ID: 1185052052

View in Genome Browser
Species Human (GRCh38)
Location 22:48559169-48559191
Sequence CCCGGGGCCATGGTGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185052048_1185052052 -9 Left 1185052048 22:48559155-48559177 CCTTGTTGAGGCCGCCCGGGGCC No data
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052038_1185052052 23 Left 1185052038 22:48559123-48559145 CCATACCAGGAACCCAGTTGGGC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052043_1185052052 -2 Left 1185052043 22:48559148-48559170 CCCTTGACCTTGTTGAGGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052041_1185052052 10 Left 1185052041 22:48559136-48559158 CCAGTTGGGCTGCCCTTGACCTT 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052036_1185052052 24 Left 1185052036 22:48559122-48559144 CCCATACCAGGAACCCAGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052040_1185052052 11 Left 1185052040 22:48559135-48559157 CCCAGTTGGGCTGCCCTTGACCT No data
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052044_1185052052 -3 Left 1185052044 22:48559149-48559171 CCTTGACCTTGTTGAGGCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data
1185052039_1185052052 18 Left 1185052039 22:48559128-48559150 CCAGGAACCCAGTTGGGCTGCCC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185052052 Original CRISPR CCCGGGGCCATGGTGTTTTG TGG Intronic
No off target data available for this crispr