ID: 1185055261

View in Genome Browser
Species Human (GRCh38)
Location 22:48575859-48575881
Sequence CACCGCCGCCGCGGCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 1, 2: 7, 3: 65, 4: 437}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185055261_1185055278 26 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055278 22:48575908-48575930 GCCCCGGGCCGGAGCGAGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 249
1185055261_1185055271 10 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055271 22:48575892-48575914 CGCGGCGGCCCCCTGAGCCCCGG 0: 1
1: 0
2: 2
3: 18
4: 270
1185055261_1185055272 11 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055272 22:48575893-48575915 GCGGCGGCCCCCTGAGCCCCGGG 0: 1
1: 0
2: 2
3: 38
4: 392
1185055261_1185055280 27 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055280 22:48575909-48575931 CCCCGGGCCGGAGCGAGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 223
1185055261_1185055270 -5 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055270 22:48575877-48575899 CGGTGGCGGCGGCGGCGCGGCGG 0: 1
1: 19
2: 91
3: 517
4: 1596
1185055261_1185055269 -8 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055269 22:48575874-48575896 CGGCGGTGGCGGCGGCGGCGCGG 0: 1
1: 116
2: 268
3: 730
4: 2022
1185055261_1185055283 30 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055283 22:48575912-48575934 CGGGCCGGAGCGAGCGCGGGCGG 0: 1
1: 0
2: 2
3: 38
4: 342
1185055261_1185055273 15 Left 1185055261 22:48575859-48575881 CCTGGCCCGCCGCGGCGGCGGTG 0: 1
1: 1
2: 7
3: 65
4: 437
Right 1185055273 22:48575897-48575919 CGGCCCCCTGAGCCCCGGGCCGG 0: 1
1: 0
2: 4
3: 33
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185055261 Original CRISPR CACCGCCGCCGCGGCGGGCC AGG (reversed) Intronic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
900349567 1:2228214-2228236 CAGCGCCGCCGGGACGAGCCGGG + Intergenic
900694090 1:3999566-3999588 CACTGCCGACGGGGCGGGCATGG + Intergenic
900694106 1:3999625-3999647 CACTGCCGACGGGGCAGGCCTGG + Intergenic
900694120 1:3999684-3999706 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694151 1:3999802-3999824 CACTGCCGACGGGGCAGGCCTGG + Intergenic
900694165 1:3999861-3999883 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694178 1:3999920-3999942 CACTGCCGACGGGGCGGGCCTGG + Intergenic
900746819 1:4366296-4366318 CACCCCCGCTGCAGAGGGCCCGG + Intergenic
901019757 1:6249699-6249721 CCGCGCCGCCGCCCCGGGCCCGG - Exonic
901433998 1:9235085-9235107 CCCCGCCGCCGCCCCGGCCCCGG + Intronic
902585733 1:17437957-17437979 CCCCTCCCCCGCCGCGGGCCCGG + Intronic
903184706 1:21622524-21622546 CAGCGCCGCCGCCGGGAGCCGGG - Intronic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903875860 1:26472671-26472693 CACCGCCGCCGCCGCCTCCCTGG + Intronic
904318305 1:29680236-29680258 AACCACCCCTGCGGCGGGCCAGG - Intergenic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904762699 1:32817301-32817323 CACCGTCGCCGCCGCGTGCCGGG + Exonic
904814081 1:33182114-33182136 CTCCGCCCCCGCAGCGGGCGGGG + Intergenic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
905390054 1:37630517-37630539 CACAGCAGGCCCGGCGGGCCTGG + Intronic
905867170 1:41382623-41382645 CGCCGCCGCCGGGCCTGGCCGGG + Exonic
906532827 1:46533227-46533249 CTCGGCGGCCGCGGCGGGCCCGG - Intergenic
906627019 1:47333813-47333835 CCCCGCCGCCGTGGCTGCCCGGG - Exonic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
907136254 1:52142160-52142182 GAGCGCCGCCGAGCCGGGCCGGG - Exonic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908527581 1:65002685-65002707 CGCCTCCGCCGCCGCCGGCCAGG - Intergenic
912993451 1:114510975-114510997 CGCCTCCTGCGCGGCGGGCCCGG + Exonic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
913963158 1:143354343-143354365 CACCGCCCCTCCGGGGGGCCGGG - Intergenic
914057514 1:144179929-144179951 CACCGCCCCTCCGGGGGGCCGGG - Intergenic
914121632 1:144786437-144786459 CACCGCCCCTCCGGGGGGCCGGG + Intergenic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
