ID: 1185052995

View in Genome Browser
Species Human (GRCh38)
Location 22:48563425-48563447
Sequence TGAACTCCTCTGGGCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185052982_1185052995 25 Left 1185052982 22:48563377-48563399 CCGGTGGTCTGTCTGGCCTCACT 0: 1
1: 0
2: 3
3: 24
4: 216
Right 1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1185052985_1185052995 9 Left 1185052985 22:48563393-48563415 CCTCACTCACCGGCAGTGTGGAG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1185052989_1185052995 0 Left 1185052989 22:48563402-48563424 CCGGCAGTGTGGAGGCTGGGCCC 0: 1
1: 0
2: 9
3: 50
4: 357
Right 1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185052995 Original CRISPR TGAACTCCTCTGGGCACAGG TGG Intronic
900293757 1:1937872-1937894 GGCACCCCTCTGGACACAGGTGG - Intronic
901199503 1:7458563-7458585 GGGACTCCTCTGGGCAGGGGCGG - Intronic
903659383 1:24967399-24967421 TGAACTACTCGGTGCACAGATGG - Intergenic
904288858 1:29470941-29470963 TGGGCTCCCCTGGGCACGGGAGG + Intergenic
904321322 1:29699283-29699305 TGAACCCCTCTGTGCCCTGGCGG + Intergenic
904735885 1:32632756-32632778 AGAACTACTCTGGGCACACAGGG + Intronic
907299852 1:53479999-53480021 TGAAGTTCTCTGCCCACAGGAGG + Intergenic
912768652 1:112441206-112441228 TGGTTTCCTCTGGGGACAGGGGG - Intronic
912960181 1:114189202-114189224 TGAACTCCTTTGCTGACAGGTGG + Intergenic
914370625 1:147021560-147021582 ACAACTGCTCGGGGCACAGGAGG + Intergenic
914484065 1:148091850-148091872 ACAACTGCTCGGGGCACAGGAGG - Intergenic
916248073 1:162708278-162708300 TGATCTCTTCTGGGTTCAGGAGG + Intronic
917490519 1:175494212-175494234 TGCAGTTCTATGGGCACAGGTGG + Intronic
921268042 1:213442311-213442333 GGCACTGTTCTGGGCACAGGGGG - Intergenic
921332918 1:214057948-214057970 AGAACTCAGCTGGGCCCAGGGGG + Intergenic
1062854401 10:772484-772506 GGAACCCATCTGCGCACAGGTGG - Intergenic
1067582468 10:47454296-47454318 GGAAGGTCTCTGGGCACAGGTGG - Intergenic
1068751968 10:60604771-60604793 TTATCTCCTCTGAGCATAGGTGG - Intronic
1069749323 10:70735461-70735483 TGAACACCTGTGGGGGCAGGTGG + Intronic
1069876665 10:71567374-71567396 TGAACTCCTTTGGGCCCTGCAGG - Intronic
1069903164 10:71717383-71717405 TGAGCTGCTCTGGGAACAGGTGG + Intronic
1070288441 10:75099973-75099995 TGGACTCCTCTGGGTCCTGGGGG - Intronic
1070969823 10:80554086-80554108 AGAACTCCACTAAGCACAGGAGG - Intronic
1071789828 10:88941964-88941986 TGACCTGTTCTGGGCAGAGGAGG + Intronic
1072539120 10:96384916-96384938 TGAGCTCCAGAGGGCACAGGGGG + Intronic
1072691380 10:97574298-97574320 GGGACTCCTCTGTGGACAGGAGG + Intronic
1073319321 10:102604764-102604786 TTAACTCCTCTGGGCACCAGGGG - Intronic
1074877994 10:117629459-117629481 TCAACACCTCTGGGTACAAGGGG + Intergenic
1077226466 11:1440996-1441018 TGTAGTCCTTGGGGCACAGGGGG - Intronic
1078019906 11:7648398-7648420 TGTGCTCCACTGGGCAAAGGGGG - Exonic
1079135010 11:17771512-17771534 TTCCCTCCTCAGGGCACAGGGGG - Intronic
1079628152 11:22641013-22641035 TTCACTCCTCTGCGCAGAGGAGG - Intronic
1081739586 11:45429090-45429112 TGAACTCCTCCAGGGACAAGGGG - Intergenic
1082095645 11:48127177-48127199 TCACCTGCTCTGGGCCCAGGAGG - Intronic
1083488041 11:62995813-62995835 TGAGCTCCTTCGGGCAGAGGAGG + Exonic
1090170617 11:124600350-124600372 TGAGCTCCTCTGAGCATAGAAGG + Intergenic
1090423834 11:126593501-126593523 TGACCCCCTCTGGGTACAGGTGG + Intronic
1091284110 11:134398641-134398663 TGCACTCCTCTGGGCAGCAGTGG + Intronic
1091564019 12:1634677-1634699 GGAGCTACTCTGGGCTCAGGGGG - Intronic
1101736206 12:107465206-107465228 TCAAATCCTCGGGGCACTGGAGG - Intronic
1101743893 12:107523145-107523167 GGAACTCCTCTGGGAAGAAGTGG - Intronic
1105357018 13:19667967-19667989 CCAACTCCTCTGGTCACACGGGG + Intronic
1106219535 13:27734123-27734145 TGAACTCTCCTGGGCTCAGGTGG - Intergenic
1107821272 13:44287912-44287934 TAAACTCCTCTGGGCACACCTGG - Intergenic
1110638869 13:77798552-77798574 TGAACTTCTCTGGAAACAGGGGG - Intergenic
1111464614 13:88592590-88592612 GGAACACCTCTGGGCACTTGGGG + Intergenic
1111793017 13:92882719-92882741 TGAACTCCACTGGGCCCAAATGG + Intergenic
1111922371 13:94425715-94425737 TACACTCCACTGGGCTCAGGAGG - Intergenic
1118348985 14:64960171-64960193 GGCCCTCCTCTGGGCACCGGGGG + Intronic
1118934040 14:70269773-70269795 TGAAGACCTCAGGGCCCAGGGGG - Intergenic
1119418983 14:74494751-74494773 TGTGCACCTCTGGGCTCAGGGGG + Intronic
1122895312 14:104753720-104753742 TGAATACCTCTTGGGACAGGAGG - Intronic
1123718310 15:23044909-23044931 TGAAGTCCTCTGGGCACCTCTGG - Intergenic
1124620478 15:31271210-31271232 TGAATTCTGCTGTGCACAGGGGG - Intergenic
1128542661 15:68546589-68546611 TGTACTGCACTGGGCAGAGGAGG - Intergenic
1129462199 15:75705040-75705062 TCACCTGCTCTGGGGACAGGGGG + Intronic
1129606336 15:77026861-77026883 GCAGCTCCTCTGGCCACAGGAGG - Intronic
1129722662 15:77886808-77886830 TCACCTGCTCTGGGGACAGGGGG - Intergenic
1130726623 15:86445691-86445713 TGAACTCATCTGAGGTCAGGTGG - Intronic
1131209211 15:90479110-90479132 TGAAGCTCTCTGGGCATAGGTGG + Intronic
1131747000 15:95459468-95459490 TGAACTCCTTTGGGGGCAGGAGG + Intergenic
1132659817 16:1056278-1056300 TGAACACTTCTGGGCACAGCAGG + Intergenic
1134798719 16:17065163-17065185 TCAACTCCTCTGGGCTCTGGGGG + Intergenic
1136054249 16:27676447-27676469 TGAACTCCTGAGGGCTCAGGAGG - Intronic
1137581814 16:49638155-49638177 AGAACTGCTCAGGGCACATGGGG + Exonic
1138094934 16:54204131-54204153 TCAACTCTTCAGGGGACAGGTGG + Intergenic
1141092903 16:81142369-81142391 TAAAATACTCTGGGCCCAGGGGG - Intergenic
1142553124 17:752880-752902 CGAACTCCACTTGGCACATGGGG - Intronic
1144675524 17:17159066-17159088 TGAACCCCTCAGGCCACAGCTGG - Intronic
1144996319 17:19271706-19271728 TGACCTCCTGGAGGCACAGGTGG + Intronic
1148805848 17:50263648-50263670 TGAACTGTCCTGGGCACACGGGG + Intergenic
1149041702 17:52197625-52197647 TGAACACCTCTAGTCACAGAAGG - Intergenic
1151326893 17:73385208-73385230 TGAACTTCAGAGGGCACAGGAGG + Intronic
1151928666 17:77216596-77216618 TAAACATCTCTGGGCACATGAGG - Exonic
1153533117 18:6069657-6069679 TGAACTCTTCTGTGCAGAAGAGG - Intronic
1154975394 18:21452517-21452539 TGAAGTCCTCTGGGCACAGCTGG - Intronic
