ID: 1185055465

View in Genome Browser
Species Human (GRCh38)
Location 22:48576440-48576462
Sequence CTGCGCGACTTCGGGGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 711}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185055457_1185055465 11 Left 1185055457 22:48576406-48576428 CCGGCGGGGCGCTGATGCGGCGC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1185055465 22:48576440-48576462 CTGCGCGACTTCGGGGGCGTCGG 0: 1
1: 0
2: 0
3: 14
4: 711
1185055456_1185055465 12 Left 1185055456 22:48576405-48576427 CCCGGCGGGGCGCTGATGCGGCG 0: 1
1: 0
2: 1
3: 12
4: 95
Right 1185055465 22:48576440-48576462 CTGCGCGACTTCGGGGGCGTCGG 0: 1
1: 0
2: 0
3: 14
4: 711
1185055452_1185055465 26 Left 1185055452 22:48576391-48576413 CCGCGGAGGCTGCACCCGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1185055465 22:48576440-48576462 CTGCGCGACTTCGGGGGCGTCGG 0: 1
1: 0
2: 0
3: 14
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185055465 Original CRISPR CTGCGCGACTTCGGGGGCGT CGG Intronic
900117329 1:1034206-1034228 CTGCGCGGCTCCGGGGGCTCCGG + Intronic
900201172 1:1407323-1407345 CTGCGATACTTCCGGGGCGAAGG + Intergenic
900814203 1:4830913-4830935 CTGCTCGACCTCGGGGGTGGGGG + Intergenic
902144641 1:14387959-14387981 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
903732541 1:25506945-25506967 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
906084558 1:43120154-43120176 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
906229296 1:44147080-44147102 CTGGGCGCCTTCTGGGGCCTGGG + Intergenic
906306794 1:44724720-44724742 CGGCGTGACTGCGGGGGCGACGG - Intronic
906760145 1:48369546-48369568 CAGCGAGACTCCGTGGGCGTAGG + Intronic
907838278 1:58132103-58132125 CAGCGAGACTCCGTGGGCGTAGG + Intronic
908086447 1:60640370-60640392 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
908452933 1:64273788-64273810 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
908584189 1:65550586-65550608 CAGCGAGACTCCGTGGGCGTAGG + Intronic
908978743 1:69928577-69928599 CAGCGAGACTCCGTGGGCGTAGG + Intronic
909036632 1:70600896-70600918 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
909114209 1:71514070-71514092 CAGCGCGATTCCGTGGGCGTAGG - Intronic
909421936 1:75476622-75476644 CAGCGAGACTCCGTGGGCGTAGG - Intronic
909727301 1:78851094-78851116 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
909983858 1:82136564-82136586 CAGCGAGACTCCGGGGGCGTAGG + Intergenic
910082348 1:83356083-83356105 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
910157390 1:84234559-84234581 CAGCGAGACTCCGTGGGCGTAGG + Intronic
910636875 1:89418233-89418255 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
910643778 1:89491343-89491365 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
910815398 1:91287007-91287029 CAGCGAGACTCCGTGGGCGTAGG - Intronic
911225265 1:95297880-95297902 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
911291072 1:96057350-96057372 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
911307290 1:96246743-96246765 CAGCGAGACTCCGTGGGCGTGGG + Intergenic
911338040 1:96604746-96604768 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
911859913 1:102933735-102933757 CAGCGAGACTCCGTGGGCGTAGG + Intronic
911988796 1:104664490-104664512 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
911996761 1:104775897-104775919 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
912002265 1:104849484-104849506 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
913040697 1:115019809-115019831 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
914410609 1:147423578-147423600 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
915808976 1:158886463-158886485 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
916333645 1:163645661-163645683 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
917182484 1:172314609-172314631 CAGCGAGACTCCGTGGGCGTAGG - Intronic
917259727 1:173154091-173154113 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
917547943 1:175992617-175992639 CAGCGAGACTCCGTGGGCGTAGG - Intronic
917575173 1:176314025-176314047 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
917774637 1:178320438-178320460 CAGCGAGACTCCGTGGGCGTAGG + Intronic
918351268 1:183658429-183658451 CAGCGAGACTCCGTGGGCGTAGG - Intronic
918483227 1:185001890-185001912 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
918506265 1:185257426-185257448 CAGCGAGACTCCGTGGGCGTAGG + Intronic
918624069 1:186637690-186637712 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
919446148 1:197708074-197708096 CAGCGCGATTCCGTGGGCGTAGG - Intronic
920638766 1:207730825-207730847 CAGCGAGACTCCGTGGGCGTAGG - Intronic
922197481 1:223372313-223372335 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
922618276 1:226976132-226976154 CTGCGGGACTGCGGGGCTGTGGG + Intronic
922618288 1:226976180-226976202 CTGCGGGACTGCGGGGCTGTGGG + Intronic
922618314 1:226976284-226976306 CTGCGGGACTGCGGGGCTGTGGG + Intronic
922618327 1:226976332-226976354 CTGCGGGACTGCGGGGCTGTGGG + Intronic
923786810 1:237075622-237075644 CAGCGCGATTCCGTGGGCGTAGG - Intronic
924007582 1:239629147-239629169 CAGCGAGACTCCGTGGGCGTAGG + Exonic
924008956 1:239643538-239643560 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1063326619 10:5109980-5110002 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1064011086 10:11737087-11737109 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1064761680 10:18627754-18627776 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1066033080 10:31449058-31449080 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1066034707 10:31469559-31469581 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1066239133 10:33516496-33516518 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1066487257 10:35859029-35859051 CAGCGAGACTGCGTGGGCGTAGG - Intergenic
1066687653 10:37995789-37995811 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1067843270 10:49698831-49698853 CTGCCTGACTTCGGAGGCCTCGG - Intronic
1067987267 10:51163766-51163788 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1068050829 10:51947233-51947255 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1068340005 10:55688712-55688734 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1068355084 10:55900000-55900022 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1069353643 10:67558858-67558880 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1070893018 10:79956526-79956548 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1071459297 10:85876978-85877000 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1071891341 10:90011416-90011438 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1072446741 10:95505274-95505296 CTGCGGGACTCCGTGGGAGTGGG + Intronic
1072855059 10:98937457-98937479 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1072874072 10:99153098-99153120 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1073837717 10:107463905-107463927 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1073987292 10:109223971-109223993 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1074282163 10:112062751-112062773 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1074639857 10:115368170-115368192 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1074903286 10:117838532-117838554 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1075700352 10:124465257-124465279 CTTGGCGAGTTCGAGGGCGTGGG + Intronic
1076353952 10:129839004-129839026 CGGCGGCACTTCGGGGGCCTGGG + Intronic