915463227 1:156081818-156081840 CCCCGCCCCCACGGCGGGCGAGG - Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
916106991 1:161440256-161440278 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916108552 1:161447670-161447692 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916110140 1:161455051-161455073 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916111725 1:161462461-161462483 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916113312 1:161469842-161469864 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916666947 1:166975402-166975424 CCCCGCCTGCGCGGCCGGCCCGG - Intronic
921046105 1:211479072-211479094 CACCGCCGCCACTGCGGTCCTGG - Exonic
922518199 1:226223741-226223763 CCCCGCCGGCGTGGGGGGCCCGG - Exonic
922739343 1:228006816-228006838 CAACGCCGCCGCCGCGGTTCGGG + Intergenic
923191827 1:231627127-231627149 CACCAGCGCCGAGCCGGGCCAGG + Intronic
923622234 1:235588355-235588377 CACAGCCCCCGCTGGGGGCCAGG - Intronic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924527065 1:244863030-244863052 GAGCGCCGCCGCGCCGGGCTCGG - Intronic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064254678 10:13733569-13733591 CCCCGCCCCCGCAGCAGGCCTGG + Intronic
1064443059 10:15370894-15370916 CGCCGCCTCCGCGCCAGGCCCGG + Intronic
1064982009 10:21174343-21174365 CGCCACCGCCGCTGCAGGCCGGG + Intergenic
1065215004 10:23439923-23439945 GAGCCCCGCCGCGGCGGGACCGG - Exonic
1065483900 10:26218046-26218068 CACCGCGGCCGGTGCGGGTCCGG + Intronic
1065883829 10:30059516-30059538 CGCCGCCGCTCCGGCCGGCCGGG + Exonic
1066022571 10:31318832-31318854 CACACCCGCCGCGGCTGCCCGGG - Intronic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1066464299 10:35639786-35639808 GACCACCACCGCGGCGGGCACGG + Exonic
1066464504 10:35640787-35640809 CACCGCCGCCGCCGCGAGCTGGG + Exonic
1070367343 10:75750269-75750291 CCCCGCCGGGGCGGCTGGCCGGG + Intronic
1070800703 10:79243122-79243144 TCCCCCCGCCGCGGCTGGCCTGG + Intronic
1070800862 10:79243664-79243686 CGCCGCGGCCGCCGCCGGCCGGG + Intronic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1073058284 10:100715767-100715789 CACCGCCGCCGCCGCCTGTCAGG - Intergenic
1073099599 10:100999783-100999805 CTCCGCCTCCGCGGCGCCCCCGG - Exonic
1074121556 10:110497621-110497643 CACCGCGGCCCCGGAGCGCCTGG + Intergenic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1074866417 10:117546667-117546689 CACCGCCGCCTCGGCTGTCCAGG - Intronic
1075106273 10:119542205-119542227 CTCCGCCTCCGCTGCGGGCGTGG - Intronic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1076035631 10:127196590-127196612 CACCTCCGCCCCGCGGGGCCCGG - Intronic
1076548250 10:131260370-131260392 CACCGCCGCCGCCGCTGCCATGG - Exonic
1077056995 11:598640-598662 CACAGAAGCCGCGCCGGGCCCGG + Intronic
1077962461 11:7089624-7089646 CACCGCCGCTGCTGCGAGCCGGG - Exonic
1078210357 11:9265215-9265237 CACGGCAGCCGCGGCGGCCGAGG - Exonic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081699946 11:45146700-45146722 CGCCGCCGCCGCGCCGAGGCTGG + Intronic
1081925749 11:46826820-46826842 CGCCGCCGCCGCCGCCTGCCGGG - Intronic
1083048285 11:59755492-59755514 CTCCTTCGCCCCGGCGGGCCCGG + Exonic
1083160804 11:60852998-60853020 CACCGCGGCCGCCGGCGGCCAGG - Exonic
1083203043 11:61131832-61131854 CACCACCGCCGGGGCCTGCCTGG - Exonic
1083753666 11:64777984-64778006 CACCTCCTCCGCCGCCGGCCGGG + Exonic
1083904827 11:65662768-65662790 CGCCACAGCCGCGGCGGCCCCGG + Intronic
1083920856 11:65780888-65780910 TACCGCCGGCGCCGGGGGCCGGG - Intergenic
1084068468 11:66718911-66718933 CTCCGCCGCCCCGCAGGGCCTGG - Intronic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1084814691 11:71639338-71639360 CACCGCGGACACGCCGGGCCGGG - Intergenic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561267 11:77474205-77474227 CGCCGCCGCCGCGCCGGGGAGGG - Intronic
1087076215 11:94129094-94129116 CGCCGCCGGCGGGGCGGGGCGGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090710084 11:129375967-129375989 CCCCGCGGCCCCAGCGGGCCGGG + Exonic
