
1133214944 16:4286388-4286410 CAGCCAGGAGGAAGAGCTGTCGG + Intergenic
1134197603 16:12170910-12170932 ATGGCTGGAGAGAGAGCCGTAGG + Intronic
1136620128 16:31423095-31423117 CTGCCTGGAGAGAGAGCCTGTGG - Exonic
1138134844 16:54512619-54512641 CCGCACAAAGAGAGAGCCGTGGG + Intergenic
1138529401 16:57626960-57626982 CAGCCCCGGGAGAGAGCAGAGGG + Intronic
1138992205 16:62405062-62405084 CAGCCAGGAGTGAGGGGCGTGGG - Intergenic
1141416280 16:83877816-83877838 CAGCCCGGAGAGTGAGCTTGTGG - Intergenic
1142059544 16:88020599-88020621 CAGCCTGGACAGAGAGGAGTGGG + Intronic
1142305103 16:89280356-89280378 CAGCCCGGAGGGAGGGGCGTAGG + Exonic
1147585412 17:41651563-41651585 CAGCCAGGAGCGAGGGCAGTGGG + Intergenic
1147686273 17:42288534-42288556 CGGCCGGGAGCGAGAGCCGCGGG + Exonic
1150255416 17:63741056-63741078 TTTCCCGGAGAAAGAGCCGTTGG - Intronic
1151836654 17:76586399-76586421 CAGCCCAGAGACTGAGCTGTCGG - Intronic
1154373222 18:13785527-13785549 CTGCACGGAGAGAGAACTGTGGG - Intergenic
1154377914 18:13824079-13824101 CCGCCCGGAGCGACAGCCGGCGG + Intergenic
1157620842 18:49016777-49016799 CTGCCCAGACAGGGAGCCGTGGG + Intergenic
1160399353 18:78598779-78598801 CATCCCACAGAGAGAGCAGTTGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1164455557 19:28403915-28403937 GAGCCCGCAGAGAGACACGTGGG - Intergenic
1164665318 19:30028502-30028524 CAGCCCAGGAAGAGAGCCCTCGG - Intergenic
1165064357 19:33220321-33220343 CAGCCAGGAGACAGGGCCCTGGG - Intronic
1166333680 19:42092571-42092593 CAGCCCCTAGAGGGAGCCATAGG - Intronic
927065630 2:19468130-19468152 CTGACTGGAGAGAGAGCCCTCGG + Intergenic
930355419 2:50312586-50312608 GAGCCTGGAGAGAGAGAGGTTGG - Intronic
932374789 2:71226511-71226533 CAGCCCGGGGAGAGGGGCGGGGG + Intronic
935725250 2:106018336-106018358 CAGCCTGGAGAGAGGCTCGTGGG - Intergenic
937692607 2:124772884-124772906 CAGCCCGGACATAGTGCCATTGG - Exonic
938377975 2:130820843-130820865 CAGCCCTTGGAGAGAGCCGCCGG + Intergenic
939061728 2:137430760-137430782 CAGCCAGGAGAGAGTGACGTTGG + Intronic
948851870 2:240712257-240712279 CAGCCAGGAGAGAGTGCAGCTGG + Intergenic
948890930 2:240906795-240906817 CAGCCAGGAGAGAGAGCCTGGGG + Intergenic
1170337519 20:15286617-15286639 CAGGCTGGAGAGAGAGAAGTGGG + Intronic
1173528574 20:43751205-43751227 CAGCCTGGTTAGAGAGCTGTGGG + Intergenic
1174037345 20:47676450-47676472 CAGTCAGGAGGGGGAGCCGTTGG + Intronic
1174112069 20:48204111-48204133 CAGCCTGGAGAGGGAGGCATGGG - Intergenic
1175987176 20:62769971-62769993 CAGCCCAGGCAGAGAGCCCTGGG - Intergenic
1176937280 21:14882004-14882026 GAGCCCTGAGAGAGATCCCTTGG - Intergenic
1179197127 21:39174862-39174884 CAGCCTTGAAAGAGAGCCCTGGG + Exonic
1179995255 21:44971202-44971224 CTGCCTGGAGGGAGTGCCGTGGG + Intronic
1183105486 22:35612139-35612161 TAGACAGGAGAGAGAGCCCTGGG - Intronic
1183432626 22:37774838-37774860 CAGGCCTGAGAGAGAGGCCTGGG + Exonic
1185050958 22:48553705-48553727 CAGCCCGGAGAGAGAGCCGTGGG - Intronic
1185334672 22:50266184-50266206 CAGCCAGGAGAGGGAGCTGCTGG + Intronic
1185400004 22:50610784-50610806 CGGCCAGGAGACAGAGCGGTGGG - Exonic
1185403250 22:50629406-50629428 CAGCCCTGAGAGAGAACAGATGG - Intergenic
1185404517 22:50640010-50640032 CAGCCCTGAGAGAGAACAGATGG - Intergenic
949400639 3:3662101-3662123 CAGCCTGGAGAGAAAGCAGCAGG + Intergenic
950553763 3:13682855-13682877 CAGCCCGGTGGGACAGCCATGGG - Intergenic
950643315 3:14362218-14362240 CAGCCCAGGGAGAGCGCTGTAGG + Intergenic
952516670 3:34111566-34111588 CAGCCAGGAAAGAGAGCCAGTGG + Intergenic
952901779 3:38115835-38115857 CAGGCTGGAGAGAGAGCAATGGG + Intronic
954132243 3:48566703-48566725 CCCCCCGGAGAGAGAGTGGTGGG - Exonic