1077524761 11:3057426-3057448 GGGCGCGACTTCCGGGGCGGCGG - Exonic
1077857543 11:6144006-6144028 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1077861552 11:6185706-6185728 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1078029452 11:7734859-7734881 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1078304803 11:10173507-10173529 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1079549331 11:21674687-21674709 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1079575765 11:22001429-22001451 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1079629158 11:22652566-22652588 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1079922640 11:26451456-26451478 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1079964596 11:26965474-26965496 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1079988227 11:27220061-27220083 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1080234855 11:30056852-30056874 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1080579443 11:33630425-33630447 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1080705906 11:34692460-34692482 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1081086780 11:38811538-38811560 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1081382660 11:42434908-42434930 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1081468929 11:43351737-43351759 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1082666956 11:55986380-55986402 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1082877105 11:57999805-57999827 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1083920984 11:65781266-65781288 CTGCGCGGCTTGGCGGGCGCTGG - Intergenic
1085222073 11:74883156-74883178 CTGTGAGACTCCGTGGGCGTAGG + Intronic
1085343429 11:75748973-75748995 CTGTGAGACTCCGTGGGCGTAGG - Intergenic
1086489561 11:87345680-87345702 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1086516923 11:87623791-87623813 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1086882837 11:92169761-92169783 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1087067095 11:94037215-94037237 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1087451599 11:98330544-98330566 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1087598710 11:100286102-100286124 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1087608807 11:100409411-100409433 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1087687465 11:101281100-101281122 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1087722657 11:101684173-101684195 CGGCGAGACTCCGTGGGCGTAGG + Intronic
1087737673 11:101852844-101852866 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1087787809 11:102374812-102374834 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1087824286 11:102747084-102747106 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1088012152 11:105016652-105016674 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1088203165 11:107362170-107362192 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1088204132 11:107373118-107373140 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1088292959 11:108260984-108261006 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1088300925 11:108357291-108357313 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1088334162 11:108685177-108685199 CAGCGCGATTCCGTGGGCGTAGG + Intronic
1088473265 11:110209335-110209357 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1088731132 11:112684193-112684215 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1090290252 11:125536967-125536989 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1090690323 11:129174288-129174310 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1091185274 11:133641161-133641183 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1091627726 12:2135952-2135974 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1091943178 12:4509244-4509266 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1092012031 12:5122061-5122083 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1092939779 12:13397254-13397276 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1093325919 12:17774013-17774035 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1093332085 12:17855902-17855924 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1093631861 12:21419566-21419588 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1093776148 12:23076272-23076294 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1095416119 12:41978952-41978974 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1095423422 12:42049260-42049282 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1095553351 12:43471332-43471354 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1095678915 12:44951319-44951341 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1096433470 12:51568280-51568302 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1096921125 12:55087026-55087048 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1097310619 12:58114929-58114951 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1097838023 12:64292997-64293019 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1098624016 12:72640149-72640171 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1098767563 12:74509163-74509185 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1098923013 12:76319985-76320007 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1099106769 12:78506791-78506813 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1099146131 12:79045266-79045288 CAGCGAGACTACGTGGGCGTAGG + Intronic
1099268387 12:80477876-80477898 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1099514802 12:83584627-83584649 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1099643224 12:85318079-85318101 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1100238356 12:92683972-92683994 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1101629281 12:106477509-106477531 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1101929047 12:108997307-108997329 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1105316858 13:19273354-19273376 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1105338502 13:19497146-19497168 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1105906145 13:24812287-24812309 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1106246495 13:27954386-27954408 GGGCGCGACTTCCGGGGCGACGG + Intergenic
1106913268 13:34485913-34485935 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1107304779 13:39006496-39006518 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1107475912 13:40735277-40735299 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1107489785 13:40870216-40870238 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1107973757 13:45669838-45669860 CAGTGAGACTTCGTGGGCGTAGG + Intergenic
1108296097 13:49019247-49019269 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1108308018 13:49158166-49158188 CTGTGAGACTCCGTGGGCGTAGG + Intronic