1091206571 11:133825331-133825353 CACCCCCACCGCGGTGGACCTGG + Intergenic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG + Intergenic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1095271474 12:40224690-40224712 CACCGCAGCGGCGGCGCGGCCGG - Intronic
1097019090 12:56007545-56007567 CACCGCCGCCTCTGAGCGCCCGG + Intergenic
1097155080 12:57006471-57006493 CGCCGCCTCCTCGTCGGGCCGGG - Intergenic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1101970639 12:109309808-109309830 CCTCGCCGCCGCGCTGGGCCCGG - Intergenic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103604883 12:122079023-122079045 CGCCACCGCCGCCTCGGGCCGGG + Exonic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103779396 12:123389107-123389129 CAGCGCCGCCGCGGCGCCCCGGG - Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1105472066 13:20703731-20703753 CGCCGCCGCCGCCCCGAGCCGGG - Intronic
1105943642 13:25171586-25171608 CCCCGCCGCCGCCGCGGCTCCGG + Exonic
1106157459 13:27171666-27171688 CACAGCGGCGGCGGCGGGCGGGG + Exonic
1106512389 13:30422371-30422393 CACCACCGCCGCCGCGGCCAGGG - Intergenic
1106517147 13:30465330-30465352 GGCCGCCGCCGCAGCGAGCCGGG - Intronic
1107058405 13:36130920-36130942 CAACGCCCCCGGGTCGGGCCAGG + Intronic
1107467842 13:40665931-40665953 CACCGCCGCCGCCACGGAGCCGG + Exonic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1108227457 13:48303945-48303967 CACCGCCGCCGCTGCCGCCGCGG + Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1108541503 13:51451742-51451764 CGCCGCTGCCGGGCCGGGCCGGG + Intronic
1113378529 13:109784442-109784464 CACCGCCGCCGCCGCCGTCTCGG + Exonic
1113378534 13:109784448-109784470 CGCCGCCGCCGTCTCGGGCCGGG + Exonic
1114483205 14:23047944-23047966 CCCCCCCCCCGCGGTGGGCCGGG + Exonic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1116973877 14:51095025-51095047 CACAGCCGCCGCCGCTGGCCAGG - Exonic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1117875868 14:60249550-60249572 CACCGCTGCAGCGGCGGGCCAGG - Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1119318430 14:73714433-73714455 CTCCGCCGCGGGGGCGGGACGGG - Intergenic
1119434121 14:74586849-74586871 CACCACAGCCGCTGCCGGCCAGG + Intronic
1120881341 14:89417152-89417174 CGCCTCCGCCGCGGCGCGTCGGG + Intronic
1121050454 14:90816367-90816389 TCCCGCCGCCGCCGCGGGCTCGG + Exonic
1121767797 14:96502530-96502552 AACCGCCGCCGCTGCCGCCCTGG - Exonic
1122145175 14:99684517-99684539 CACCTGGGCCGCGGCGGCCCGGG - Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122873711 14:104653274-104653296 CCCAGCCGCCGCGCCAGGCCTGG - Intergenic
1122873721 14:104653311-104653333 CCCAGCCGCCGCGCCAGGCCTGG - Intergenic
1122889190 14:104724685-104724707 CACCACCCCGGCAGCGGGCCAGG + Intronic
1122917487 14:104865669-104865691 CGCCGCCGCGGAGGCGGCCCTGG + Intronic
1122993171 14:105248544-105248566 CACCGGCGCCGCGGCGGGTACGG + Intronic
1123024926 14:105420011-105420033 CCCCTCCGCCGCCGCCGGCCCGG + Exonic
1123036685 14:105474612-105474634 CACCTCCGGCGCGAGGGGCCCGG + Intronic
1124129365 15:26971123-26971145 CAGCGCCTCCGAGGCGGTCCCGG - Intergenic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125999399 15:44195071-44195093 CAGCGCCGCCGCGTCGCTCCCGG - Exonic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1126738038 15:51751566-51751588 CCCCGGCGCCGCGCCCGGCCGGG + Exonic
1127117583 15:55743191-55743213 CAGCGCCGCGGCCGCGGGCCTGG + Intergenic
1127469411 15:59276913-59276935 AACCGCTGCCGCGTGGGGCCAGG - Intronic
1127763628 15:62164588-62164610 CGCCGCCGCAGCTGTGGGCCCGG + Exonic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1129309440 15:74695877-74695899 CACCTCCGCGCCGACGGGCCTGG + Exonic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132398244 15:101489589-101489611 CACCGACACCGCCGCGGGCGCGG - Exonic
1132779293 16:1614160-1614182 CTGCGCCGCCTCGGCCGGCCGGG - Intronic
1132841321 16:1979699-1979721 CACCGCGGGCAGGGCGGGCCAGG - Exonic
1133156770 16:3881099-3881121 CAGCGCCGCCCCAGCGGGACGGG - Intergenic
1133369921 16:5239675-5239697 CACCGCGGACACGCCGGGCCCGG - Intergenic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784481 16:8963715-8963737 CAGGCCCGCCGCGGCCGGCCAGG - Intronic
