ID: 1185056274

View in Genome Browser
Species Human (GRCh38)
Location 22:48580052-48580074
Sequence GTACACCGTGCCGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185056274_1185056282 17 Left 1185056274 22:48580052-48580074 CCAGCGGCCGCGGCACGGTGTAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1185056282 22:48580092-48580114 AAGCGCTTTCAGAACCGCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185056274 Original CRISPR GTACACCGTGCCGCGGCCGC TGG (reversed) Intronic
901146730 1:7069974-7069996 CTACTCCTTGCCGCGGCCTCTGG + Intronic
903389288 1:22953069-22953091 GTACAGAGTGCTGCGGCTGCGGG - Exonic
906556562 1:46718864-46718886 GGACACGGTGCCGCGGGCGACGG + Exonic
923102402 1:230826939-230826961 ATACACCGTGCCAAGGCCCCTGG + Intergenic
1065025317 10:21534891-21534913 CCGCCCCGTGCCGCGGCCGCGGG + Intronic
1077319981 11:1936771-1936793 GGACACCGTCCCGTGGCCCCTGG - Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1143622014 17:8086190-8086212 GTACACCGTGCAGTGCCCTCAGG - Exonic
1163606747 19:18280114-18280136 GTACACCGCGCCGCGGAAGGGGG - Exonic
937284527 2:120741711-120741733 GCCGACCGTGCCGCGGCCGGGGG + Intronic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
1183484056 22:38080015-38080037 GGACACCTTGCGGGGGCCGCAGG - Intronic
1184678075 22:46054168-46054190 AGACACCGAGCCGCGGCCACAGG + Intronic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
950601305 3:14037622-14037644 GGATCCCGTGCCGGGGCCGCGGG - Intronic
954701208 3:52451842-52451864 GTCCACCGTGCCGCTGCCTGGGG + Exonic
968653883 4:1770465-1770487 GGACCCCGTGCCCGGGCCGCAGG - Intergenic
971757606 4:30722132-30722154 GAACACGCTGCTGCGGCCGCCGG - Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984966215 4:185142931-185142953 AGACACCGGGCCGCTGCCGCCGG - Intergenic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
998166752 5:139848570-139848592 GCACGCCGTGTCGCTGCCGCCGG - Exonic
1008525460 6:52403176-52403198 GCACTCCGTGCCGCGCCCTCAGG - Exonic
1013656666 6:112253945-112253967 GGACACTGTACCTCGGCCGCAGG + Exonic
1016151039 6:140743894-140743916 GTACACCATGCTGCAGCTGCTGG - Intergenic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1019312496 7:369562-369584 GTCCACTGTGCCGAGGCCCCGGG + Intergenic
1022396021 7:29989118-29989140 GGACACGGTGCGGCGGCCGCGGG + Intronic
1042155562 8:65841538-65841560 GCCCGCCCTGCCGCGGCCGCCGG + Exonic
1053372724 9:37576234-37576256 GGAGTCCGGGCCGCGGCCGCCGG + Exonic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic