ID: 1185051296

View in Genome Browser
Species Human (GRCh38)
Location 22:48555683-48555705
Sequence CCCCGTCATCAGCAAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185051282_1185051296 25 Left 1185051282 22:48555635-48555657 CCCACGCCACGGGCACCCCGTGG No data
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051287_1185051296 10 Left 1185051287 22:48555650-48555672 CCCCGTGGTCTGTGGCCTCCTGC 0: 1
1: 0
2: 1
3: 34
4: 226
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051289_1185051296 8 Left 1185051289 22:48555652-48555674 CCGTGGTCTGTGGCCTCCTGCAG 0: 1
1: 0
2: 1
3: 43
4: 391
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051281_1185051296 26 Left 1185051281 22:48555634-48555656 CCCCACGCCACGGGCACCCCGTG No data
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051292_1185051296 -8 Left 1185051292 22:48555668-48555690 CCTGCAGCCAGGTGACCCCGTCA 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051288_1185051296 9 Left 1185051288 22:48555651-48555673 CCCGTGGTCTGTGGCCTCCTGCA 0: 1
1: 0
2: 2
3: 29
4: 257
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051279_1185051296 28 Left 1185051279 22:48555632-48555654 CCCCCCACGCCACGGGCACCCCG 0: 1
1: 0
2: 0
3: 26
4: 224
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051291_1185051296 -5 Left 1185051291 22:48555665-48555687 CCTCCTGCAGCCAGGTGACCCCG 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051285_1185051296 19 Left 1185051285 22:48555641-48555663 CCACGGGCACCCCGTGGTCTGTG 0: 1
1: 0
2: 1
3: 16
4: 145
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051280_1185051296 27 Left 1185051280 22:48555633-48555655 CCCCCACGCCACGGGCACCCCGT 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154
1185051284_1185051296 24 Left 1185051284 22:48555636-48555658 CCACGCCACGGGCACCCCGTGGT No data
Right 1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185051296 Original CRISPR CCCCGTCATCAGCAAGGCCC AGG Intronic
900295593 1:1947542-1947564 GCTGGTCAGCAGCAAGGCCCCGG + Intronic
900593410 1:3469662-3469684 CACTGTCATCAGCAGGCCCCTGG + Intronic
901030279 1:6303489-6303511 CCCAGTCACGAGCAAGGCCTTGG - Intronic
902520265 1:17011791-17011813 CCCCGGCGTGCGCAAGGCCCTGG + Intronic
902990267 1:20182869-20182891 CCCCGCCTTCAGCAAGCCCCTGG + Intergenic
905646772 1:39630264-39630286 CACCGTCATCTGCAAGACCTCGG + Exonic
905924109 1:41737758-41737780 CCTCATCATCACCAAGGCCTTGG - Intronic
907724693 1:57008197-57008219 CCCCATAATCAGAATGGCCCTGG - Intronic
912764481 1:112396288-112396310 CCCAGCCATCACCAAGCCCCAGG - Intronic
913980321 1:143501312-143501334 CCCCACCCTCACCAAGGCCCGGG + Intergenic
914074669 1:144326800-144326822 CCCCACCCTCACCAAGGCCCGGG + Intergenic
914104507 1:144639646-144639668 CCCCACCCTCACCAAGGCCCGGG - Intergenic
914431735 1:147624884-147624906 CCACGTCAGCAGCCATGCCCCGG - Exonic
917205234 1:172564402-172564424 CTCATTCATCACCAAGGCCCTGG - Intronic
918133403 1:181648007-181648029 CACCAGCACCAGCAAGGCCCTGG - Intronic
919839086 1:201596317-201596339 CCCTGTCATCAGGAAGCCCTTGG - Intergenic
923541714 1:234893009-234893031 TTCCCTCATCTGCAAGGCCCAGG + Intergenic
923888276 1:238181746-238181768 CCCGGTGATCAGGCAGGCCCTGG + Intergenic
1062761389 10:23914-23936 ACCAGTCATCTGCAAGGCCATGG + Intergenic
1063455310 10:6178624-6178646 CCCAGTCATCTCCACGGCCCAGG - Intronic