1133945920 16:10348460-10348482 CACTGCAGCCGCTGCGTGCCAGG + Intronic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136546534 16:30958019-30958041 CGCCGCCACCGCTGCGGGGCCGG + Intronic
1136579429 16:31142737-31142759 CCCCGCGGCCCCAGCGGGCCAGG + Exonic
1137426425 16:48384947-48384969 CGCCGCCACCCCGCCGGGCCCGG + Intronic
1137454844 16:48610185-48610207 CTTTGCCGCCGCCGCGGGCCGGG + Exonic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139890626 16:70251393-70251415 CACCGCCGCCGCGCTCGCCCTGG - Exonic
1140187428 16:72787742-72787764 CACCGCCGCCGCCGCCGGTGGGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141830140 16:86505792-86505814 CCCCGCCCGCGCGGCCGGCCTGG + Intergenic
1141840129 16:86568576-86568598 CGCCTGCGCCGCGGCGGCCCCGG - Exonic
1142336188 16:89490656-89490678 CACAGCCCCTGCGGCCGGCCGGG - Intergenic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1143742582 17:8965417-8965439 CGCTGCCCCCGCGGTGGGCCAGG + Intronic
1144787494 17:17840180-17840202 CAGCCCCGCCCCCGCGGGCCCGG + Intergenic
1144907740 17:18650269-18650291 CACCGCCGCTGCGCCAGCCCAGG + Intronic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147307408 17:39573641-39573663 CGCCGCCGCCGGGCCGCGCCGGG + Intergenic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1148150837 17:45395817-45395839 CACAGCGGCTGCGCCGGGCCTGG + Exonic
1148388631 17:47254196-47254218 CCCGGCCGCCGCGGCGCGCACGG + Intronic
1148664078 17:49361854-49361876 CACCGCCGCGGCGGCGCCCCCGG - Intronic
1148807915 17:50273456-50273478 CGCCCGCGCCCCGGCGGGCCTGG + Intronic
1148830176 17:50426116-50426138 CTCCGCCGGCGGGGCGGGGCGGG - Intergenic
1149614741 17:57988275-57988297 CACCACCGCGGCGGCGAGCGCGG + Intergenic
1149685376 17:58531849-58531871 CACCGCAGCCGCGGCTGTGCAGG - Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150488790 17:65560928-65560950 CCCCGACGCCGCGGCCGGCCCGG - Intronic
1150643450 17:66964575-66964597 CCCCGCCGCCGCCGCGCTCCGGG - Intergenic
1150643592 17:66965067-66965089 CGCCGCGGGCGCGGCGGGGCGGG - Exonic
1151612168 17:75183150-75183172 GCGCGCCCCCGCGGCGGGCCGGG - Intergenic
1151662383 17:75525686-75525708 CACCTCCGGCGCGGCGAGCCTGG - Intronic
1152543989 17:80991813-80991835 TACGGCGGCCGCGCCGGGCCAGG - Intronic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1153805312 18:8705335-8705357 CACCGGTGCCGCGGCGGCGCTGG - Intergenic
1154125695 18:11689985-11690007 GCCCGCCGCCCCCGCGGGCCCGG - Intronic
1154151384 18:11908877-11908899 CACAGCCACCGCGGCGGCCGGGG + Exonic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155928953 18:31685612-31685634 CACCGCCGCCCCCGCCCGCCCGG + Intronic
1156275819 18:35581802-35581824 CGCGACCGCCGCGGCCGGCCCGG + Intronic
1156338130 18:36187538-36187560 CTCCGCCGCCGCGCCGGCCATGG - Exonic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157384320 18:47248374-47248396 CACCGCGGCCGCGGCGGCCACGG + Intronic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1158190961 18:54828427-54828449 GTCCGCCGCGGCGGCGGGGCTGG - Exonic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1159578272 18:70206001-70206023 AGCGGGCGCCGCGGCGGGCCCGG - Intergenic
1160543651 18:79638754-79638776 CAGCGCCGCCGCGTCTGGACAGG - Intergenic
1160631172 18:80247247-80247269 CAGGGCCGCCGGGGCGGGCGGGG + Intronic
1160790461 19:920584-920606 CCCCGCCGCCCCCGCCGGCCCGG + Exonic
1160857653 19:1224590-1224612 CACGGCCGCCCCTGCAGGCCAGG + Intronic
1160861283 19:1238105-1238127 CTCGGCCGCCGCGGCGGGTGCGG - Intergenic
1160910346 19:1471077-1471099 CGGCGCAGCCGCGGCGGGCGAGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160960605 19:1719048-1719070 TGCCGCCGCCGCAGCGGGGCTGG + Intergenic
1161076860 19:2290033-2290055 GCCGGCCGCCGCGGCGGGCCAGG - Exonic
1161241159 19:3224704-3224726 CGCCGCCGCCGCCGCCGGCTCGG + Exonic
1161505097 19:4639545-4639567 CACCGCCGCGGCAACGGCCCCGG + Intronic
1161513201 19:4683061-4683083 CCCCGCCGCCGCAGAGGGCCGGG + Intronic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162027704 19:7903910-7903932 CACCGCCGCCGCGCACCGCCCGG - Exonic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163154469 19:15432486-15432508 CGCCACCGCCGCCGCGGGACGGG - Intronic
