ID: 1185057376

View in Genome Browser
Species Human (GRCh38)
Location 22:48588020-48588042
Sequence AGGGGGCTCCTGGCACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 406}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057376_1185057392 23 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057376_1185057387 7 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057387 22:48588050-48588072 GCTCCATCTGTGCATAATGGGGG No data
1185057376_1185057391 22 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057376_1185057385 5 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057385 22:48588048-48588070 AAGCTCCATCTGTGCATAATGGG 0: 1
1: 0
2: 1
3: 5
4: 119
1185057376_1185057390 21 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057376_1185057394 25 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057376_1185057384 4 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057384 22:48588047-48588069 CAAGCTCCATCTGTGCATAATGG 0: 1
1: 0
2: 1
3: 15
4: 99
1185057376_1185057386 6 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057386 22:48588049-48588071 AGCTCCATCTGTGCATAATGGGG No data
1185057376_1185057389 16 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057376_1185057395 29 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057376_1185057393 24 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057376 Original CRISPR AGGGGGCTCCTGGCACCTGC AGG (reversed) Intronic
900144014 1:1150269-1150291 AGGTGGGTCCCAGCACCTGCAGG + Intergenic
900292294 1:1928682-1928704 GGGGGGCTCCGGCCACGTGCCGG - Intronic
900301569 1:1980591-1980613 TGGGGGTTCCTGGGACCTGCTGG + Intronic
900360979 1:2288971-2288993 AGGCGGCACCGGGGACCTGCAGG - Intronic
900550377 1:3251529-3251551 AGTGGTATCATGGCACCTGCAGG + Intronic
900605619 1:3522387-3522409 AGGAGGCTCCTGGGACCTCGGGG - Intronic
900786279 1:4652800-4652822 AGGGAGGTCCTGGAACCAGCGGG - Intergenic
901193440 1:7426068-7426090 AGGGGCCTCCTGGCATCTGCAGG + Intronic
901436842 1:9251665-9251687 AGTGAGCTCCTGGCCCCTTCTGG - Intronic
901664198 1:10817210-10817232 CGGAGGCTCCTGGGGCCTGCAGG + Intergenic
902247310 1:15129347-15129369 AGGGGGGTCCTGGCACCCAGAGG - Intergenic
902278645 1:15358472-15358494 AGAGGGCTCCTGGCATCTGGTGG - Intronic
902366137 1:15975724-15975746 AGGGGGCGCGTGTCACCTCCCGG - Intronic
902554660 1:17239893-17239915 TGGGGGCTGCTGGGGCCTGCAGG + Intronic
902779513 1:18695537-18695559 CAGAGGCTCCTGGCCCCTGCAGG - Intronic
902821092 1:18943978-18944000 TGGGGGCTGCTGGCACTTTCAGG - Intronic
903023913 1:20413497-20413519 AAGGGCCTCCTGGCACCAGACGG + Intergenic
903549744 1:24149686-24149708 TGGGGGCTCCAGGCTCCTACTGG + Intergenic
904118024 1:28176565-28176587 GGGGGAATCCTGGCCCCTGCTGG - Intronic
904424896 1:30416897-30416919 CGGGGGCTCCTGGCAGCTCCTGG - Intergenic
905884606 1:41484950-41484972 AGGGGGCTCGGGGCAGCTGGGGG - Intergenic
905915501 1:41681719-41681741 AGTGGGCTGGTGGCACCTGAGGG + Intronic
907243110 1:53091478-53091500 AGGGGGCTGCTGGCTCTGGCTGG + Intronic
907294317 1:53439698-53439720 AATGGGCTCCTGGTAGCTGCAGG + Intergenic
909673450 1:78213861-78213883 AGGGGTGTCCTGGGTCCTGCAGG - Intergenic
910338273 1:86156918-86156940 AGGGGGCCGGTGGCAACTGCAGG + Intronic
912432562 1:109636763-109636785 AGGAGGCTCCTGCCACATCCCGG + Intergenic
912501753 1:110127239-110127261 TGGAGCCTCCTGGCACCAGCAGG + Intergenic
913975409 1:143451180-143451202 GGGGCGCTCCTGGGACCTGCGGG - Intergenic
914069801 1:144276796-144276818 GGGGCGCTCCTGGGACCTGCGGG - Intergenic
914109354 1:144689558-144689580 GGGGCGCTCCTGGGACCTGCGGG + Intergenic
915070264 1:153260808-153260830 AGGGCTCTCCGGGCACCTGAAGG + Intronic
915320332 1:155052649-155052671 TGGGGTGTCCTGGGACCTGCAGG + Exonic
916914450 1:169391374-169391396 AGGGGGATCCCAGCAGCTGCAGG - Intronic
917076172 1:171207408-171207430 TGGGGCCTCCTGTCACCTTCAGG + Intronic
918243648 1:182640979-182641001 ATGGGGCTCCTGACCCCTCCAGG - Intergenic
921157785 1:212451849-212451871 AGCAGGCTCCTGACACCTGTGGG + Intergenic
922289969 1:224201875-224201897 ATGGGGCTCCTGCCAAGTGCCGG + Intergenic
923033132 1:230265483-230265505 AGGAAGCACCTGGCTCCTGCTGG + Intronic
923481563 1:234389897-234389919 AGGCGGCTCATGGCACCAGCAGG - Intergenic