1108628312 13:52254675-52254697 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1108837727 13:54572599-54572621 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1110180404 13:72610608-72610630 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1110328181 13:74241595-74241617 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1111917120 13:94372560-94372582 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1112061042 13:95740456-95740478 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1113122135 13:106934982-106935004 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1114869192 14:26634918-26634940 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1114945276 14:27673419-27673441 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1114982938 14:28188800-28188822 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1115368314 14:32583745-32583767 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1115977944 14:39017539-39017561 CAGCGCGACTCCGTGGGCCTAGG - Intergenic
1116094280 14:40348419-40348441 CAGCGCGACTCTGTGGGCGTAGG - Intergenic
1116138159 14:40954554-40954576 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1116284930 14:42958876-42958898 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1116405109 14:44557419-44557441 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1116570383 14:46508919-46508941 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1116675504 14:47901540-47901562 CAGCGAGACTCCGTGGGCGTGGG - Intergenic
1117424419 14:55580244-55580266 CTGAGCGACTGCGGCGGCGGCGG + Intronic
1117577334 14:57112571-57112593 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1118466041 14:66032226-66032248 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1119111804 14:71981931-71981953 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1120069675 14:80088888-80088910 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1120371298 14:83639670-83639692 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1120567707 14:86080139-86080161 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1123024880 14:105419864-105419886 CTGCGCGGCCTCGGCGGCCTCGG + Exonic
1202883342 14_KI270722v1_random:82157-82179 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1123444064 15:20311389-20311411 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1124152445 15:27193489-27193511 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1125412639 15:39420923-39420945 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1126248787 15:46542001-46542023 CTGCGAGACTCCGTGGGTGTAGG + Intergenic
1126501829 15:49354593-49354615 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1126505136 15:49396343-49396365 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1126661429 15:51037271-51037293 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1126707814 15:51422866-51422888 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1126922244 15:53540989-53541011 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1127031756 15:54872057-54872079 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1127740211 15:61896598-61896620 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1129940384 15:79491434-79491456 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1130190490 15:81730640-81730662 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1130197920 15:81798290-81798312 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1130205460 15:81871027-81871049 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1130218385 15:81995526-81995548 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1130382629 15:83384008-83384030 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG + Intronic
1130806896 15:87333035-87333057 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1131584197 15:93675759-93675781 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1131916449 15:97271222-97271244 CAGCGAGACTCCGTGGGCGTCGG + Intergenic
1131929095 15:97419093-97419115 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1133103891 16:3494727-3494749 CTGCGCCACCTCCGGGGCCTGGG - Exonic
1135268398 16:21048321-21048343 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1136899417 16:34019034-34019056 CTGCGAGACTTTGTGGGTGTAGG - Intergenic
1137228230 16:46535710-46535732 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1137304269 16:47183126-47183148 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1138712283 16:58983150-58983172 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1138762840 16:59564938-59564960 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1138842163 16:60523111-60523133 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1138940336 16:61782435-61782457 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1138941940 16:61801812-61801834 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1139050595 16:63120314-63120336 CTGCGAGACTCTGTGGGCGTAGG - Intergenic
1141047330 16:80727444-80727466 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1141228246 16:82139603-82139625 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1141517566 16:84556074-84556096 CTGCACGACTCCGAGGACGTCGG + Intergenic
1203073582 16_KI270728v1_random:1104561-1104583 CTGCGAGACTCTGTGGGCGTAGG + Intergenic
1142920072 17:3176890-3176912 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1142936032 17:3332356-3332378 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1143562847 17:7705547-7705569 GTGGGCGACTTTGGGGGAGTTGG + Exonic
1145724433 17:27104795-27104817 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1146420822 17:32683892-32683914 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1146520373 17:33521469-33521491 CTCCAGGACTTCGGGGGCGTTGG - Intronic
1146586662 17:34088806-34088828 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1146610162 17:34298092-34298114 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1146752505 17:35394298-35394320 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1149408608 17:56380656-56380678 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1149942672 17:60887090-60887112 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1149961089 17:61110589-61110611 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1150818363 17:68413759-68413781 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1150879233 17:69004757-69004779 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1152354743 17:79801257-79801279 CTTCGCGGCTTGGCGGGCGTCGG + Intronic
1153010698 18:536059-536081 CAGCGAGACTCCGTGGGCGTGGG - Intergenic
1153058975 18:976503-976525 CAGCGAGACTCCGTGGGCGTGGG + Intergenic
1153105556 18:1521859-1521881 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1153164601 18:2247527-2247549 CAGCGAGACTCCGTGGGCGTGGG - Intergenic
1153494615 18:5685027-5685049 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1153726994 18:7966802-7966824 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1153735536 18:8063103-8063125 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1154011431 18:10578300-10578322 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1155093103 18:22529997-22530019 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1155321600 18:24624692-24624714 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1155331023 18:24716464-24716486 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1155898029 18:31353615-31353637 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1156158474 18:34331473-34331495 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1156177000 18:34558014-34558036 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1156292528 18:35760671-35760693 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1156843059 18:41632100-41632122 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1157397327 18:47353873-47353895 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1158074400 18:53511807-53511829 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1158177165 18:54669953-54669975 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1158347022 18:56525924-56525946 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1158732101 18:60035326-60035348 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1159376850 18:67603991-67604013 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1159466540 18:68790475-68790497 CAGCGAGACTCCGAGGGCGTAGG + Intronic