1163282340 19:16325392-16325414 CAGCGCCCCCGCGGGTGGCCTGG + Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163607100 19:18281492-18281514 CTCCCCCGCCGCGCCGGCCCGGG + Exonic
1163635102 19:18433911-18433933 GACCGTGACCGCGGCGGGCCAGG + Intronic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165293065 19:34904864-34904886 CCCCGCCGCTGCAGCCGGCCTGG - Intergenic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165510969 19:36266525-36266547 CACCGCCGCCACCGCCGCCCCGG + Intergenic
1165851391 19:38852053-38852075 CCCCGCCCCCGCGGCCGGCCCGG + Intronic
1165961623 19:39539803-39539825 CAGGGCAGCCGCGGCGGGCAGGG - Exonic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166959662 19:46489909-46489931 AACAGCCGCCGCCGCGTGCCAGG + Intronic
1167071728 19:47226130-47226152 CCCGGGCGCCGGGGCGGGCCGGG - Intronic
1167268310 19:48494028-48494050 CACGGGGGCCGCCGCGGGCCCGG + Exonic
1167613363 19:50517799-50517821 CACGGCGGCCGCGGCGGCCACGG + Exonic
1202696998 1_KI270712v1_random:132602-132624 CACCGCCCCTCCGGGGGGCCGGG - Intergenic
926914409 2:17878699-17878721 CGCCGCCGCGGCGGCAGGCGCGG + Intronic
927472272 2:23385401-23385423 CCCCGCAGCCGCGGCGGCCGCGG - Exonic
927698286 2:25252065-25252087 CGCCGCGGCTGCTGCGGGCCGGG + Intronic
927713819 2:25340915-25340937 CGCCGCCACCGCGGCCGCCCGGG + Intronic
928511767 2:32010085-32010107 CCCCGCGGCGGCGGCGGGCGGGG - Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
932385907 2:71332235-71332257 CAGCGCAGCCTCGGCAGGCCGGG - Intronic
932599299 2:73112879-73112901 CGCCGCCGCAGCTGCGGGCTGGG + Exonic
934079014 2:88452161-88452183 CCCCGCGGGCGCGGCGGGCGAGG + Exonic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934278159 2:91589616-91589638 CACCGCCCCTCCGGGGGGCCGGG - Intergenic
934296836 2:91749090-91749112 CAGCGCCGCGGCGGCGCCCCGGG + Intergenic
934686845 2:96327402-96327424 CACAGCCACAGCGGCGGCCCAGG - Exonic
934993307 2:98936304-98936326 CGCCGCCTCCGCAGCTGGCCCGG + Intergenic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
935904388 2:107827415-107827437 CATCGCGGCCGCGGCCGGGCCGG - Intronic
936038326 2:109129651-109129673 CACCGCCGCGGGGGCGGGCGAGG + Exonic
938397731 2:130963499-130963521 CACCGCGGCTGCGACGAGCCTGG + Intronic
940038038 2:149330489-149330511 GCCCGCAGCCGCGGCCGGCCCGG - Intronic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
943185162 2:184598306-184598328 CGCCGCTGCCGCAGAGGGCCGGG - Intergenic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
944811091 2:203328293-203328315 CACCGCGGCGACGGCCGGCCGGG - Exonic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
945649131 2:212538047-212538069 CACCGCCGGGGCCGCGGTCCTGG - Intronic
946130736 2:217604696-217604718 CACTGCCGCCGCCCCGTGCCAGG + Intronic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946327671 2:218993149-218993171 CAGCGCCCCCGCGCCGGGCCCGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947518747 2:230828503-230828525 GCCCAGCGCCGCGGCGGGCCCGG + Intergenic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948467416 2:238159013-238159035 CTCCGGCGGGGCGGCGGGCCGGG - Exonic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
949017188 2:241720146-241720168 CACTCCCGCCCCGGCAGGCCAGG - Intronic
1168814651 20:728311-728333 CCCCGCCTCCGCAGCTGGCCCGG - Intergenic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169216299 20:3796518-3796540 CACCTCCATCGCGGCGGGGCCGG - Exonic
1172775896 20:37406698-37406720 CCGCGCTGCCGCGGCGGGTCAGG + Intergenic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1174343864 20:49915385-49915407 CACTGCCGCCGAGGACGGCCCGG + Intronic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1175399667 20:58693135-58693157 CACCCCCGCCGCCGCCGGGCCGG + Intronic
1175802720 20:61810286-61810308 CACAGCCGCCCCGACTGGCCCGG - Intronic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1175926545 20:62474236-62474258 CGCCGGCGCCGGGCCGGGCCTGG - Intronic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176232278 20:64038569-64038591 CACGGCCCCCGCGCCCGGCCCGG - Intronic