923612047 1:235504388-235504410 GGGGGGCTCCTCGCAGCTCCCGG + Exonic
923648083 1:235845125-235845147 GGGGGTCTCCTGGGGCCTGCAGG - Intronic
924052779 1:240093597-240093619 GGGAGGCTCCGCGCACCTGCTGG + Exonic
1063033972 10:2266890-2266912 AGGTTGATTCTGGCACCTGCTGG - Intergenic
1064119209 10:12604732-12604754 TGGGAGCTCCTGGCACCTACAGG - Intronic
1064549011 10:16479808-16479830 AGGGGGCCCGTTGTACCTGCAGG - Intronic
1064995055 10:21289261-21289283 AGGGGAATCCTGACACCAGCTGG + Intergenic
1065019983 10:21495833-21495855 CGGAGGCGCCCGGCACCTGCAGG + Exonic
1065523410 10:26593957-26593979 GGGGTGCTCCTGGCTCCTGGTGG - Intergenic
1065529340 10:26653088-26653110 GGGGTGCTCCTGGCTCCTGGTGG - Intergenic
1065875503 10:29994135-29994157 AGAAGGCTCCTGGCATCTGGTGG - Intergenic
1066460535 10:35608541-35608563 AGGGGGCTGCAGGCTGCTGCAGG - Exonic
1067931196 10:50563899-50563921 AGGCTGCTCCTGGCACTTGGAGG - Intronic
1070594233 10:77821216-77821238 TGGGGACTCCTCCCACCTGCCGG - Exonic
1072156487 10:92728639-92728661 GGGGTGCTGCTGGCACCTACTGG - Intergenic
1073497941 10:103911328-103911350 AGGGCTGTCCTGGCTCCTGCAGG + Intronic
1074863590 10:117532029-117532051 AGGGGCTCCCAGGCACCTGCTGG - Intergenic
1075112193 10:119596542-119596564 GGGGGGCTCTGGGCACCGGCTGG + Intronic
1075515370 10:123104113-123104135 GGGGAGCTCCGGGCAGCTGCGGG + Intergenic
1075644336 10:124087687-124087709 TGGGGGCTCCTGGCTTCGGCAGG - Intronic
1076555917 10:131321309-131321331 AGGCGGGTGCTGGGACCTGCTGG - Intergenic
1076673351 10:132135172-132135194 CGGGGGCTTCTGGCTCCTGGGGG + Intronic
1076698266 10:132257380-132257402 AGGTGGCTCCTGGCAGCCACAGG + Intronic
1076732871 10:132447061-132447083 GGGGGGCCCCTGGCACTGGCAGG + Intronic
1076836051 10:133021419-133021441 AGGGGACGCCTGGCACGTGCCGG + Intergenic
1076917620 10:133432508-133432530 AGGGTGCCCCTGGCCCCTGGGGG - Intergenic
1076937618 10:133576583-133576605 AGGGTGCCCCTGGCCCCTGGGGG - Intergenic
1076979755 11:198161-198183 AGGGGGCTGCTGGGACAAGCAGG - Intronic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1077092521 11:786155-786177 AGAGGTATCCTGGCACCTGTGGG + Intergenic
1077501099 11:2910026-2910048 AGGGTGCTCCTGTCCCCAGCAGG - Intronic
1078485819 11:11722308-11722330 GGGGGGCCCATGGGACCTGCCGG - Intergenic
1079071573 11:17352067-17352089 CGGGGGCTCCTGGCGCCAGAGGG + Intronic
1079329593 11:19522530-19522552 AGAGTGCCCCTGGCCCCTGCTGG + Intronic
1080451823 11:32384389-32384411 GGGGTGCTCCTGGTATCTGCGGG - Intergenic
1082140601 11:48603913-48603935 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
1082567797 11:54701013-54701035 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
1082997919 11:59267541-59267563 GCGGGGCTCCTGGCCCCAGCTGG - Intergenic
1083303038 11:61748686-61748708 AGAGGGATGCTGGCACCTGAGGG - Intergenic
1083323199 11:61860175-61860197 AGGGTGCTACTGGCATCTGGTGG + Intronic
1083966464 11:66046795-66046817 AGGGGGAGCCTGGAACCTGATGG + Intronic
1084296244 11:68214542-68214564 AGCGCGCTCCCGGCCCCTGCGGG + Intergenic
1084413126 11:69015319-69015341 AGGGAGGGCCTGGCACCAGCGGG - Intergenic
1084683622 11:70681124-70681146 TTGGGGCTGCCGGCACCTGCTGG + Intronic
1085763494 11:79262105-79262127 AGGTGGCGCCTGGCACGTGATGG - Intronic
1087283692 11:96241482-96241504 AGGGGTCTACTGGCACCTAGTGG + Intronic
1089659794 11:119978464-119978486 AGGGGGCTCCAGGGAGCTGTTGG - Intergenic
1090843234 11:130510682-130510704 AGGGGGCTCTTAGCCCCAGCAGG - Intergenic
1091864458 12:3819465-3819487 GGGGTGCTCCTGGCATCTACTGG - Intronic
1095892643 12:47249399-47249421 GGGGGTCTCCTGGGTCCTGCAGG - Intergenic
1096660138 12:53119072-53119094 AGAGGGATGCTGGCAGCTGCCGG - Intronic
1096692431 12:53329206-53329228 AATGGGCTCCTTTCACCTGCAGG - Exonic
1099268120 12:80473931-80473953 AGGGGCCTCCTGGCAACTGGTGG + Intronic
1101702095 12:107183590-107183612 AGGGTGCTTCTGGCATCTGGTGG + Intergenic
1101991108 12:109485915-109485937 AGCGGGTACCTGGCACGTGCAGG - Intronic
1102185024 12:110941173-110941195 TGTGAGCCCCTGGCACCTGCAGG + Intergenic
1102607783 12:114082722-114082744 ACTGGGCTCCTGGCATCTGTGGG + Intergenic
1103527778 12:121579283-121579305 AGGGGGCTCCGGACACGGGCTGG + Intronic
1103870801 12:124090233-124090255 AGGGCTCCCCTGGCCCCTGCAGG - Intronic