1160631063 18:80246889-80246911 CTGCTCGGATTCGGGGCCGTGGG - Intronic
1160873237 19:1286347-1286369 GGGCGCGGCTTGGGGGGCGTTGG - Intronic
1165288155 19:34860548-34860570 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
925470723 2:4158169-4158191 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
926185577 2:10688192-10688214 GTGAGCGACTTCGGTGGCTTGGG - Intronic
926718487 2:15942233-15942255 CTGGGCGACAGCGGGGGCGTGGG - Exonic
926929016 2:18017643-18017665 CTGCGAGACTCCGTGGGCGTAGG + Intronic
927366637 2:22304715-22304737 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
927426239 2:22984511-22984533 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
928463346 2:31496664-31496686 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
929274845 2:40014237-40014259 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
929638345 2:43548638-43548660 CAGCGAGACTCCGTGGGCGTAGG + Intronic
930830877 2:55742002-55742024 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
930987583 2:57609196-57609218 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
931846213 2:66206678-66206700 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
931864152 2:66391489-66391511 CAGCGAGACTCCGCGGGCGTAGG - Intergenic
932077603 2:68679693-68679715 CAGCGAGACTCCGCGGGCGTAGG + Intronic
932984364 2:76707726-76707748 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
932986194 2:76728650-76728672 CAGCGGGACTCCGTGGGCGTAGG + Intergenic
932990614 2:76781398-76781420 CAGCGAGACTCCGTGGGCGTAGG + Intronic
933062358 2:77754111-77754133 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
933169670 2:79111337-79111359 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
933499080 2:83089164-83089186 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
933550381 2:83768662-83768684 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
933737104 2:85504065-85504087 CTGCGGGACTTCTGGGGCAAGGG + Intergenic
935422064 2:102879799-102879821 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
935631249 2:105214108-105214130 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
936234686 2:110732801-110732823 CTCGGCGGCTTCGGGGGCGCGGG - Intronic
936436273 2:112509460-112509482 CAGCGAGACTCCGTGGGCGTAGG + Intronic
936554004 2:113477163-113477185 CAGCGAGACTCCGTGGGCGTGGG + Intronic
936576041 2:113656506-113656528 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
936873028 2:117156387-117156409 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
936904914 2:117525745-117525767 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
936914229 2:117623611-117623633 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
936967613 2:118142638-118142660 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
937457092 2:122051865-122051887 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
937489620 2:122351935-122351957 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
937654751 2:124361954-124361976 CAGCGAGACTTCGTGGGCGTAGG + Intronic
937658876 2:124408230-124408252 CAGCGAGACTCCGTGGGCGTAGG - Intronic
938666836 2:133547224-133547246 CAGCGAGACTCCGTGGGCGTAGG - Intronic
938704487 2:133910840-133910862 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
938788545 2:134656193-134656215 CAGCGAGACTCCGTGGGCGTAGG + Intronic
939051677 2:137315152-137315174 CAGCGAGACTCCGTGGGCGTAGG + Intronic
939470402 2:142613431-142613453 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
939486000 2:142811913-142811935 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
940055299 2:149507023-149507045 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
940253426 2:151704505-151704527 CAGCGAGACTCCGTGGGCGTAGG + Intronic
940992792 2:160114874-160114896 CAGCGAGACTCCGTGGGCGTAGG - Intronic
941053611 2:160762694-160762716 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
941534726 2:166708375-166708397 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
942071058 2:172315626-172315648 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
942879285 2:180839309-180839331 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
943244210 2:185425082-185425104 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
943882943 2:193171065-193171087 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
944018509 2:195073162-195073184 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
944030456 2:195228796-195228818 CAGCGAGACTTCGTGGGCGTAGG - Intergenic
944077059 2:195744234-195744256 CAGCGAGACTCCGTGGGCGTAGG - Intronic
944257659 2:197640380-197640402 CAGCGAGACTCCGTGGGCGTAGG + Intronic
944262541 2:197693180-197693202 CAGCGAGACTCCGTGGGCGTAGG + Exonic
944266159 2:197729311-197729333 CAGCGAGACTCCGTGGGCGTAGG - Intronic
945379961 2:209128889-209128911 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
946468289 2:219932178-219932200 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
947278849 2:228425646-228425668 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
947290495 2:228568619-228568641 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
947306723 2:228756054-228756076 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG + Exonic
948820859 2:240544855-240544877 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1169283668 20:4289496-4289518 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1169672160 20:8114537-8114559 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1169714548 20:8600745-8600767 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1171281453 20:23902619-23902641 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1171466330 20:25330310-25330332 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1171569408 20:26234038-26234060 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1171941373 20:31333071-31333093 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1173346678 20:42206629-42206651 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1174790454 20:53473003-53473025 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1174793765 20:53504208-53504230 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1175512193 20:59537422-59537444 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1177116310 21:17090875-17090897 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1177810351 21:25918727-25918749 CAGCGCGATTCCGTGGGCGTAGG - Intronic
1178593387 21:33931231-33931253 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1178770484 21:35499410-35499432 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1180326221 22:11432820-11432842 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1180368255 22:11959747-11959769 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1181353806 22:22282431-22282453 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1184177738 22:42799111-42799133 CTGCGCCATGTCGGGGGCGTTGG + Exonic
1185055465 22:48576440-48576462 CTGCGCGACTTCGGGGGCGTCGG + Intronic