1176372199 21:6068906-6068928 CTCCCCCGCCGTGGCAGGCCTGG + Intergenic
1176418925 21:6499025-6499047 CACCGCCGCGCCGGCCCGCCTGG + Intergenic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1179495231 21:41767056-41767078 CAGCGCCGCGGCGGCTGCCCAGG + Exonic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179694418 21:43107347-43107369 CACCGCCGCGCCGGCCCGCCTGG + Intronic
1179751320 21:43469633-43469655 CTCCCCCGCCGTGGCAGGCCTGG - Intergenic
1179908703 21:44436988-44437010 CCCCTGCGCCGCGGCGGGGCTGG - Intronic
1180953502 22:19731204-19731226 CACCGCCGCGGGGGAGGGGCGGG + Intergenic
1181006738 22:20017028-20017050 CACCGCCGCCGCAGAGGTTCGGG - Intronic
1181064304 22:20298535-20298557 CACCGCCTCCCCTGCAGGCCCGG - Intergenic
1181169909 22:21002174-21002196 CCCCGCCACCGGGGCGGGGCGGG + Intronic
1181572031 22:23772944-23772966 AGCCGCCGCCGCTGCTGGCCCGG + Exonic
1182903853 22:33920446-33920468 CTCCGGCGCGGCGGCGGGGCAGG + Intronic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183702166 22:39457106-39457128 CTCCGCCGCCGCGCCGGGCCGGG - Intergenic
1184337545 22:43862570-43862592 CAGCGCCGCGGCCGCGTGCCGGG - Intergenic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1184932374 22:47690810-47690832 CACCCCAGCAGCGGGGGGCCTGG + Intergenic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185316172 22:50180138-50180160 CTCAGCCGCGGCGGGGGGCCCGG - Exonic
1185397662 22:50600979-50601001 CCCCGCCGCCGGCGCGGACCCGG + Intronic
1203252493 22_KI270733v1_random:124757-124779 CACCACCGCCGCCGCGGTCGCGG - Intergenic
950316364 3:12004827-12004849 GACGGCCGCCTCGGCTGGCCTGG + Exonic
950345329 3:12287859-12287881 GCCCGCCCCCGCGCCGGGCCCGG + Intronic
950729768 3:14947542-14947564 CCCCGCCGCGGCGGCGAGGCTGG + Intergenic
951717359 3:25664168-25664190 TTCCGCCCCCGCCGCGGGCCCGG + Intronic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
955916505 3:63912753-63912775 CACCGCCGCCACGGCGCACACGG + Exonic
960577076 3:119240588-119240610 CGCCGCCTCTGCTGCGGGCCGGG - Exonic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961306042 3:125959534-125959556 GACCGCCGGGGCGGCTGGCCTGG - Intergenic
961389202 3:126542417-126542439 CCCCGGGGCCGCGGCGGCCCAGG - Exonic
961574450 3:127823216-127823238 CCCCGCCGCCGAGCCGGCCCAGG - Intronic
961873305 3:130003197-130003219 CACCGCGGACACGCCGGGCCGGG + Intergenic
963503913 3:146161272-146161294 ACCCGCCGCCGCTGCGCGCCCGG + Intronic
964358424 3:155870843-155870865 CACCGCCGCGGCTCCGGCCCTGG + Exonic
966915827 3:184583715-184583737 CCGCGCCGCCGCAGCCGGCCCGG + Intronic
968428084 4:536145-536167 CCCCGCAGACTCGGCGGGCCCGG + Intronic
968660021 4:1794997-1795019 GACCGCGGGCGCGGCGGGCCGGG + Intronic
968674957 4:1872002-1872024 CACCGCGGCCGCCCCGGACCGGG - Intronic
968957153 4:3725304-3725326 CACCGCAACCACGGCCGGCCAGG - Intergenic
969032589 4:4226720-4226742 CACCGCCCCGCCGGGGGGCCGGG + Exonic
969132744 4:5003730-5003752 CACCACAGCCACGGAGGGCCGGG + Intergenic
969344642 4:6563353-6563375 CACCGACCCCGGGGCGGTCCTGG - Intronic
969413376 4:7043534-7043556 CGCGGCGGCTGCGGCGGGCCGGG + Exonic
969609277 4:8218000-8218022 CACCGCCACCCCTGTGGGCCTGG - Intronic
969737351 4:9000629-9000651 CACCGCGGACACGCCGGGCCGGG - Intergenic
969796559 4:9532217-9532239 CACCGCGGACACGCCGGGCCGGG - Intergenic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970456061 4:16226023-16226045 CCCCGCGGCCGCGCCAGGCCAGG - Intronic
975409966 4:74038465-74038487 CACCCCAGCCGCGTCCGGCCCGG + Intronic
975415354 4:74098974-74098996 CACCCCAGCCGCGTCCGGCCCGG + Intronic
975883607 4:78939397-78939419 CGCCAGCGCCGCGGCGGACCCGG + Exonic
976569736 4:86594408-86594430 GACCGCTGCCGAGGCGGACCGGG - Exonic
979547275 4:121951977-121951999 CATCGCCGCCGCCGCGGGGCTGG - Intergenic
980130062 4:128809965-128809987 CGCCGTCGCCGCCGCGGGACCGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981528811 4:145733202-145733224 GACGGCCGCTCCGGCGGGCCGGG - Intronic
983940261 4:173529478-173529500 CAGCGCTGCTGAGGCGGGCCCGG - Exonic