1067907695 10:50310798-50310820 CCCTGTCCTCAACAAGGCCATGG - Intronic
1068661139 10:59624418-59624440 CACCGTCATCATCAGGGCCAGGG + Intergenic
1073291850 10:102417029-102417051 CCCCGGCCCCAGCATGGCCCAGG - Exonic
1074082384 10:110177954-110177976 CCCCTTCCTCAGAAGGGCCCCGG - Intergenic
1074859419 10:117499159-117499181 CCCTGTCATCAGCAGGCCTCTGG + Intergenic
1076742730 10:132495170-132495192 CCCCATCCAGAGCAAGGCCCTGG + Intergenic
1077352278 11:2098555-2098577 CCCCGGCTCCAGCAGGGCCCTGG + Intergenic
1077840399 11:5968239-5968261 CACCGTCATCCCCAAGGTCCTGG - Exonic
1077843780 11:6002737-6002759 CACCGTCATCCCCAAGGTCCTGG - Exonic
1077846210 11:6027437-6027459 CACCGTCATCCCCAAGGTCCTGG - Exonic
1077848029 11:6046492-6046514 CACCGTCATCCCCAAGGTCCTGG - Intergenic
1083307842 11:61770132-61770154 CCCCGTCCTGAGCCAAGCCCGGG - Intronic
1085522582 11:77147062-77147084 ACAGGTCATCAGCAAGCCCCAGG + Intronic
1086085074 11:82945532-82945554 CCCCGTACTCAGCCAGGCTCAGG - Intronic
1088848855 11:113689664-113689686 CCCAGTCCCCAGCAGGGCCCGGG + Intronic
1088893073 11:114059627-114059649 CCCCCTCCCCTGCAAGGCCCCGG - Exonic
1092058308 12:5524969-5524991 CCCCGTGAACGTCAAGGCCCAGG + Intergenic
1096983808 12:55743736-55743758 GACCGTCATTAGCATGGCCCAGG + Exonic
1099238410 12:80110407-80110429 CCCCATCACCTGAAAGGCCCCGG + Intergenic
1099994594 12:89764555-89764577 CCCCATCCTCTGAAAGGCCCTGG - Intergenic
1100219501 12:92489168-92489190 CCCAGTCACCCGGAAGGCCCCGG + Intergenic
1104042370 12:125138962-125138984 CTCCTGCCTCAGCAAGGCCCCGG - Intronic
1107053491 13:36077832-36077854 CCCCGACATCAGCATTGGCCAGG - Intronic
1113747714 13:112756539-112756561 CCCCGCCATCCGCTAGACCCTGG - Intronic
1114612509 14:24052061-24052083 ACCCGGCTTCAGCAGGGCCCGGG - Exonic
1115217282 14:31026112-31026134 CCCCGGCAGCAGCAGGGACCTGG - Exonic
1116025394 14:39508391-39508413 CCCAGTCCCCAGAAAGGCCCAGG + Intergenic
1119099739 14:71868810-71868832 CCCCATCATTAGGAATGCCCCGG - Intergenic
1122408180 14:101512602-101512624 CACCATCAGCAGCCAGGCCCGGG - Intergenic
1122530090 14:102419268-102419290 CCTCCTCATCAGCAGGGCCAAGG + Intronic
1122882838 14:104697726-104697748 CCCCGTCCTCTGGAAGCCCCAGG + Intronic
1122976470 14:105172886-105172908 CCCAGTCCTCTCCAAGGCCCTGG + Intergenic
1123040115 14:105487004-105487026 CTCCGTCCTCAGTCAGGCCCGGG + Intergenic
1128439408 15:67690500-67690522 CCCCTTTACCAGCAAGTCCCTGG - Intronic
1128632339 15:69279649-69279671 CTCCAGCATCAGCATGGCCCGGG + Intergenic
1128757904 15:70195845-70195867 GCCTGCCATCAGCAAGGCCCTGG - Intergenic
1129182780 15:73887496-73887518 GCAAGTCAGCAGCAAGGCCCAGG + Intronic
1129340404 15:74882202-74882224 CCCAGGCCTGAGCAAGGCCCGGG - Intergenic
1129852341 15:78800589-78800611 CCCGGCCACCAGCAAGGACCCGG - Intronic
1132326787 15:100977332-100977354 ACCCCTCACCAGCAAGGGCCAGG + Intronic
1132709741 16:1261146-1261168 CCCCGGCATCAGGGAGGTCCTGG + Intergenic
1133051592 16:3120255-3120277 CCCCAGCATCAGCATGGCCAGGG - Exonic
1134136765 16:11681670-11681692 CCCCCTCATCACCCTGGCCCAGG + Intronic
1135649102 16:24189832-24189854 CCCCATCATCAGCAAGTCCTGGG + Intronic
1136622708 16:31440978-31441000 CCCTGTCATCAGCCTTGCCCAGG + Intronic
1136800131 16:33062392-33062414 CCCCATCCCCACCAAGGCCCGGG + Intergenic
1137618400 16:49859602-49859624 ACCCGTGAGAAGCAAGGCCCAGG - Intergenic
1137707783 16:50547773-50547795 CCCCGTTATCAGCCAGTCTCTGG - Intergenic