1103937390 12:124483758-124483780 GTGGAGCTCCTGGGACCTGCAGG + Exonic
1103947044 12:124532485-124532507 AGGGGGCTCCTGGGAGCATCAGG + Intronic
1103977561 12:124713433-124713455 AGGGCACTCCTGGCACCACCCGG + Intergenic
1104664836 12:130640665-130640687 AGAGGGCTTCAGGCACCTCCTGG + Intronic
1104714874 12:131009964-131009986 CGGGGGCTCCTGGCATGGGCAGG + Intronic
1104833357 12:131770335-131770357 AGGAGGCTCATGGCACCCCCAGG + Intronic
1104900767 12:132188547-132188569 AGACGGCTCCTGGCAGCTGGCGG - Intergenic
1104988851 12:132613360-132613382 AGAGGGCTCTTGGCCCCTGCTGG - Intergenic
1105890923 13:24681458-24681480 AAGGGGCTCCTGACTCCTGCAGG + Intronic
1106548791 13:30753718-30753740 AGTGGGCTGCTGGCACCAGGAGG - Intronic
1107343385 13:39433856-39433878 AGGAGGCTCCTGGTGACTGCTGG - Intronic
1108749412 13:53432227-53432249 AGGGGACCACTGGCAGCTGCTGG - Intergenic
1110627521 13:77668328-77668350 AGGTGTCTCCTGGGTCCTGCAGG - Intergenic
1110706219 13:78603474-78603496 AGGGAGCGCCTGGCAGCAGCAGG - Exonic
1110797753 13:79659520-79659542 AGGTAGCTCTTGGCTCCTGCTGG + Intergenic
1112248143 13:97753287-97753309 AGGGGGATCCAGACACCTACAGG - Intergenic
1113224043 13:108139923-108139945 AGGGGGCTCCTGGCTTCTCATGG + Intergenic
1113591854 13:111506940-111506962 GGGGTGCTGCTGGCACCTGATGG - Intergenic
1113928612 13:113954560-113954582 ACCGTGCTCCTGGCTCCTGCAGG + Intergenic
1113952620 13:114080290-114080312 TGGGAGCCCCTGGCACCAGCGGG + Intronic
1114455273 14:22849732-22849754 CCAGGGCTCCTGGCACCAGCTGG + Intergenic
1115854923 14:37621141-37621163 AGGGGACACCTGGGACCAGCTGG + Intronic
1118162176 14:63301714-63301736 GGGGGTCTCCTGGGTCCTGCAGG - Intergenic
1118532311 14:66719485-66719507 AGGTGTCTCCTGGGTCCTGCAGG + Intronic
1118729429 14:68656085-68656107 TGGGTTCTCCTGGCTCCTGCAGG - Intronic
1118764789 14:68902461-68902483 AGGGGGCCCCGGGTACCTTCTGG + Exonic
1119125494 14:72121949-72121971 AGGGTGCTACTGGCATCTGGTGG + Intronic
1119158170 14:72430641-72430663 AGTATGTTCCTGGCACCTGCAGG + Intronic
1120537541 14:85715451-85715473 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
1120997504 14:90427798-90427820 AGGTGGCACCTGTCACCTCCTGG + Intergenic
1121459722 14:94065645-94065667 GGGGGTCTCCTGGGTCCTGCTGG - Intronic
1121558232 14:94854643-94854665 GGGGTGCTCCTGGCATCTGGTGG + Intergenic
1121827932 14:97026147-97026169 GGAGGGCTCCTCTCACCTGCCGG + Intergenic
1122354090 14:101112993-101113015 AGGGGCCTGCTGGGGCCTGCGGG + Intergenic
1122785444 14:104161276-104161298 CAGGGGCACCTGCCACCTGCCGG - Intronic
1124159047 15:27252682-27252704 AGAGGGCACCTCCCACCTGCAGG + Intronic
1124369519 15:29095949-29095971 AGCTGGCTTCTGGGACCTGCAGG + Intronic
1125056054 15:35359722-35359744 GGGGGACTCCTGGGTCCTGCAGG + Intronic
1125518723 15:40336798-40336820 TGGTGGCTCCTGGGACCTGCGGG + Exonic
1125580599 15:40782796-40782818 AGGGGTGTGCTGCCACCTGCTGG + Intronic
1126956307 15:53936589-53936611 AGGGGTCTCCAGACACCTACAGG + Intergenic
1128547602 15:68578731-68578753 GGCTGGCTCCCGGCACCTGCCGG - Intergenic
1128577958 15:68789218-68789240 AAGTGTTTCCTGGCACCTGCAGG - Intronic
1128735783 15:70053265-70053287 GGTGCGCTCCTGGGACCTGCGGG - Exonic
1128882086 15:71253114-71253136 AGCTGACTCCTGGCAACTGCAGG + Intronic
1129181667 15:73881785-73881807 AGGCAGCACCTGCCACCTGCAGG - Intronic
1129644713 15:77419759-77419781 AGGGGGCGCGCGGCACCGGCGGG + Intronic
1129911286 15:79228834-79228856 AGGGTGCTACTGGCATCTGGTGG + Intergenic
1130226226 15:82060191-82060213 AGGGGGCCCCTTCCAACTGCAGG + Intergenic
1131058335 15:89389684-89389706 AGGGGGCCCAAGGCAGCTGCAGG + Intergenic
1131144071 15:90000528-90000550 AAGGGGCTCAGGGCAGCTGCTGG - Intergenic
1132501604 16:286918-286940 ACGGGGCTGCTGGCTCCTCCGGG - Exonic
1132550472 16:551940-551962 ACGGAGCAGCTGGCACCTGCTGG + Intronic
1132944851 16:2527240-2527262 AGGAGGCTCCTGGGAGCAGCAGG - Intronic
1135589387 16:23694455-23694477 GAGGGGCTACTGGCATCTGCTGG - Intronic
1135620425 16:23950664-23950686 AGGGGCCTCCTGGCATCAGTGGG + Intronic
1135663272 16:24314998-24315020 AGGAGGCTCCTGGAACATGGAGG + Intronic
1136023849 16:27457283-27457305 GGGTGGCTGCTGCCACCTGCTGG + Intergenic
1136182711 16:28565417-28565439 AGGGAGCTCCTGGCAGCTCCTGG - Intronic
1137606266 16:49788728-49788750 AAGGGGATCCCGGCGCCTGCCGG + Intronic