984699005 4:182806648-182806670 CACCCCAACCGCGGCGGGGCCGG + Intergenic
984765721 4:183398925-183398947 GCCCGCGGCCGCGGCGGACCCGG - Intergenic
985678835 5:1245666-1245688 CACCACCGCCCCTCCGGGCCAGG - Intronic
986330677 5:6714130-6714152 CACGGCGGCCGCGGCGGGGGCGG + Intergenic
986402840 5:7396196-7396218 CCGCGCCGCCTCGGCCGGCCCGG - Exonic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
989637955 5:43556658-43556680 CACCGCCGCTGCGCCAGCCCAGG - Exonic
989963298 5:50440945-50440967 CATCGCCGGCGCGCCGGGCAAGG - Intronic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991351191 5:65722116-65722138 CACCGCCCCTGGGGCGGGGCCGG + Exonic
991587355 5:68215086-68215108 CACCGCCGCCTCCGGGAGCCAGG - Intergenic
991587735 5:68216444-68216466 CACCGCCGCCTCGCCCGCCCCGG - Intronic
994197560 5:96936389-96936411 CAGCGCCGCCGCCGCTCGCCCGG + Intronic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995809126 5:116085179-116085201 CCTGGGCGCCGCGGCGGGCCCGG + Intronic
997653011 5:135536030-135536052 CTCCGCCCCCGCGGCAGCCCGGG + Intergenic
999300206 5:150486160-150486182 CCCCGGCGCAGCGCCGGGCCGGG + Intronic
999315658 5:150582401-150582423 CACCGCGGCAGCGGCGGGCCTGG + Intergenic
999326936 5:150649594-150649616 CTCCTCCGCCGCCGCGGGGCTGG - Exonic
999767971 5:154755409-154755431 CCCCGCCCCCGGGGCGGCCCGGG - Intronic
1001959564 5:175872020-175872042 CGCCGCAGCCGGGGCGGTCCTGG - Intronic
1002184264 5:177446966-177446988 TACCGCGGCGGCTGCGGGCCGGG + Intronic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003552142 6:7108887-7108909 GACCACCGCCCCGGGGGGCCTGG + Intronic
1003617979 6:7672695-7672717 GACAGCAGCCACGGCGGGCCAGG + Intergenic
1004140533 6:13013752-13013774 AAGCACCGCCGCGGCGGGGCGGG - Intronic
1004396339 6:15248819-15248841 CCCCGCCGCCCCGCCGCGCCTGG - Intronic
1005040345 6:21595191-21595213 CGCCGCCGCCGCCGCCTGCCAGG - Exonic
1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG + Exonic
1005959768 6:30686724-30686746 CTCCGCCCCCGAGGCGGGTCGGG + Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006304083 6:33208514-33208536 CACCGCCGCCGCCATGGCCCGGG - Exonic
1006337492 6:33428104-33428126 CACCGCCCCCCGGGGGGGCCAGG - Intronic
1006535609 6:34696648-34696670 CGCCGCCGCGCCGCCGGGCCCGG + Exonic
1007258045 6:40542305-40542327 CACCGCCACCTCTCCGGGCCAGG - Intronic
1007739138 6:44000509-44000531 CACTCCCGCCGCGGCAGGCCAGG + Intergenic
1007927743 6:45663556-45663578 GCTCGCCGCAGCGGCGGGCCGGG - Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1011128741 6:84033713-84033735 CGCCGCCTCCGCTGCGGGTCGGG + Intergenic
1013793612 6:113860186-113860208 GGCCGCCGCCGAGGCGGGCGCGG + Exonic
1016330279 6:142946574-142946596 CACGGCTGCCGCTGCGGGCGGGG + Intergenic
1017671905 6:156777527-156777549 CCCCGCCGGAGCGCCGGGCCGGG - Intergenic
1017842334 6:158232163-158232185 CACCGCCGCCGCCGCCGGCCCGG - Intergenic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1020037666 7:4974444-4974466 CACCGCCTCCGCGGCGGCCTCGG - Intergenic
1020162152 7:5781180-5781202 CACCGCCTCCGCGGCGGCCTCGG + Intronic
1021600223 7:22356986-22357008 CACCGCCGCCGCGGCGGCCAGGG + Intronic
1021717723 7:23474379-23474401 CACCGCCCCTGCTGCGGGCGGGG + Intergenic
1022020879 7:26398546-26398568 CCCAGCCGCCGAGCCGGGCCGGG - Intergenic
1022112967 7:27242854-27242876 CACCGCCACCGCCGCGGTCGCGG + Exonic
1022285963 7:28956534-28956556 CGTCGCTGCCGCCGCGGGCCCGG - Exonic
1022427954 7:30285552-30285574 CGCGGCGGCCGCGGCGGCCCCGG + Exonic
1023418263 7:39951238-39951260 CACTGCTGCTGCGGCGGTCCCGG - Exonic
1024963799 7:55004595-55004617 CCCCGCGGCCGCGGCGAACCTGG - Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025211125 7:57020072-57020094 GACAGCCGCCGGGGCAGGCCAGG - Intergenic
1025660830 7:63556775-63556797 GACAGCCGCCGGGGCAGGCCAGG + Intergenic
1025976885 7:66377112-66377134 CACGGCAGCCCCGGCAGGCCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1028417623 7:90596505-90596527 CACCACCTCCTCGGCGGGCCGGG - Intronic
1028762450 7:94510325-94510347 AACCGCCTCCCCCGCGGGCCGGG - Intronic
1029075075 7:97928487-97928509 CACCTCCGCCACGCCGGGCCCGG + Intergenic