1185424371 22:50756946-50756968 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
949154282 3:809736-809758 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
949429813 3:3963434-3963456 CAGCGAGACTCCGTGGGCGTAGG - Intronic
949660466 3:6272656-6272678 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
950039094 3:9908348-9908370 CTGCGCTACCTTGGGGGCTTAGG - Intronic
950757386 3:15187025-15187047 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
951028998 3:17861013-17861035 CAGCGAGACTCCGTGGGCGTAGG + Intronic
951101525 3:18693917-18693939 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
951135777 3:19102967-19102989 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
951381453 3:21988814-21988836 CAGCGAGACTCCGTGGGCGTAGG + Intronic
951770002 3:26244830-26244852 CTTCGAGACTCCGTGGGCGTAGG + Intergenic
951939241 3:28059602-28059624 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
952659209 3:35824311-35824333 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
952680211 3:36083089-36083111 GAGCGAGACTTCGTGGGCGTAGG - Intergenic
953105855 3:39878115-39878137 CAGCGAGACTCCGTGGGCGTAGG + Intronic
953133188 3:40160639-40160661 CAGCGAGACTCCGTGGGCGTAGG + Intronic
953289519 3:41647966-41647988 CAGCGAGACTCCGTGGGCGTAGG + Intronic
953513358 3:43566182-43566204 CAGCGAGACTCCGTGGGCGTAGG - Intronic
954890916 3:53927424-53927446 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
954931362 3:54285305-54285327 CAGCGAGACTTCGTGGGCGTAGG - Intronic
955255265 3:57324941-57324963 CAGCGAGACTTCATGGGCGTAGG - Intronic
958063118 3:88508740-88508762 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
958134181 3:89466476-89466498 CAGCGAGACTCCGTGGGCGTAGG + Intronic
958171444 3:89944735-89944757 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
958205701 3:90388074-90388096 CAGCGAGACTTTGTGGGCGTAGG + Intergenic
959224405 3:103562188-103562210 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
959833182 3:110889172-110889194 CAGCGAGACTCCGTGGGCGTAGG - Intronic
959844660 3:111019075-111019097 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
959994416 3:112664784-112664806 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
960545900 3:118914602-118914624 CAGCGAGACTCCGTGGGCGTAGG - Intronic
960553928 3:119007109-119007131 CAGCGAGACTCCGTGGGCGTAGG + Intronic
960839101 3:121938409-121938431 CAGCGAGACTCCGTGGGCGTAGG + Intronic
962138799 3:132766273-132766295 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
962161493 3:133005279-133005301 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
962219487 3:133551688-133551710 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
962442934 3:135439477-135439499 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
962524462 3:136224656-136224678 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG + Intronic
962648085 3:137460602-137460624 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
962831718 3:139147953-139147975 CAGCGAGACTCCGTGGGCGTAGG + Intronic
962882468 3:139591315-139591337 CAGCGCGATTCCGTGGGCGTAGG - Intronic
963175204 3:142290564-142290586 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
964126735 3:153241406-153241428 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
964602463 3:158516741-158516763 CAGCGAGACTCCGTGGGCGTAGG + Intronic
965522263 3:169679846-169679868 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
965717715 3:171625224-171625246 CAGCGAGACTCCGTGGGCGTGGG - Intronic
966147419 3:176827398-176827420 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
966335198 3:178860308-178860330 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
966484149 3:180448833-180448855 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
966662140 3:182426450-182426472 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
967238476 3:187412483-187412505 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
967285261 3:187862841-187862863 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
967714281 3:192744863-192744885 CAGCGAGACTCCGTGGGCGTAGG + Intronic
970003105 4:11384392-11384414 CAGCGAGACTCCGTGGGCGTTGG + Intergenic
970219878 4:13799338-13799360 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
970283241 4:14481109-14481131 CAGCGAGACTCCGCGGGCGTAGG - Intergenic
970358187 4:15279014-15279036 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
970518880 4:16862835-16862857 TTGCTGGACTTCGGGGGCGGAGG - Intronic
971389152 4:26169844-26169866 CAGCGAGACTCCGTGGGCGTAGG + Intronic
971476331 4:27075883-27075905 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
973689398 4:53409760-53409782 CTGCGAGACTCCGTGGGCGTAGG + Intronic
973731728 4:53829406-53829428 CAGCGAGACTCCGTGGGCGTAGG + Intronic
974418977 4:61646922-61646944 CAGCGAGACTCCGTGGGCGTAGG + Intronic
974542115 4:63250623-63250645 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
974682030 4:65176948-65176970 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
974798454 4:66783129-66783151 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
975034586 4:69664368-69664390 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
975187367 4:71419465-71419487 CAGCGAGACTCCGTGGGCGTAGG + Intronic
975504968 4:75127166-75127188 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
975531246 4:75401555-75401577 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
975824673 4:78307500-78307522 CAGCGAGACTCCGTGGGCGTAGG + Intronic
976371879 4:84299138-84299160 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
976676634 4:87710732-87710754 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
977567706 4:98598082-98598104 CAGCGAGATTTCGTGGGCGTAGG + Intronic
977815675 4:101411315-101411337 CAGCGAGACTCCGTGGGCGTAGG + Intronic
978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG + Intergenic
978680758 4:111378265-111378287 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
979299212 4:119067682-119067704 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
979432492 4:120648105-120648127 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
979634860 4:122945414-122945436 CAGCGAGACTCCGTGGGCGTAGG + Intronic
979640160 4:123004078-123004100 CAGCGAGACTCCGTGGGCGTAGG + Intronic
979965152 4:127068221-127068243 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
980016472 4:127655868-127655890 CAGCGAGACTCCGTGGGCGTAGG + Intronic
980018160 4:127676970-127676992 CAGCGAGACTCCGTGGGCGTAGG - Intronic
980149050 4:129023909-129023931 CAGCGAGACTCCGTGGGCGTAGG - Intronic
980316645 4:131209672-131209694 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
980920740 4:139083683-139083705 CTGCCCGCGTTCGGGGGCGGCGG - Intronic
981283718 4:142991236-142991258 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
981345009 4:143664858-143664880 CAGCGAGACTCCGTGGGCGTAGG + Intronic
983341242 4:166463671-166463693 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
983402408 4:167281779-167281801 CCGCGAGACTCCGTGGGCGTAGG + Intergenic
983446381 4:167858246-167858268 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
983495922 4:168442350-168442372 CAGCGAGACTCCGTGGGCGTAGG - Intronic
983798987 4:171903490-171903512 CAGCGAGACTCCGTGGGCGTGGG - Intronic
984198795 4:176692473-176692495 CAGCGAGACTCCGTGGGCGTAGG - Intronic
984572866 4:181414534-181414556 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
984696430 4:182784699-182784721 CAGCGAGACTCCGTGGGCGTAGG + Intronic