1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG + Intronic
1144782074 17:17813441-17813463 CCCCGCCATCAGCCGGGCCGTGG + Exonic
1145124261 17:20287042-20287064 CACCCTCATCAGCAGAGCCCAGG - Intronic
1146659886 17:34658739-34658761 CCTATTCATCTGCAAGGCCCAGG + Intergenic
1147605527 17:41771951-41771973 CCACATCATCACCATGGCCCAGG + Intronic
1149555236 17:57568906-57568928 CCCCGGTACCAGCCAGGCCCAGG - Intronic
1149665963 17:58364913-58364935 CCCAGACAGCAGCAAGGCCCAGG + Intronic
1150636211 17:66915124-66915146 CCACAGCATCAGCAAGACCCAGG - Intergenic
1150639399 17:66939387-66939409 GCCTGTCACCAGCAAGGGCCAGG - Intergenic
1150674056 17:67229079-67229101 CCCACTGAGCAGCAAGGCCCTGG + Intronic
1151656013 17:75496339-75496361 CACCAGCATCAGCATGGCCCAGG + Exonic
1152032577 17:77853423-77853445 CCACATCATCAGCATGACCCTGG + Intergenic
1152954296 18:24244-24266 ACCAGTCATCTGCAAGGCCATGG + Intergenic
1160923811 19:1533471-1533493 CCCGGTCACCAGCACAGCCCAGG - Intronic
1161118192 19:2511163-2511185 CTCCCTCCCCAGCAAGGCCCGGG + Intergenic
1162460152 19:10810044-10810066 CCCCGTCATGAGCGTGGCCGTGG + Intronic
1162545061 19:11324310-11324332 CCTTGTCATCGGCAGGGCCCAGG - Exonic
1163685588 19:18710084-18710106 CCCCGTGAGCACAAAGGCCCTGG - Intronic
1164088751 19:21928957-21928979 CCCCTCTATAAGCAAGGCCCAGG - Intergenic
1165012632 19:32859811-32859833 CCCCGCCAGCAGCGATGCCCGGG + Intronic
1165871356 19:38975664-38975686 CCCCGTGATCGGCGTGGCCCAGG + Exonic
1166852386 19:45766914-45766936 CCCCGTCATCATCAACGGCCTGG - Exonic
926989692 2:18664644-18664666 CCTCGTCATCAGGGAGGCCTGGG + Intergenic
929918602 2:46156204-46156226 CCCCGTCATCTGCTGGGCTCTGG + Intronic
931753858 2:65354321-65354343 CCACGGCATTAGCAATGCCCAGG + Intronic
932188364 2:69717738-69717760 CCCAGGCATCAGGAAGGCTCAGG - Intronic
936485895 2:112925497-112925519 CCAGGCCATCAGCAATGCCCAGG + Intergenic
946113212 2:217438214-217438236 CACAGACATCAACAAGGCCCTGG + Intronic
948643795 2:239391438-239391460 CCCGGTCAGCAGCAGGCCCCGGG + Intronic
1169596383 20:7204283-7204305 CCCCAGGATCAGCAAGGCCCAGG + Intergenic
1172637863 20:36422121-36422143 CCCAGGCAGCAGCAAGGCCCTGG + Intronic
1173011939 20:39190829-39190851 CCCTGTCCTCAGCTATGCCCTGG - Intergenic
1175112438 20:56658095-56658117 CTCTGTCATCACCAAGACCCAGG - Intergenic
1175757206 20:61537425-61537447 CCAGGTCATCAGGGAGGCCCAGG + Intronic
1176141739 20:63547853-63547875 TCCCGCCCTCTGCAAGGCCCAGG + Intergenic
1176145571 20:63563895-63563917 CCGCGACCTCCGCAAGGCCCTGG - Exonic
1179909840 21:44441911-44441933 CCCCATCATGTGCAGGGCCCAGG - Exonic
1181081036 22:20415260-20415282 CCCCATCCTCAGACAGGCCCCGG + Intergenic
1181274795 22:21681661-21681683 CCGCGTCTTCAGCAAAGCCCAGG + Intronic
1183934980 22:41256870-41256892 CCCAGCCCTCAGCAAGCCCCGGG + Intronic
1184652614 22:45925994-45926016 CCCGGTCTTCATCAAGGCCAGGG + Intronic
1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG + Intronic
1185163787 22:49245237-49245259 GCCGGGCATCAGCCAGGCCCAGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954807079 3:53226831-53226853 CCCCTTCACCATCAAGCCCCTGG - Exonic
954862985 3:53705651-53705673 AACCCTCATCAGCAAGGCTCTGG - Intronic
954954788 3:54509610-54509632 TACAGTCCTCAGCAAGGCCCAGG + Intronic
961437704 3:126931039-126931061 CCCTGTCATCAGAAAGTCCTGGG + Intronic
966306731 3:178544452-178544474 CCCCCTCCTCATCAAAGCCCGGG + Intronic