1029206055 7:98869943-98869965 CACCGCCCGCGCTGCGCGCCCGG - Intronic
1029715134 7:102321555-102321577 CACCGCCGCCGAGGAGCCCCCGG + Exonic
1029813984 7:103075237-103075259 CAGAGCCGCAGCGCCGGGCCAGG - Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032122871 7:129169354-129169376 CCCCGCCCCCGCGGCGGCCTAGG + Intronic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1033477200 7:141702229-141702251 CAACGCCGCCGCCGCCCGCCGGG + Intergenic
1033640996 7:143263351-143263373 CACCTCCGGCGCAGCGGGGCAGG - Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1034991615 7:155551142-155551164 CACGGGCACAGCGGCGGGCCTGG - Intergenic
1035023527 7:155812293-155812315 CCCCGCAGCCGCGGCGGGCAAGG - Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1036789502 8:11708672-11708694 CGCCGCCGCTGCCGCGGCCCGGG + Exonic
1036900433 8:12665685-12665707 CACCGCCGCCACGCCGGGCTCGG + Intergenic
1037947728 8:22999709-22999731 CAGCGCCTTCGCCGCGGGCCCGG + Intronic
1038152658 8:24956534-24956556 TCCCACCGCCGCCGCGGGCCGGG - Exonic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1038554124 8:28494566-28494588 CCCAGCCGCCACCGCGGGCCCGG - Intronic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1041690085 8:60679355-60679377 CGCCCCCGCCGCCGCCGGCCCGG - Intronic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042155711 8:65842032-65842054 CTCCGCCGCCGGCGCGAGCCCGG + Intronic
1043053357 8:75407973-75407995 CTCCGCCGCCGCCCGGGGCCCGG + Intronic
1043388156 8:79768018-79768040 CACCGCCGCCGGGCAGGGGCGGG - Intergenic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044569386 8:93700514-93700536 TCGCGCCGCCGCGGCAGGCCGGG - Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044832306 8:96262008-96262030 CGCCGCCACCGCGGCAGGACGGG + Exonic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1048152073 8:131904030-131904052 CCCCGCCCCCGCGGATGGCCGGG - Intergenic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049194517 8:141308109-141308131 CCCCGCCGCCCCCGCGGCCCCGG - Intronic
1049218424 8:141418066-141418088 CACCTCCTCCCCGGCGGGGCTGG - Intronic
1049512740 8:143037955-143037977 CATCGCTGCCGGGGCTGGCCAGG - Intergenic
1049649856 8:143760875-143760897 CATCGCCGCGCAGGCGGGCCCGG + Intergenic
1049665441 8:143840799-143840821 AGCCGGCGCCGAGGCGGGCCCGG - Exonic
1049762174 8:144336607-144336629 CTCCGCCGCGGCGGCGGGGGGGG - Intergenic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1050091028 9:2016535-2016557 CACGGCGGCGGCTGCGGGCCCGG + Intronic
1051079689 9:13279656-13279678 CACCGCCTCCGCGGCAGCCCCGG - Intergenic
1052970241 9:34372888-34372910 TACCCCCGCCGCCGCCGGCCTGG - Exonic
1053014108 9:34652138-34652160 CACCCCCGCTGCGGGGGCCCAGG + Intronic
1053066318 9:35071991-35072013 CTCCGCCGGCGCGGCGCCCCGGG - Intronic
1053072933 9:35111618-35111640 CACCCGCGCCGCGGCGGCCACGG + Intronic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1054798675 9:69325549-69325571 CGCCGCTGCCGCCGCGGCCCCGG + Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057752412 9:97803494-97803516 CCCCGCCCCCGCGCTGGGCCGGG - Intergenic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1060209035 9:121699262-121699284 TAGCGCGGCGGCGGCGGGCCGGG - Intronic
1061453550 9:130681757-130681779 CTCCGCGGCGGCGCCGGGCCGGG - Exonic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061802763 9:133121185-133121207 CGCCGCCCCCGCCGCGCGCCGGG - Intronic
1061987094 9:134136179-134136201 CCCCGCCGCCGCGGCCCGGCAGG + Exonic
1062344120 9:136107026-136107048 CACGGCTGCCGCAGTGGGCCAGG - Intergenic
1062499094 9:136844728-136844750 CACCGGCGGCGAGGCGGGCGCGG - Exonic
1062574711 9:137200757-137200779 AGCCGCCGCCGCGGCCAGCCTGG + Exonic
1062646332 9:137550504-137550526 CATCCCCGCCGCGCTGGGCCTGG - Exonic
1203773674 EBV:61494-61516 CACAGCCGTCGCGGCGGGGGCGG + Intergenic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic
1196965113 X:121047430-121047452 CGCCGCGGCCTCGCCGGGCCTGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200068790 X:153517842-153517864 CACGGCCGCCGCCGCGGCCTCGG - Intronic