984857659 4:184208586-184208608 CAGCGAGACTCCGTGGGCGTAGG - Intronic
985065410 4:186116039-186116061 CAGCGAGACTCCGTGGGCGTGGG + Intronic
985307935 4:188563906-188563928 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
985357473 4:189136867-189136889 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
985755258 5:1710175-1710197 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
986101492 5:4615786-4615808 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
987980975 5:25083304-25083326 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
988003957 5:25384177-25384199 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
988086020 5:26476401-26476423 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
988648497 5:33122730-33122752 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
988690676 5:33568965-33568987 CAGCGAGACTCCGTGGGCGTAGG - Intronic
988880254 5:35494532-35494554 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
989138068 5:38175147-38175169 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
989492953 5:42078643-42078665 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
989544748 5:42659979-42660001 CAGCGAGACTCCGTGGGCGTAGG - Intronic
990191855 5:53268356-53268378 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
990600842 5:57357145-57357167 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
990707105 5:58541909-58541931 CAGCGAGACTCCGTGGGCGTAGG + Exonic
991107886 5:62863509-62863531 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
991304697 5:65164377-65164399 CAGCGAGACTCCGTGGGCGTAGG - Intronic
991320727 5:65370622-65370644 CAGCGAGACTCCGTGGGCGTAGG - Intronic
991549255 5:67818294-67818316 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
991555420 5:67889965-67889987 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
991916406 5:71610213-71610235 CAGCGAGACTCCGTGGGCGTAGG + Intronic
992328977 5:75696059-75696081 CAGTGAGACTTCGTGGGCGTAGG - Intronic
992606092 5:78457830-78457852 CAGCGAGACTCCGTGGGCGTAGG + Intronic
993046492 5:82872506-82872528 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
993051637 5:82932803-82932825 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
993612604 5:90073588-90073610 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
993790239 5:92199113-92199135 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
993871672 5:93261396-93261418 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
994290396 5:98022957-98022979 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
994693546 5:103047100-103047122 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
994780252 5:104080003-104080025 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
994882761 5:105518893-105518915 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
996231057 5:121064598-121064620 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
996335829 5:122383186-122383208 CAGCGAGACTCCGTGGGCGTAGG + Intronic
996832225 5:127752758-127752780 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
997087432 5:130818095-130818117 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
997742940 5:136273575-136273597 CTGCGAGACTTCGGGGCTGCTGG - Intronic
998982640 5:147721494-147721516 CAGCGAGACTCCGTGGGCGTAGG + Intronic
999091827 5:148942620-148942642 CAGCGAGACTCCGTGGGCGTAGG - Intronic
999548674 5:152659596-152659618 CAGCGAGACTCCGTGGGCGTGGG + Intergenic
999584599 5:153076633-153076655 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1000424170 5:161071711-161071733 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1000468712 5:161611702-161611724 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1000544169 5:162578394-162578416 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1001262696 5:170245418-170245440 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1001359172 5:171063932-171063954 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1001662768 5:173408447-173408469 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1001898071 5:175398129-175398151 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1002231991 5:177772605-177772627 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1202775177 5_GL000208v1_random:63091-63113 CAGCGAGACTTCGTGGGTGTAGG + Intergenic
1003413969 6:5891852-5891874 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1003446606 6:6190869-6190891 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1003457868 6:6300387-6300409 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1003813444 6:9811110-9811132 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1003827763 6:9971670-9971692 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1005723043 6:28621591-28621613 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1008801106 6:55369087-55369109 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1008968091 6:57335208-57335230 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1009499189 6:64390120-64390142 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1009984977 6:70771521-70771543 CAGCAAGACTCCGGGGGCGTAGG + Intronic
1010263334 6:73841055-73841077 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1011550416 6:88526968-88526990 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1011804246 6:91052788-91052810 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1011999628 6:93637228-93637250 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1012406959 6:98911049-98911071 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1012434875 6:99204643-99204665 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1012527603 6:100196820-100196842 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1012673639 6:102088558-102088580 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1012854820 6:104489752-104489774 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1012923541 6:105244734-105244756 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1013344905 6:109250870-109250892 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1013622993 6:111908641-111908663 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1013704201 6:112813381-112813403 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1013762182 6:113531477-113531499 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1013886685 6:114976022-114976044 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1014076812 6:117245111-117245133 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1014702955 6:124712463-124712485 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1014704183 6:124726054-124726076 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1015432504 6:133147725-133147747 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1017394300 6:153979280-153979302 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1018340264 6:162844243-162844265 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1018533011 6:164787603-164787625 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1018749310 6:166789234-166789256 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1020449306 7:8303760-8303782 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1020536501 7:9404407-9404429 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1020881321 7:13766003-13766025 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1020884691 7:13806626-13806648 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1020924961 7:14313628-14313650 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1020948658 7:14647991-14648013 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1021016984 7:15547662-15547684 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1021047404 7:15940588-15940610 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1021359064 7:19689333-19689355 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1021373878 7:19883413-19883435 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1021671145 7:23036087-23036109 CAGCGAGATTCCGGGGGCGTAGG - Intergenic