1156164060 18:34396768-34396790 TGAGCTCCTCTTGGCAGAAGAGG + Intergenic
1157615731 18:48986745-48986767 TGACCTCCTCAGGGAACTGGAGG - Intergenic
1158936062 18:62365686-62365708 TGACTTCCTCTGGGCACATTTGG - Intronic
1163463738 19:17454749-17454771 AGCACTCCTCTGGGGGCAGGAGG - Intronic
1163578579 19:18124626-18124648 CAAACTCCTAGGGGCACAGGAGG - Exonic
1165069043 19:33244974-33244996 TGACCTCATCTGGCCACAGTAGG + Intergenic
1165137767 19:33681187-33681209 TGAACTCCACTGAGCCCAGCTGG - Intronic
1166530841 19:43542652-43542674 TGATCACCACTGGGTACAGGTGG - Intergenic
1166932448 19:46309155-46309177 TGAACTGCTCTGGACATATGAGG + Exonic
1167172585 19:47843123-47843145 TGAAATCCCCTGTGCACAGCTGG - Exonic
925344332 2:3159922-3159944 TGAACTCCCCAGGGCACTGGTGG + Intergenic
925781585 2:7386909-7386931 TGAAATCCACTGGGGCCAGGAGG - Intergenic
927924810 2:27004141-27004163 AGAGATCCTCTGGGCAAAGGCGG - Intronic
929545635 2:42853773-42853795 CGAACTGCTCTGGGGAAAGGAGG + Intergenic
930874967 2:56204891-56204913 TGAACACCTCTCGGCAAACGGGG + Intronic
932749894 2:74364872-74364894 TGAGTTTCTCTGGGCAAAGGAGG - Intronic
937085518 2:119169222-119169244 TGAACTACTCTGGCCCCTGGGGG - Intergenic
937999318 2:127719776-127719798 TGCATTCCTCTGGGACCAGGTGG + Exonic
938241846 2:129748235-129748257 GGAACATCTCTGGGCACTGGTGG + Intergenic
941567211 2:167124359-167124381 CTAACTCCTCTGGGGAGAGGAGG - Intronic
941607544 2:167618676-167618698 GGAACTGCTGTGGGTACAGGAGG - Intergenic
942366860 2:175237424-175237446 TGCACCACTCTGGGCAGAGGGGG - Intergenic
942964064 2:181868404-181868426 TGAACTTCTCTGTGTACATGAGG - Intergenic
943280355 2:185924272-185924294 TGAACATCTTTGGGCACAGAGGG + Intergenic
944583474 2:201153200-201153222 TAAACCCCCCTGGGCTCAGGTGG + Intronic
947165720 2:227259844-227259866 CGAGCTCCTCTGGGCCCTGGTGG - Exonic
947988415 2:234467962-234467984 TGAACACCTCAGGCCACGGGAGG - Intergenic
948029097 2:234801652-234801674 TTCACTCCTCTGGGCCCAGCAGG - Intergenic
948220404 2:236265013-236265035 TGCACTCCTAGGGGCAAAGGTGG + Intergenic
948925998 2:241098441-241098463 GGAACTCCTCTGGTCAAAGTGGG + Intronic
948969063 2:241410022-241410044 TGAATTCCACTAGGGACAGGGGG + Intronic
1170415440 20:16134055-16134077 GGAACTCCTCTGGGCACTGAGGG - Intergenic
1170777741 20:19392255-19392277 TGATCACCTGTGGGTACAGGTGG + Intronic
1170916864 20:20634892-20634914 TGAAGGCCTCTGGGAAGAGGTGG + Intronic
1171048898 20:21837524-21837546 TGATCACCACTGGGCACACGTGG + Intergenic
1174403393 20:50288455-50288477 TGGAGGGCTCTGGGCACAGGAGG + Intergenic
1175920182 20:62446930-62446952 TGACCTCCCCAGGGGACAGGAGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1179036913 21:37766329-37766351 TGAACCCCTTTGGAGACAGGTGG + Intronic
1180185274 21:46136288-46136310 AGAACTTCTCTGGAGACAGGAGG + Exonic
1180902544 22:19385292-19385314 TGACCTCCTCTGGGCTCCTGGGG + Intronic
1181132134 22:20738214-20738236 TGTCCTCCTGTGGGCTCAGGAGG - Intronic
1181625800 22:24121354-24121376 TGATTTCCTCAGGGCACAGCAGG + Intronic