1140823941 16:78688704-78688726 AGAGTGCTCCTGGCATCTGGTGG + Intronic
1141551553 16:84809901-84809923 AGGGGTCTCCAGGGACCTCCAGG + Intergenic
1141551565 16:84809931-84809953 AGGGGTCTCCAGGGACCTCCAGG + Intergenic
1141742438 16:85902773-85902795 AGGGGGCTGCTGGTGGCTGCAGG + Intronic
1142196173 16:88740259-88740281 TGGGGGCACCAGGCACCTGCAGG - Intronic
1142211961 16:88812551-88812573 AGGGGTCACCTGGCCTCTGCAGG - Intergenic
1142247507 16:88976695-88976717 AGCGGCCTCCTGGCATCTGCCGG - Exonic
1143106979 17:4534882-4534904 AGGGAGCGCCTGACAGCTGCCGG + Intronic
1143519992 17:7439571-7439593 AGCGCGCTCCGGGCGCCTGCCGG + Exonic
1143545480 17:7592783-7592805 CGGCGGCGCCTGGCACTTGCTGG + Exonic
1144519514 17:15944793-15944815 CGGCGGCTCCTGGGACCTGCTGG + Intergenic
1144943191 17:18955499-18955521 TGGGGGCTGCTGGCAGTTGCTGG - Intronic
1145755924 17:27390024-27390046 AGGGGCCTCCTGGGGCCTGGTGG - Intergenic
1146571902 17:33960201-33960223 AGGTTGCTGCTGGCAGCTGCGGG - Intronic
1146690937 17:34875594-34875616 AGGGTGCTACTGGCACCTAGTGG + Intergenic
1146704585 17:34991722-34991744 AGGAGGCTCTTGGCAGCTGGGGG - Exonic
1147403568 17:40194983-40195005 CAGGGGCTCCTGGCAGCTACTGG + Exonic
1147657036 17:42096905-42096927 AGGGGGAACCTGCCCCCTGCTGG - Intergenic
1148276207 17:46305854-46305876 AGTGTGCTCCTGGCATCTGGTGG + Intronic
1148298324 17:46523429-46523451 AGTGTGCTCCTGGCATCTGGTGG + Intronic
1148362865 17:47027902-47027924 AGTGTGCTCCTGGCATCTGGTGG + Intronic
1148533782 17:48420871-48420893 AGGGTGCTCCTGGCATCTAGTGG - Intronic
1148805031 17:50259681-50259703 AGGGGGCTCCTGGGACCCAGAGG - Intergenic
1150404267 17:64886519-64886541 AGTGTGCTCCTGGCATCTGGTGG - Intronic
1151298040 17:73200044-73200066 GGGTGGCTCCTGCCAGCTGCAGG - Intronic
1151515028 17:74588132-74588154 AGGTGGCTCCAGGCACCTCGTGG + Intronic
1151603294 17:75119859-75119881 AGCTGGCACCTGGCACCTGGTGG - Intronic
1152539509 17:80967851-80967873 AGGGGGCGCCTGCTACCCGCTGG + Intergenic
1152597581 17:81245546-81245568 AGAGGAGTCCTAGCACCTGCTGG - Exonic
1153236624 18:2994720-2994742 AGGGTGCTACTGGCATCTGGTGG - Intronic
1154009072 18:10560111-10560133 AGGGGGCTCATGGCTGCTGCTGG - Intergenic
1159025887 18:63181954-63181976 GGGGATCTCCAGGCACCTGCTGG + Intronic
1159450660 18:68598112-68598134 AGGGGTCTGCTGGCTCCGGCTGG - Intergenic
1160628507 18:80229409-80229431 AGGGGGCTCCTGGCTCAGACAGG - Intronic
1160686273 19:438433-438455 TGGGGCGTCCTGGCCCCTGCAGG + Intronic
1160755541 19:755147-755169 CTGTGGCTCCTGGCATCTGCAGG - Intronic
1160891058 19:1379063-1379085 AGGGGGCCTCTGGCACATTCTGG - Intergenic
1160973483 19:1780649-1780671 AGGATGCTCCTTGCACCAGCAGG + Exonic
1160982217 19:1821658-1821680 AGGGTCCTCTTGGCACCTGTGGG + Exonic
1161055928 19:2190633-2190655 ACGGGGCTCGTGGCACCTGACGG + Intronic
1161086842 19:2339389-2339411 GGTGGGCTCCGGGCACCTGGTGG + Intronic
1161319418 19:3634087-3634109 AGGCGTCTCCTGGCTCTTGCAGG - Intronic
1161436702 19:4267820-4267842 AGGGAGCTGCTGCCACCTACAGG - Intronic
1161587407 19:5113182-5113204 AGGGGGCTCCTGGGAGGAGCAGG - Intronic
1161743426 19:6039951-6039973 AGGAGGCTCTTGGGACCAGCAGG - Intronic
1161942453 19:7414155-7414177 GGGGTGCTCCTGGCATCTGGTGG - Intronic
1162834212 19:13305624-13305646 AGGGTGCTACTGGCATCTGGTGG - Intronic
1163786046 19:19275477-19275499 AGGGAGCCCCTGGTGCCTGCAGG + Intergenic
1164595958 19:29530683-29530705 ATGGGGGCACTGGCACCTGCTGG + Intronic
1165133013 19:33645007-33645029 AGGATGCTCCTGGCATCTGGTGG + Intronic
1165139301 19:33689378-33689400 AGGACTCACCTGGCACCTGCTGG - Exonic
1166309848 19:41956824-41956846 AGGTGTCTTCTGGGACCTGCCGG - Exonic
1167263310 19:48470715-48470737 CAGGGGCTTCTGGCACCTCCGGG + Intronic
1168148963 19:54434907-54434929 GGGGTGCTCCTGGCATCTGGTGG + Intronic
1168232913 19:55044773-55044795 AAGGGGCTCCGTGCACTTGCAGG - Exonic
1168358948 19:55722014-55722036 AGGGTGCTGCTGGCATCTGGTGG - Intronic
925278314 2:2665884-2665906 AGAGGGAACCTGGCACCTCCCGG - Intergenic
925314666 2:2912036-2912058 TGAGGGCTCCTAGCACCGGCGGG - Intergenic
925714052 2:6768630-6768652 AGGGGGCTCTTGGCATCTACGGG - Intergenic
925959816 2:9003909-9003931 AGGGGGCCGCTGGAAGCTGCTGG - Intergenic
926599361 2:14825227-14825249 ATGGGGCTCTGGCCACCTGCAGG + Intergenic
927510238 2:23639824-23639846 GGGGGTCTCCTGACACCTGTAGG - Intronic
927692232 2:25216222-25216244 GCGGGGCGCCTGGGACCTGCGGG + Intergenic
927694395 2:25230412-25230434 ATGCGCCACCTGGCACCTGCAGG + Exonic
927716401 2:25356086-25356108 AGGGGGCTGCTGGCTGCTGGTGG - Intergenic
927864776 2:26581425-26581447 AGAGGGCCCCTTGGACCTGCGGG - Intronic
929117635 2:38457615-38457637 AAGGGGCTCCAGGAAGCTGCAGG - Intergenic
929565186 2:42979534-42979556 AAGGGGCTCCATGCAGCTGCGGG + Intergenic
930036290 2:47087371-47087393 AGGGGCCACCTAGAACCTGCTGG + Intronic
931461917 2:62457112-62457134 CGGGGGATGCTGGCCCCTGCTGG - Intergenic
932593640 2:73081214-73081236 AGCGAGATCCTGGCCCCTGCAGG - Intronic
932954771 2:76337997-76338019 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
934180110 2:89612153-89612175 GGGGCGCTCCTGGGACCTGCGGG - Intergenic
934290401 2:91686413-91686435 GGGGCGCTCCTGGGACCTGCGGG - Intergenic
934774440 2:96928167-96928189 AAGGGGGGCCTGGCACCTCCTGG + Intronic
934862438 2:97775417-97775439 ATGTTGCTCCTAGCACCTGCTGG - Intronic
935376135 2:102399682-102399704 CGGGGGCTCCTAGCAGATGCCGG - Intergenic
936075086 2:109396721-109396743 AGGCCCCTCCTGGCACCTGCGGG + Intronic
936485099 2:112918632-112918654 GGTGGGCTCCTGGAACATGCTGG + Exonic
937002323 2:118479038-118479060 TGGGGGCTGCTGGCCCATGCAGG + Intergenic
937223323 2:120354218-120354240 AGGGAGCTCTAGGCAGCTGCAGG - Intergenic
937271713 2:120657045-120657067 AGGGGGCTCCTGGCTGCTGTGGG - Intergenic
937301654 2:120846434-120846456 AGGGGGCTCTTCACAGCTGCTGG + Intronic
937346596 2:121129944-121129966 CGGGGCCTCCAGTCACCTGCTGG - Intergenic
937424755 2:121789682-121789704 AGGGGGTCCTTGTCACCTGCTGG + Intergenic
937887731 2:126911501-126911523 AGGGGGCTGCTCTCACCTGCAGG - Intergenic
937987752 2:127646142-127646164 AGGGGGCTCCTTGCCGCTGTGGG - Exonic
942318201 2:174713426-174713448 AGAGGGCTACTGGCAACTCCAGG + Intergenic
942462492 2:176178057-176178079 AGGGCGCCCCGGGCCCCTGCGGG + Intergenic
944689917 2:202149488-202149510 AAGAGGCTCCGGGAACCTGCGGG - Intronic
946501341 2:220250475-220250497 AGGTGTCTCCTGGGTCCTGCAGG - Intergenic
948004897 2:234600064-234600086 AGGTGGCTCCTGGGAGTTGCTGG + Intergenic
948140610 2:235669937-235669959 ACGGCGCCCCTGGCACCCGCCGG - Intronic
948525891 2:238570574-238570596 AGGGGGCTGCGGGAAGCTGCAGG + Intergenic
948853729 2:240720540-240720562 AGGGGACACCTGGCCCCTGCAGG - Intronic
949019627 2:241734164-241734186 AGGGGGCAGCTGCCTCCTGCAGG - Intergenic
1169786018 20:9359876-9359898 AGGGCTCTACTGACACCTGCTGG + Intronic
1171242489 20:23582721-23582743 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
1171247598 20:23625037-23625059 AGGGAGCTACTGGCATCTGCGGG + Intergenic
1171403400 20:24893473-24893495 CGGGGGCTCCTCAGACCTGCAGG - Intergenic
1172130286 20:32650625-32650647 AGGGGGCTGCGGGCCCCTGCTGG - Intergenic
1172509507 20:35490642-35490664 GGAGCGCTCCTGGCACCAGCAGG + Exonic
1173721057 20:45258538-45258560 AGGGGGACCCTGGCAGCTGGTGG + Intergenic
1173907395 20:46638870-46638892 AGGGTGCTACTGGCATCTGATGG - Intronic
1173985763 20:47260157-47260179 GGGGTGCTCCTGGCACCTAATGG - Intronic
1174446157 20:50592698-50592720 AGGGAGCTCCTGGAATCTCCAGG + Intronic
1175027586 20:55919004-55919026 AGGGCGCTCCTGTCACCATCTGG - Intergenic
1175171089 20:57082037-57082059 AGAGCCCTCCTGGCAGCTGCTGG - Intergenic
1175483912 20:59331147-59331169 AAGAGGCTCCTTGCAGCTGCCGG + Intergenic
1175771517 20:61627464-61627486 AGGGTGCTCCTGGCATCCCCAGG - Intronic
1176128315 20:63485745-63485767 AGGGGCCTAGTGGGACCTGCAGG - Intergenic
1176289490 21:5036585-5036607 AGGGGGCTTCAGGGACCAGCAGG - Intronic
1178832804 21:36070448-36070470 CTGGGGCTCCTGGCGTCTGCGGG + Intronic
1179504434 21:41831357-41831379 GGGGTGCTCCTGGCACCTACTGG - Intronic
1179712110 21:43269277-43269299 AGGGGTCTGCTGGCAGCTCCAGG + Intergenic
1179801358 21:43812929-43812951 AGGGGGCTGTGGGCACCTCCAGG - Intergenic
1179867740 21:44227002-44227024 AGGGGGCTTCAGGGACCAGCAGG + Intronic
1179886454 21:44316162-44316184 GGAGGGCTCCTGGCACCCGGGGG + Intronic
1179890089 21:44330950-44330972 AGGGGGCTCGTGGCACCGGGGGG + Intronic
1180129913 21:45820701-45820723 AGGGAGTTCCTGGGACCTGGGGG + Intronic
1180982224 22:19884206-19884228 GAGGGGCTCCTGGCCTCTGCAGG + Intronic
1181632682 22:24159504-24159526 AGGTGGCTCCTGGCACCTCATGG + Intronic
1181720756 22:24772842-24772864 AGGGGACACCCGGCACATGCAGG - Intronic
1182141412 22:27962578-27962600 AGGGCACTGCTGGCACCAGCAGG + Intergenic
1183215166 22:36474712-36474734 AGGGCGCTCCTGGCAGCCTCTGG - Intronic
1183253035 22:36743849-36743871 AGGGGGCCCTGGGGACCTGCCGG + Intergenic
1183931279 22:41237523-41237545 GGGCAGCCCCTGGCACCTGCAGG + Exonic
1184097300 22:42323439-42323461 AGGGGGCACCTGTCAGCTGAGGG + Intronic
1184513067 22:44944314-44944336 CGGTGGCTCCTGGCACCTTGAGG - Intronic
1184556959 22:45238690-45238712 AGGGGAGACCTGGCACGTGCGGG + Intronic
1184729656 22:46365587-46365609 AGGGGGATCCTTGCAGCTCCTGG + Exonic
1184988774 22:48153742-48153764 AGAGGGCACCTGGCACTTCCAGG - Intergenic
1185011976 22:48319484-48319506 AGGGAGGTCCTGACCCCTGCAGG + Intergenic
1185020155 22:48369821-48369843 AGGGGGTTCCTGGTGCCTCCAGG + Intergenic
1185057376 22:48588020-48588042 AGGGGGCTCCTGGCACCTGCAGG - Intronic
1185089177 22:48756337-48756359 AGGGGGAACCTGGTTCCTGCAGG + Intronic
950200226 3:11037158-11037180 CGGTGGCTTCTGGCACCTGGCGG + Exonic
951108941 3:18778237-18778259 GGGGGGCCACTGGCACCTGCAGG + Intergenic
952885653 3:38009750-38009772 GGGGGGCTCCTGCCCCCTGGAGG - Exonic
953029431 3:39168717-39168739 AGGGAGCTCCTGGCATAAGCTGG + Intergenic
953608667 3:44429134-44429156 AGAGGGCTCCTGGCATCAGCAGG - Intergenic
953683883 3:45061033-45061055 AGAGGAGTCCTGGCACCAGCTGG - Intergenic
954147565 3:48641835-48641857 AGAGGGCGCCTGGCACCTTTGGG + Exonic
954149784 3:48651632-48651654 GGGGGGCTCCTGGCAGGTGCCGG + Exonic
954154813 3:48679508-48679530 AGGGTGTTCCTGCCATCTGCTGG - Intronic
956335523 3:68159194-68159216 ATGGGGCTCCTCACCCCTGCAGG - Intronic
956375874 3:68613202-68613224 AGGGTGCTCCTGGCATCTAGTGG - Intergenic
958970075 3:100601318-100601340 GGGGGTCTCCTGGGTCCTGCAGG + Intergenic
959997141 3:112692766-112692788 AGGTGTCTCCTGGGTCCTGCAGG - Intergenic
961483091 3:127196584-127196606 ACGGGGCTCCTGGTATCTGTGGG - Exonic
961766661 3:129216880-129216902 AGGGAGCACCTGGCAGCCGCAGG + Intergenic
964695452 3:159502869-159502891 AGGGGCCAACTGGCCCCTGCAGG + Intronic
967829206 3:193904491-193904513 AAGGGGCTCCAGTCACCAGCTGG - Intergenic
968083539 3:195863694-195863716 AGGGGGCCCCTGGCAGCAGCTGG - Exonic
968235705 3:197029205-197029227 CGGGGGTTTCTGGCACATGCAGG - Intronic
968405371 4:336371-336393 AGGCGGCTCCTGGGGTCTGCCGG + Intergenic
968471881 4:786273-786295 ATGGGGCTCCAGCCACCCGCGGG + Exonic
968645272 4:1737591-1737613 GGGGTGGGCCTGGCACCTGCGGG - Exonic
968931462 4:3581696-3581718 AGCAGGCTCCTGGCACCAGAGGG - Intronic
968952206 4:3701068-3701090 AAGGGGTTCCTAGCCCCTGCTGG - Intergenic
969593867 4:8137216-8137238 GGGGGGGTCCTAGCGCCTGCTGG - Intronic
969717794 4:8876731-8876753 AGGGGGCCCCAGGCAACTGTTGG + Intergenic
971413494 4:26400316-26400338 AGGGTGCTACTGGCACCTGCAGG + Intronic
972805191 4:42522693-42522715 AGGGGGGTCTTTGCACATGCTGG + Intronic
976002394 4:80387817-80387839 AGGGGACTCCTGGAAGCTACAGG - Intronic
977510514 4:97956563-97956585 GGGTGTCTCCTGGCTCCTGCAGG - Intronic
978095014 4:104765772-104765794 AGGGGGCAACTGGCATCTGATGG - Intergenic
979600016 4:122577197-122577219 GGAGAGCCCCTGGCACCTGCAGG + Intergenic
980087318 4:128404260-128404282 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
981519264 4:145644875-145644897 AGGGTGCTACTGGCATCTACTGG - Intronic
985516428 5:347723-347745 GAGGGGCTGCTGGCACGTGCAGG + Intronic
985626581 5:991978-992000 AGGGGGCTTCTGGAACCTGGTGG + Intergenic
985639408 5:1056699-1056721 TGGGGGCTCCTGGGCCCTGTGGG - Intronic
985675499 5:1229517-1229539 ATGGGGCCCAGGGCACCTGCTGG + Intronic
986779235 5:11048963-11048985 AGGGTGCTACTGGCACCTAGTGG - Intronic
988141851 5:27253421-27253443 AGGTGGCTCCTGCTTCCTGCAGG - Intergenic
988181650 5:27802705-27802727 AGGGCCATCCTGGCAACTGCGGG - Intergenic
989190698 5:38667198-38667220 ATGGTGCTCCTGCCACCTGGAGG + Intergenic
990413180 5:55561349-55561371 AGGGGTGTCCTGACTCCTGCAGG - Intergenic
991318296 5:65338009-65338031 TGGGGGCTTCTGCCACCTGTGGG - Intronic
993502714 5:88680561-88680583 GCGGGGCTCCTGGCTCCCGCCGG + Intergenic
994318484 5:98361324-98361346 ATGGATCTTCTGGCACCTGCAGG + Intergenic