1021875733 7:25047510-25047532 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1022439314 7:30420125-30420147 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1022532748 7:31076998-31077020 CTGCGGGTCTTCGGGGGTGTGGG + Intronic
1022586687 7:31619978-31620000 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1022630760 7:32082233-32082255 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1022654733 7:32308104-32308126 CAGCGAGACTCCGTGGGCGTTGG - Intergenic
1022695672 7:32703162-32703184 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1022696199 7:32708365-32708387 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1022775916 7:33527393-33527415 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1022824389 7:33994265-33994287 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1027639253 7:80713466-80713488 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1027819386 7:83024452-83024474 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1027896807 7:84055349-84055371 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1027989225 7:85335362-85335384 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1028119347 7:87040117-87040139 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1028252841 7:88556684-88556706 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1028421670 7:90639889-90639911 CGGCGAGACTCCGTGGGCGTAGG + Intronic
1028467983 7:91173803-91173825 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1028507230 7:91583630-91583652 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1028507889 7:91590010-91590032 CAGCGAGACTTTGTGGGCGTAGG - Intergenic
1028665779 7:93342324-93342346 CAGCGAGACTTCGTGGGCATGGG - Intronic
1029044557 7:97614016-97614038 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1029915989 7:104210090-104210112 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1029949026 7:104563327-104563349 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1030792163 7:113743260-113743282 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1030893692 7:115030732-115030754 CAGCGGGACTCCGTGGGCGTAGG + Intergenic
1031029985 7:116724128-116724150 CAGCGGGACTCCGTGGGCGTAGG + Intronic
1032910180 7:136419832-136419854 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1033401796 7:141032957-141032979 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1033504398 7:141985732-141985754 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1033960361 7:146906148-146906170 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1033962203 7:146928807-146928829 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1035156160 7:156915159-156915181 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1036689804 8:10938046-10938068 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1037232029 8:16670478-16670500 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1039127055 8:34215294-34215316 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1040405779 8:47100599-47100621 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1041017949 8:53609865-53609887 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1041371370 8:57164276-57164298 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1041613772 8:59882211-59882233 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1041736938 8:61121018-61121040 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1041752274 8:61273636-61273658 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1041949969 8:63489955-63489977 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1042010564 8:64240454-64240476 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1042087095 8:65120997-65121019 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1042434113 8:68743730-68743752 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1042476525 8:69254578-69254600 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1042487003 8:69357037-69357059 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1042779920 8:72479794-72479816 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1042970440 8:74402324-74402346 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1043009737 8:74866879-74866901 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1043016729 8:74948297-74948319 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1043045928 8:75324579-75324601 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1043181244 8:77088771-77088793 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1043713128 8:83447503-83447525 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1043976627 8:86591985-86592007 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1044353867 8:91197488-91197510 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1044402996 8:91793912-91793934 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1045044425 8:98260625-98260647 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1045083157 8:98650710-98650732 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1045087268 8:98700135-98700157 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1045386761 8:101678429-101678451 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1045433174 8:102133111-102133133 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1045592002 8:103608636-103608658 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1045607046 8:103788916-103788938 CAGCGAGACTCCGTGGGCGTTGG + Intronic
1045897970 8:107240967-107240989 CAGCGAGACTACGTGGGCGTCGG - Intergenic
1045954965 8:107895525-107895547 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1046770439 8:118111988-118112010 CGGCGCGGCGTTGGGGGCGTAGG + Intergenic
1046894845 8:119461977-119461999 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1047008877 8:120649812-120649834 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1047070163 8:121334436-121334458 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1047149513 8:122244778-122244800 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1048125912 8:131635527-131635549 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1048540297 8:135335751-135335773 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1049206425 8:141365729-141365751 CTGTGAGACACCGGGGGCGTGGG + Intronic
1050337787 9:4606145-4606167 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1050486125 9:6136204-6136226 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1050490435 9:6182857-6182879 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1051060348 9:13038243-13038265 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1051458759 9:17290654-17290676 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1051584386 9:18711593-18711615 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1051655229 9:19374819-19374841 CTGCTCGCCATCCGGGGCGTAGG + Intergenic