1182426883 22:30278310-30278332 TGAGCAGCTCTGGGCACAGTGGG + Intergenic
1184516407 22:44965379-44965401 TGAGCTCCACTGGGTGCAGGTGG - Intronic
1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG + Intronic
1185408669 22:50671822-50671844 TGACGTCCTCTGGGCTCCGGGGG - Intergenic
950339685 3:12231596-12231618 TGAGCTCCTCTGGCTCCAGGGGG + Intergenic
950935330 3:16833844-16833866 TGAATTGCTCTGTGCAGAGGAGG - Intronic
951257282 3:20464624-20464646 TGAAGTCCTCTGATAACAGGGGG - Intergenic
951850572 3:27135197-27135219 TGAACTCTCCTGGGCTCAAGCGG - Intronic
952203246 3:31152369-31152391 AGAGCTTCTCTGGGCACTGGGGG - Intergenic
953309659 3:41864268-41864290 AGAACATCTCTGGGCACTGGGGG - Intronic
953536110 3:43778068-43778090 TGACCTCCTCTGGGCCCCTGTGG - Intergenic
954085876 3:48243472-48243494 TGAACTGGTCTTGGCACAGTAGG - Intronic
954885261 3:53867729-53867751 TGAAGCCCTCTGAGCCCAGGAGG - Exonic
963847166 3:150171250-150171272 TGAACTCCACAGGGCAGTGGTGG - Intergenic
964976271 3:162623739-162623761 AGAGCTTCTCTGGGCACTGGGGG - Intergenic
965788098 3:172357658-172357680 TTAAGGCCTCTGAGCACAGGAGG - Intronic
967407257 3:189131058-189131080 TGAACTGTTCTGGGCAAAGTGGG - Intronic
967603474 3:191415982-191416004 TGAAATCGGCTGGGCACGGGTGG + Intergenic
968613544 4:1567562-1567584 AGGACTCTGCTGGGCACAGGGGG - Intergenic
969415271 4:7053710-7053732 TGGGCTCCTCTGGTCGCAGGTGG + Intronic
974081667 4:57220268-57220290 TGAACTCCTCTAGTCAAAGAGGG + Intergenic
977744893 4:100535106-100535128 AGAGCTTCTCTGGGCACTGGGGG + Intronic
981755551 4:148138465-148138487 TCAACTTCCCTGGGCTCAGGTGG + Intronic
981760097 4:148184929-148184951 TTAACTTCTCTGGGCACCAGAGG + Intronic
983922804 4:173365665-173365687 GGCACTCCCTTGGGCACAGGTGG + Intergenic
985566715 5:622365-622387 TCAGCTCCCCTGGGCACTGGGGG + Intronic
986396026 5:7331651-7331673 TGAACTGCCCTGAGCAGAGGGGG + Intergenic
987467880 5:18294097-18294119 TGAACTCCTCTGGAGAAAGCAGG - Intergenic
988090807 5:26538481-26538503 TGAAGTCCTCTAGGCAAAGAAGG - Intergenic
993500352 5:88660291-88660313 TGAGCTCCTATGGGCAATGGGGG + Intergenic
995401577 5:111748158-111748180 TGCACTCCTTTGGGCAGAAGAGG - Intronic
995420479 5:111961291-111961313 TTAAATCCACTGGGCACTGGTGG - Intronic
995558883 5:113359367-113359389 TGAACTCACTTGGGCACAGTGGG - Intronic
998379604 5:141714744-141714766 TGCATTCCTCTAGGCAAAGGAGG - Intergenic
1004020964 6:11775239-11775261 TGAACTTCTCTGGGTAGAGAAGG - Intronic
1005092493 6:22072239-22072261 TGAACTCATATGAACACAGGGGG - Intergenic
1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG + Exonic
1006981810 6:38153620-38153642 TGAAATCCTCTGTGAACATGAGG - Exonic
1007891457 6:45296857-45296879 TGATCTCCACGGGGCACAGGTGG - Intronic
1007996318 6:46311939-46311961 TGGACTCATCTGGACACAAGAGG - Intronic
1009782811 6:68292640-68292662 AGAACATCTCTGGGCACTGGGGG + Intergenic
1010933663 6:81834758-81834780 TGAATGCCTCTGGGAACAGCTGG - Intergenic
1012952525 6:105533919-105533941 GGAACTCCTCCGGGGGCAGGGGG + Intergenic
1014069809 6:117168332-117168354 ATTACTCCTTTGGGCACAGGAGG - Intergenic