994661627 5:102661119-102661141 AGTGGCCTCCTGGCATCTGCCGG - Intergenic
994923570 5:106084102-106084124 AGGTGGCTCCTGGCACTTGCAGG + Intergenic
995224972 5:109690831-109690853 GGGTGGCTTCGGGCACCTGCTGG + Intronic
998138507 5:139687144-139687166 AGGGGGCGCCTGGCAGGCGCTGG - Intergenic
998256194 5:140590873-140590895 ACGGGGCTCCTGGGAGCTGTAGG + Intronic
1001004715 5:168039934-168039956 ATGGGGCTCCTGTCAGCTTCAGG - Intronic
1001245959 5:170106013-170106035 GGGGGGCTCCTGGCCGATGCTGG - Exonic
1001260248 5:170222297-170222319 GGCGGGCTCCTGGCATTTGCTGG + Intergenic
1001990424 5:176111992-176112014 AGTGGGCTCCTTTCACCTCCTGG - Intronic
1002211787 5:177603834-177603856 AGGAGGCTCCTGTCACTTGCAGG - Intronic
1002226447 5:177726148-177726170 AGTGGGCTCCTTTCACCTCCTGG + Intronic
1002267400 5:178045065-178045087 AGTGGGCTCCTTTCACCTCCTGG - Intronic
1002310233 5:178309663-178309685 TGGGTGCTGCTGGGACCTGCAGG - Intronic
1002963587 6:1940932-1940954 GGGGTGCTCCTGGCATCTACTGG - Intronic
1003041588 6:2693003-2693025 AGGGTGCTACTGGCATCTGGTGG - Intronic
1003136599 6:3439191-3439213 AGGGTGCTACTGGCGCCTGGTGG - Intronic
1006287950 6:33112524-33112546 AGGGGCCCCCTGAAACCTGCAGG - Intergenic
1006436338 6:34027785-34027807 AGGGGGCGCCTGGGCCCTGAGGG - Intronic
1006502719 6:34468585-34468607 GTGGGGCTTCTGTCACCTGCAGG + Intronic
1007492851 6:42237386-42237408 TGAGGGCTGCTGGCTCCTGCAGG + Intronic
1007575920 6:42925214-42925236 AGGGGGCTGCGGGCTCCTGCGGG + Intronic
1007618749 6:43198734-43198756 AGGGGCCTCACGGCACCTCCGGG - Exonic
1007643656 6:43363851-43363873 AGGTGGCCACTGCCACCTGCGGG + Intronic
1009971280 6:70627966-70627988 ACAGGGCGCCGGGCACCTGCTGG - Intergenic
1010044838 6:71429350-71429372 AGGGTGCTACTGGCATCTGGTGG + Intergenic
1013616157 6:111845225-111845247 AGGGGGCTCCTGGCACCCATAGG + Intronic
1014150669 6:118050893-118050915 AGGGGGCTCCTGGTAGCTGTAGG + Intronic
1016673290 6:146733394-146733416 AAGGGGCTCCAAGGACCTGCTGG + Intronic
1017712979 6:157186440-157186462 AGGGGGCTCCAGGCACACACAGG + Intronic
1017725384 6:157273378-157273400 AGGGTGCTACTGGCACCTCGTGG - Intergenic
1017917509 6:158843262-158843284 AAGGCTCTCCTGTCACCTGCAGG + Intergenic
1017980362 6:159395756-159395778 AGGGGCATCCTGGCAGCTGTGGG - Intergenic
1018400605 6:163415526-163415548 AGGGGGCGTCCGGCACCGGCGGG - Intronic
1019070486 6:169341083-169341105 AGGAGGATCCTGGCACCTCTGGG - Intergenic
1019073686 6:169370134-169370156 AGGGGGCCCGCTGCACCTGCAGG - Intergenic
1019314645 7:378930-378952 CTGGGGGTCCTGGCGCCTGCGGG - Intergenic
1019337657 7:492922-492944 GGGGGGATCCTGGAACCTCCCGG + Intergenic
1019573584 7:1725305-1725327 CTGGGGCTCCTGGCAGCTGGCGG + Intronic
1021793435 7:24228856-24228878 AGGGTGCTATTGGCATCTGCTGG - Intergenic
1021821831 7:24506149-24506171 GGGATGCTCCTGGCACCTGGTGG + Intergenic
1022524767 7:31029753-31029775 AGGGGGCAGCTGGCACCATCAGG + Intergenic
1022905176 7:34848752-34848774 AGGGGGATCCTGTAACCTGCTGG - Intronic
1024425053 7:49215841-49215863 TGGGGGCACCTGGCCTCTGCAGG + Intergenic
1025847814 7:65216611-65216633 AGGGCGCTCCAGGCAACTGTGGG - Intergenic
1025898063 7:65722480-65722502 AGGGCGCTCCAGGCAACTGTGGG - Intergenic
1026591059 7:71695870-71695892 GAGGGGCTCCTGTCCCCTGCTGG + Intronic
1027263589 7:76481654-76481676 GGGGTGCTCCTGGCATCTGGTGG + Intronic
1027314961 7:76979766-76979788 GGGGTGCTCCTGGCATCTGGTGG + Intergenic
1028917676 7:96277607-96277629 AGGGTGCTACTGGCTCCAGCAGG + Intronic
1029116667 7:98241184-98241206 AGGGTCCTCCTGGTCCCTGCTGG - Exonic
1029205944 7:98869550-98869572 AGGGGGCTCCCCGCACCCCCTGG - Intronic
1029574694 7:101395745-101395767 AGGTGGCTCCTTCCACCTGAGGG + Intronic
1031984850 7:128157462-128157484 GGGGTGCTACTGGCACCTGGTGG - Intergenic
1032321286 7:130888470-130888492 AAGGGGCTCCTGGCCCCTGTGGG - Intergenic
1034221613 7:149450856-149450878 AAGCAGGTCCTGGCACCTGCGGG + Intronic
1034346675 7:150389486-150389508 AGGGTGCTCCTGCCACCACCTGG - Intronic
1034888392 7:154817032-154817054 TGGGAGCTCCGGGCACCTGAAGG - Intronic
1034949061 7:155284814-155284836 AGGGGACTTCTGGTTCCTGCTGG - Intergenic
1034989493 7:155539005-155539027 AGCTGGCTCCTGGCCCCTGGTGG - Intergenic
1035226073 7:157432844-157432866 TGGGGGCTCCTCACACCGGCAGG - Intergenic