955397352 3:58566587-58566609 CAGCGAAGAGAGAGAGCTGTAGG - Exonic
957230815 3:77511627-77511649 CAGGCCGAAGAGAGAGCCAGTGG + Intronic
958839542 3:99186852-99186874 CTGCCCTGAGAGAGAGACATTGG + Intergenic
961575370 3:127831722-127831744 CAGACCGGAGACAGAGATGTGGG + Intergenic
962232001 3:133674273-133674295 CAACCCAGAGAGAGATCCGCGGG - Intergenic
965691447 3:171361126-171361148 CAGCCAGGATAGAGAGCTGCTGG - Intronic
966919312 3:184601886-184601908 CAGCCCGGAGGGAGGGCGTTGGG - Intronic
967587792 3:191235720-191235742 CAGCCCTGACAGAAAGCCCTTGG + Intronic
969917529 4:10505246-10505268 CAGCCCGGGTGGAGAGCCGTGGG - Intronic
972240528 4:37187214-37187236 CAGAGCTGAGAGAGAGCTGTGGG + Intergenic
978074553 4:104512653-104512675 CAGCCAGGAGAGAGAACCTGTGG + Intergenic
980086293 4:128393655-128393677 CAGCAGGGAGGGAGAGCGGTGGG + Intergenic
982526324 4:156483844-156483866 TAGGCCTTAGAGAGAGCCGTTGG + Intergenic
983061545 4:163166627-163166649 GAGCCCGGAGACGGAGCCGCCGG + Exonic
986740271 5:10699795-10699817 CAGGAAGGAGTGAGAGCCGTGGG - Intronic
990739185 5:58894973-58894995 CAGCCTGGAGTGAGAGCCTATGG + Intergenic
994737533 5:103573676-103573698 CAGCCAGGATTGAGAGCCTTAGG + Intergenic
997642872 5:135460926-135460948 CAGCCCTGAGAGAGAGGACTGGG + Intergenic
998354717 5:141525371-141525393 CTGCCCACAGAGAGAGCAGTGGG + Intronic
998626378 5:143851150-143851172 CAGCACAGAGCAAGAGCCGTGGG - Intergenic
1000019873 5:157309878-157309900 CAGCCCGGGCAGAGAGCCGAGGG + Intronic
1002662262 5:180799471-180799493 CAGCGTGGAGAGAGTGCTGTGGG - Intronic
1006012337 6:31053655-31053677 GAGCAAGGAGAGAGATCCGTGGG + Intergenic
1007406816 6:41640125-41640147 CAGCCCGGAGGGACAGCTGGGGG + Intronic
1007730199 6:43940920-43940942 CAGGCCTGAGAGGGAGCCCTGGG - Intergenic
1013329746 6:109088129-109088151 CTTCCCCGAGAGAGAGACGTGGG + Intronic
1019733196 7:2638516-2638538 CAGCCCGGAGGGAGCCCCGGGGG + Intronic
1020030953 7:4932248-4932270 AGGCCCGGAGACAGGGCCGTGGG + Intronic
1022097503 7:27150259-27150281 CAGGGAGGAGAGAGAGCCCTGGG - Intronic
1023822275 7:43986784-43986806 CAGCCCGGGGAGGGGGCCGGAGG + Intergenic
1028709642 7:93892231-93892253 CAGCCCAGAGAGATAGCCTTGGG + Intronic
1029750540 7:102540198-102540220 CAGCCCGGGGAGGGGGCCGGAGG + Intronic
1029768493 7:102639306-102639328 CAGCCCGGGGAGGGGGCCGGAGG + Intronic
1030829146 7:114199056-114199078 CAGCCTGGAGTGAGTGCAGTGGG + Intronic
1032232039 7:130083055-130083077 CAGGCCAGAGAGAGAGATGTGGG - Intronic
1033223693 7:139544785-139544807 CAGCCAGGAGAGAAACCAGTGGG - Exonic
1033369784 7:140697369-140697391 TCGCCCAGAGAGAGCGCCGTCGG + Intronic
1033741246 7:144277338-144277360 CTGCACGGAGAGTGAGCCTTAGG + Intergenic
1033752657 7:144372276-144372298 CTGCACGGAGAGTGAGCCTTAGG - Intronic
1034400283 7:150857384-150857406 CAGCCTGAAGCGAGGGCCGTGGG - Exonic
1034413927 7:150955311-150955333 CAGCCTGGAGTCAGAGCCCTTGG + Intronic
1036808899 8:11853693-11853715 GAGCCCAGAGAGAGAGCCAAGGG + Intronic
1044163725 8:88953857-88953879 CAGCCAGGACAGAGAGATGTTGG + Intergenic
1048930931 8:139315010-139315032 CAGCCCAGAGAGAACACCGTGGG - Intergenic
1049406353 8:142453336-142453358 CAGCCCAGAGCCAGAGCCGACGG - Intronic
1061801278 9:133114597-133114619 CAGCCCGGCCAGAGTGCCCTGGG - Intronic
1062025877 9:134340436-134340458 CAGCCAGGAGTGAGGGCCGAGGG + Intronic
1189320335 X:40083619-40083641 CAGCCCGGAGCGCGATCGGTCGG + Intronic
1193820022 X:86149494-86149516 CAGCCCCCAGAGAAAGCCCTTGG - Intronic
1195759927 X:108235245-108235267 CAGACTGGAGAGAGAGCCAGAGG + Intronic
1196851574 X:119943560-119943582 CAGCCCGGATAGGGAGGCCTCGG - Exonic
1198097116 X:133390910-133390932 CAGGCGGGAGAAAGAGCCTTTGG - Intronic