1014402856 6:121012671-121012693 GGCACTCTTCTGGGCACTGGGGG - Intergenic
1021077790 7:16326472-16326494 TTAAATCCTCTGCTCACAGGAGG - Intronic
1022041744 7:26588135-26588157 TGAACACCACTGGGCTCTGGTGG + Intergenic
1022661847 7:32375126-32375148 TTACCTCCTCTGGGCTCACGGGG + Intergenic
1026054364 7:66971614-66971636 CTAAAACCTCTGGGCACAGGTGG + Intergenic
1028932418 7:96427913-96427935 TGATGTTCTCTGGGCACAGAGGG + Intergenic
1029249742 7:99227202-99227224 GGAGCTCCTCTGGGCAAAGCTGG - Intergenic
1029433047 7:100544590-100544612 TGACCTCTGCTGGGCAGAGGTGG + Intronic
1031227384 7:119057263-119057285 TCAACTCCTCAAGGCACAGTGGG - Intergenic
1034828491 7:154288396-154288418 TGGAGTCCTCTGGACACTGGTGG - Intronic
1035475226 7:159138973-159138995 CCATCTCCTCTGGGCACTGGAGG + Intronic
1036678493 8:10853593-10853615 TGATCTCCTCTGCACCCAGGTGG - Intergenic
1038795181 8:30703457-30703479 TGAAATAGGCTGGGCACAGGTGG + Intronic
1041688583 8:60667333-60667355 TGAACTGGTCTGGGGAAAGGAGG + Intergenic
1043327094 8:79065729-79065751 AGAACTCCTCTGGGAGAAGGAGG + Intergenic
1044501293 8:92961395-92961417 TGAATCTCTCTGGGCAGAGGAGG - Intronic
1046448402 8:114356508-114356530 AGAGCTTCTCTGGGCACAGAGGG + Intergenic
1047190322 8:122673631-122673653 TGCCCTCTTCTGGGCACTGGTGG - Intergenic
1048203547 8:132397216-132397238 AGCAGTCCTCTGGGCACAGAGGG - Intronic
1048848759 8:138624223-138624245 TTCACTACTGTGGGCACAGGAGG + Intronic
1049378167 8:142298888-142298910 TCCACTCCTCTGGGAACAGTGGG + Intronic
1049553778 8:143272415-143272437 TGTACACGTCTGGGGACAGGCGG - Intronic
1049742347 8:144247220-144247242 AGCCCTCCTCTGGGTACAGGTGG + Intronic
1049844124 8:144791908-144791930 TGATGTCCTGTGGGCAGAGGCGG + Exonic
1051595775 9:18823348-18823370 TGAATTCCTCTGGTGACAGCAGG - Intronic
1054841844 9:69750532-69750554 TGAACTGCTCTGGTTACAGGAGG + Intronic
1056007150 9:82284926-82284948 AGAACATCTCTGGGCACTGGGGG + Intergenic
1056754947 9:89375815-89375837 TGTACTCCTCTGGGACCTGGAGG - Intronic
1056792615 9:89635843-89635865 GGAGCTTCTCTGGGCACACGTGG - Intergenic
1057520969 9:95760099-95760121 TCCTCTCCTCTGGGTACAGGGGG + Intergenic
1060893961 9:127205709-127205731 TGAACTTCTCAGTGCACAGAGGG + Intronic
1061083059 9:128383679-128383701 TGAACACCTCCAGGGACAGGAGG - Intronic
1062319546 9:135984110-135984132 TGTCCTCCTCTGAGGACAGGAGG - Intergenic
1062548254 9:137073607-137073629 TGGACCACTCTGGGCAGAGGTGG + Intergenic
1186210462 X:7245084-7245106 TGCACTCTTATGGGGACAGGAGG + Intronic
1187983223 X:24781991-24782013 TGCACTGTTCTAGGCACAGGAGG + Intronic
1192277502 X:69648589-69648611 TGAACTCCTGTGGGGAGGGGCGG - Intronic
1194274897 X:91866557-91866579 AGAGCTTCTCTGGGCACTGGGGG - Intronic
1194389155 X:93294590-93294612 AGAACTTCTCTGGGCACTGAGGG + Intergenic
1195828901 X:109033527-109033549 AGAACATCTCTGGGCACTGGGGG - Intergenic
1197068786 X:122267710-122267732 AGAACTTCTCTGGGCCCTGGGGG - Intergenic
1199239033 X:145525575-145525597 TGAACATCTTTGGGCACTGGGGG + Intergenic
1200592139 Y:5087958-5087980 AGAGCTTCTCTGGGCACTGGGGG - Intronic