969166836 4:5323297-5323319 CCCCTCCACCAGCCAGGCCCTGG + Intronic
972939044 4:44174948-44174970 GACCCTCATCAGCAAGTCCCGGG - Exonic
974505533 4:62766015-62766037 CCCTGTCATCAGCAATGACAGGG - Intergenic
976205605 4:82620648-82620670 CCCCCTATTCAGTAAGGCCCAGG + Intergenic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
981694140 4:147542389-147542411 GCCCCTCATTAGCATGGCCCAGG + Intronic
986721140 5:10562790-10562812 ACCCGGCATCTGCAGGGCCCCGG - Intergenic
987138961 5:14926329-14926351 CTCCATCATCAGCAAAGCCAGGG - Intergenic
992783582 5:80149553-80149575 CGCAGTCAGCAGCAAGGACCAGG + Intronic
997266253 5:132496894-132496916 CACCGCCAGCTGCAAGGCCCAGG - Intergenic
998175072 5:139896752-139896774 CTCCATCATCTGCCAGGCCCTGG + Intronic
1001584392 5:172823532-172823554 CCCCGTGTCCAGCAAGGCCAGGG - Intergenic
1005015912 6:21375410-21375432 CCCCCTCATCAGAAACTCCCTGG - Intergenic
1005408311 6:25515722-25515744 CACCATCATCATCAATGCCCTGG + Exonic
1011649049 6:89489115-89489137 CCCCTTCAGGAGCAATGCCCTGG - Intronic
1011740660 6:90356202-90356224 CCCCAGCTTCAGCAAGGGCCTGG - Intergenic
1014194073 6:118532341-118532363 CCCCCTCATCAAGTAGGCCCTGG - Intronic
1014728990 6:125008492-125008514 CCCAGTCATCAGCACAGTCCAGG + Intronic
1017781683 6:157720388-157720410 CCCCTCCCTCAGGAAGGCCCTGG + Intronic
1018228725 6:161655343-161655365 CACCGTCATTAGCATGGGCCTGG + Intronic
1021313479 7:19118267-19118289 CCACGTCTTCAGAAACGCCCAGG - Intergenic
1023612109 7:41981667-41981689 CCCTGTCAGCAGCGAGGCACAGG - Intronic
1025111116 7:56217129-56217151 CCCCAACATCGGCAATGCCCAGG - Intergenic
1025987148 7:66463758-66463780 ACCAGTCATCAGAAAGGCACGGG - Intergenic
1026866672 7:73828241-73828263 ACCCGTCCTGGGCAAGGCCCTGG + Intronic
1034413688 7:150954293-150954315 CCCCCTTATCAGCAGGGGCCTGG - Intronic
1035707419 8:1687979-1688001 CCTCGTCATCAGCGAGTCCAGGG + Intronic
1039431983 8:37532016-37532038 TCCTGTCATCAGCATGACCCGGG + Intergenic
1040392561 8:46962162-46962184 CCCCTCCAGCAGCAAAGCCCTGG - Intergenic
1040562465 8:48536136-48536158 CCACCTCATCAGCCAGGCCTGGG + Intergenic
1045414631 8:101953620-101953642 GCCTGTCATGAGCAAGGCTCTGG - Intronic
1048446133 8:134494587-134494609 CTCGGTTACCAGCAAGGCCCTGG - Intronic
1049492696 8:142913646-142913668 CCCCATCTCCACCAAGGCCCAGG + Intronic
1049523613 8:143108716-143108738 CGCCGTCACCACCCAGGCCCAGG + Intergenic
1049812493 8:144581763-144581785 CCCCCAGATCAGCAAGGCCAAGG + Intronic
1052819523 9:33127980-33128002 CCCCCTGACCAGCAGGGCCCTGG + Intronic
1053291085 9:36879966-36879988 CCCTGGCATTGGCAAGGCCCAGG + Intronic
1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG + Intergenic
1059593678 9:115692782-115692804 TTCCATCAACAGCAAGGCCCAGG + Intergenic
1060552580 9:124492615-124492637 CACCGGCACCAGCAGGGCCCGGG + Intronic
1062439680 9:136564162-136564184 CCCCGTCATACCCCAGGCCCTGG + Intergenic
1062526555 9:136980223-136980245 CACCGCCTTCTGCAAGGCCCAGG + Exonic
1062584446 9:137242665-137242687 CCTCCTCATCAGCAAGATCCGGG + Exonic
1062632001 9:137467256-137467278 CCCCAGCACCAGCAAGGACCTGG + Intronic
1062741231 9:138176376-138176398 CCTCCTCATCAGCAAGATCCGGG + Intergenic
1186847606 X:13545965-13545987 CTCAGTCATCAGCAAGGGCAAGG - Intergenic
1186857535 X:13640353-13640375 CACCGTAATCAGCAAGGAGCCGG - Intergenic
1200228520 X:154432495-154432517 CCCAGAGAGCAGCAAGGCCCTGG + Intronic