1035761235 8:2070342-2070364 TGGAGCCTCCTGGCAGCTGCTGG + Intronic
1036656695 8:10681612-10681634 TGTGGCCACCTGGCACCTGCAGG + Intronic
1036806053 8:11834536-11834558 AGGTGATTCCTGGCAGCTGCTGG - Intronic
1037803926 8:22049176-22049198 AGGAGGCTCCTGGCGTCCGCGGG - Intronic
1037987789 8:23300376-23300398 AGGGGCCTCCTGGCTCCTGGTGG - Intronic
1039433705 8:37545444-37545466 AGGAGGCTCCAGGCCCCTCCTGG + Intergenic
1039893682 8:41701467-41701489 GGGGGCTTCCTGCCACCTGCCGG - Intronic
1040596468 8:48842110-48842132 AGGGTGATGCTGTCACCTGCAGG + Intergenic
1049151219 8:141036674-141036696 TGGTGGCTCCTGGCAGCTCCTGG + Intergenic
1049179770 8:141216232-141216254 AGGGGGCCCCTGGGAGCTGCAGG - Intronic
1051733182 9:20169430-20169452 AGGTGTCTCCTGGGTCCTGCAGG - Intergenic
1054458668 9:65450233-65450255 AGCAGGCTCCTGGCACCAGAGGG + Intergenic
1055623749 9:78151138-78151160 GGGCGGCTCCTTCCACCTGCGGG - Intergenic
1056442970 9:86638674-86638696 AGGAGGCACATGGCACCAGCTGG - Intergenic
1056753444 9:89367918-89367940 ATGGTGGTCCTGGCACCAGCTGG - Intronic
1057261924 9:93589421-93589443 AAGGTGCTCCTGGCACCTGCTGG - Intronic
1057469281 9:95343294-95343316 ACTGGGCTCCTGGAGCCTGCAGG + Intergenic
1058308538 9:103472044-103472066 AGGTGTCTCCTGGGTCCTGCAGG + Intergenic
1059465548 9:114466859-114466881 AGGGGTCTCCTGTCACCTCAGGG + Intronic
1059465570 9:114466932-114466954 AGGGGTCTCCTGTCACCTCAGGG + Intronic
1059465592 9:114467007-114467029 AGGGGTCTCCTGTCACCTCAGGG + Intronic
1059465607 9:114467064-114467086 AGGGGTCTCCTGTCACCTAAGGG + Intronic
1059465628 9:114467139-114467161 AGGGGTCTCCTATCACCTGGGGG + Intronic
1060558848 9:124526189-124526211 AAGGGGCACTTGGCAGCTGCTGG - Intronic
1060777122 9:126383081-126383103 AGTGGGCCCCTGCCAACTGCTGG - Intronic
1060849280 9:126860932-126860954 CGGAGGCCCCGGGCACCTGCTGG + Intronic
1061593578 9:131614330-131614352 ATGGGGCTCTCGGCACCTGTTGG - Intronic
1061793020 9:133068456-133068478 GGGGTGCTCCTGGCACCTCGTGG + Intronic
1061795625 9:133084240-133084262 GGGGTGCTCCTGGCACCTCGTGG + Intronic
1061964146 9:134003787-134003809 AGGGGGCTCAGGGCATCTGCAGG - Intergenic
1062053822 9:134460530-134460552 ATGGTGCTCCTGGGCCCTGCTGG + Intergenic
1062174801 9:135155431-135155453 GGGGGGCTCCTGGAAGCTGCTGG - Intergenic
1062416059 9:136450854-136450876 AGGAGGCTCCTGGGGCCTGACGG + Intronic
1062590838 9:137273912-137273934 AGGGGGCACCTCTCACCTCCTGG + Intergenic
1062711195 9:137976061-137976083 AGGGGGCTGTGTGCACCTGCAGG - Intronic
1203479653 Un_GL000224v1:815-837 TGGGGGCCCCTGGGAGCTGCAGG - Intergenic
1203480621 Un_GL000224v1:7111-7133 TGGGGGCCCCTGGGAGCTGCAGG - Intergenic
1185552783 X:997432-997454 GGGGTGGTCCTGGCACCTGGTGG + Intergenic
1185633045 X:1529915-1529937 GGGGTGCTCCTGGCATCTGGTGG + Intronic
1185633094 X:1531204-1531226 TGGGTGCTCCTGGCACCTTGTGG + Intronic
1185871616 X:3669472-3669494 TGGGTGCTCTTGGCATCTGCTGG + Intronic
1187442276 X:19331217-19331239 AGGGTGCTACTGGCATCTGGTGG - Intergenic
1187690292 X:21859699-21859721 AGGGTGCTACTGGCATCTGGTGG + Intronic
1189157177 X:38770318-38770340 ACAGGGCTCCTCGCTCCTGCTGG - Intergenic
1189218038 X:39344367-39344389 GGGGGTCTCCTGGGTCCTGCAGG - Intergenic
1189283267 X:39834032-39834054 AGGGAGCTCATGGCACTGGCAGG - Intergenic
1190950121 X:55135360-55135382 GGATGGCTCCTGCCACCTGCTGG - Intronic
1191208174 X:57855701-57855723 AGGTGTCTCTTGGCCCCTGCTGG - Intergenic
1192200004 X:69060713-69060735 AGTGGGCTCCTTGCTCCTGCAGG - Intergenic
1192235400 X:69292293-69292315 CGGGTACACCTGGCACCTGCTGG + Intergenic
1194775003 X:97952506-97952528 GGGGGTCTCCTGGGTCCTGCAGG - Intergenic
1196001745 X:110794659-110794681 AGTGGGCTCCTGACACTTGATGG - Intronic
1197066355 X:122237930-122237952 GGGGGTCTCCTGGGTCCTGCAGG + Intergenic
1197937270 X:131752851-131752873 CGGGACCTCCTGGCAGCTGCTGG - Intergenic
1198280259 X:135134692-135134714 AAAGGGATCCTGGCACGTGCTGG + Intergenic
1198290699 X:135237822-135237844 AAAGGGATCCTGGCACGTGCTGG - Intergenic
1200073974 X:153542235-153542257 AGGCGGCCCATGGCACCTGACGG + Intronic
1200208596 X:154335188-154335210 AGGGTGCTCAGGGCACCTGCTGG + Intergenic
1200747692 Y:6916943-6916965 AGGGAGCTCCTGGCATCTGGTGG + Intronic
1200816271 Y:7536227-7536249 GGGGTGCTCCTGGCATCTGTTGG - Intergenic