1052083028 9:24230298-24230320 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1052148206 9:25076588-25076610 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1052478298 9:28990225-28990247 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1052594415 9:30539823-30539845 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1052632742 9:31061838-31061860 CAGCGAGACTTCGTGGGCGTAGG + Intergenic
1052650386 9:31294425-31294447 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1053742049 9:41150319-41150341 CCGCGAGACTCCGTGGGCGTGGG - Intronic
1054347314 9:63980121-63980143 CAGCGAGACTCCGTGGGCGTGGG - Intergenic
1054425424 9:65062351-65062373 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1054445043 9:65306463-65306485 CAGCGAGACTCCGTGGGCGTGGG - Intergenic
1054485231 9:65715043-65715065 CAGCGAGACTCCGTGGGCGTGGG + Intronic
1054686295 9:68280981-68281003 CAGCGAGACTCCGTGGGCGTGGG + Intronic
1055745453 9:79439320-79439342 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1055853513 9:80659755-80659777 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1055860826 9:80747311-80747333 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1056093571 9:83228579-83228601 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1056393221 9:86157447-86157469 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1057086430 9:92214768-92214790 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1057163157 9:92905690-92905712 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1057322359 9:94026113-94026135 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1057329001 9:94094722-94094744 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1057513187 9:95697939-95697961 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1057638855 9:96797364-96797386 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1057773327 9:97984981-97985003 CGGCGCGGCTGCGTGGGCGTGGG + Intronic
1058051556 9:100411667-100411689 CTGCGGGGCTTCGCGGGCTTTGG - Intergenic
1058215156 9:102223552-102223574 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1061833287 9:133310372-133310394 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1062531156 9:137001025-137001047 CGGCGAGACCTCGGGGGCGGCGG + Intergenic
1062531164 9:137001042-137001064 CGGCGGGACCTCGGGGGCGGCGG + Intergenic
1062573068 9:137194413-137194435 CTGCTGGACTTCGGGGCTGTGGG - Intronic
1186041162 X:5480814-5480836 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1186176751 X:6932840-6932862 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1186243341 X:7593373-7593395 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1186968017 X:14809551-14809573 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1187223053 X:17348135-17348157 CTCCGAGACTCCGTGGGCGTAGG + Intergenic
1187271787 X:17787007-17787029 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1188420673 X:29987502-29987524 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1188936014 X:36175945-36175967 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1188940839 X:36235388-36235410 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1189562723 X:42207802-42207824 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1189597960 X:42590019-42590041 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1190556943 X:51645118-51645140 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1191038437 X:56052912-56052934 CTGCGAGACTCCGTGGGCGTAGG + Intergenic
1191194763 X:57708883-57708905 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1192096467 X:68217275-68217297 CAGCGAGACTGCGTGGGCGTAGG - Intronic
1192290441 X:69788937-69788959 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1192294043 X:69828345-69828367 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1192668784 X:73117269-73117291 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1192843180 X:74878634-74878656 CAGCGGGACTCCGTGGGCGTAGG + Intronic
1192871478 X:75188668-75188690 CAGCGAGACTTCGTGGGCGTAGG + Intergenic
1192906848 X:75560797-75560819 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1193015288 X:76725676-76725698 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1193323951 X:80157076-80157098 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1193603946 X:83542754-83542776 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1193884634 X:86969984-86970006 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1194265886 X:91753160-91753182 CAGCGAGACTCCGTGGGCGTTGG - Intergenic
1194271846 X:91825320-91825342 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1194417098 X:93627686-93627708 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1194951752 X:100135298-100135320 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1194962873 X:100255841-100255863 CAGCGAGACTCCGTGGGCGTTGG - Intergenic
1195104060 X:101585809-101585831 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1195233709 X:102876944-102876966 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1195339988 X:103897156-103897178 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1195355149 X:104032522-104032544 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1195886572 X:109645018-109645040 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1195983650 X:110606189-110606211 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1196004616 X:110822395-110822417 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1196183305 X:112718969-112718991 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1196359564 X:114836351-114836373 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1197284766 X:124582904-124582926 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1197299179 X:124757263-124757285 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1197370014 X:125614588-125614610 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1197410506 X:126109768-126109790 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1197502236 X:127256111-127256133 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1197624109 X:128783014-128783036 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1197917598 X:131553047-131553069 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1197919674 X:131579037-131579059 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1197927703 X:131664312-131664334 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1197972844 X:132133123-132133145 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1198418555 X:136445919-136445941 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1198980649 X:142391241-142391263 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1199578137 X:149334361-149334383 CGGCGAGACTCCGTGGGCGTAGG - Intergenic
1199587944 X:149436174-149436196 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1199705425 X:150421081-150421103 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1200331728 X:155305225-155305247 CAGCGAGACTCCGTGGGCGTGGG + Intronic
1200357603 X:155568207-155568229 CAGCGAGACTCCGTGGGCGTAGG - Intronic
1200589095 Y:5046757-5046779 CAGCGAGACTCCGTGGGCGTAGG + Intronic
1200740911 Y:6852786-6852808 CAGCGAGACTCCGTGGGCGTAGG - Intergenic
1201359995 Y:13136142-13136164 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1201364045 Y:13184734-13184756 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1201933404 Y:19378933-19378955 CAGCGAGACTCCGTGGGCGTAGG + Intergenic
1202055595 Y:20826639-20826661 CTGCGAGACTCCGTGGGCGAAGG + Intergenic