ID: 1185057378

View in Genome Browser
Species Human (GRCh38)
Location 22:48588030-48588052
Sequence AGCTTGGCCAAGGGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 209}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057378_1185057390 11 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057378_1185057395 19 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057378_1185057398 27 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057378_1185057385 -5 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057385 22:48588048-48588070 AAGCTCCATCTGTGCATAATGGG 0: 1
1: 0
2: 1
3: 5
4: 119
1185057378_1185057387 -3 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057387 22:48588050-48588072 GCTCCATCTGTGCATAATGGGGG No data
1185057378_1185057393 14 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057378_1185057394 15 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057378_1185057389 6 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057378_1185057397 26 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057378_1185057386 -4 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057386 22:48588049-48588071 AGCTCCATCTGTGCATAATGGGG No data
1185057378_1185057391 12 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057378_1185057392 13 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057378_1185057384 -6 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057384 22:48588047-48588069 CAAGCTCCATCTGTGCATAATGG 0: 1
1: 0
2: 1
3: 15
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057378 Original CRISPR AGCTTGGCCAAGGGGGCTCC TGG (reversed) Intronic
900186858 1:1336836-1336858 AGGATGGCCACGGGGGCACCGGG - Intronic
900395359 1:2451136-2451158 AGCTGGGCCGAGTGCGCTCCAGG + Intronic
900491517 1:2951592-2951614 CTCTTATCCAAGGGGGCTCCCGG + Intergenic
900637100 1:3671374-3671396 AGCTCGGCCAAGGGGCAGCCTGG - Intronic
900851215 1:5144578-5144600 TACTTGGCCTTGGGGGCTCCGGG + Intergenic
901202335 1:7473735-7473757 AGCTGGGCCAGGAGGGCTCACGG - Intronic
902372486 1:16015164-16015186 CCCTTGGCCAAGAGGGTTCCAGG + Exonic
902394477 1:16125180-16125202 TTCTTGGCCGATGGGGCTCCAGG + Exonic
902705274 1:18199969-18199991 AGCGGGTCCAAGGGGGCTCTGGG + Intronic
902778140 1:18687601-18687623 AGCTTGGCCAAGGCGGGTAGTGG + Intronic
905043185 1:34976907-34976929 AGCTTGCCCAGCGGTGCTCCAGG + Intergenic
905043418 1:34977972-34977994 AGCCCAGCCAAGGGTGCTCCAGG - Intergenic
905445519 1:38026237-38026259 AGCTGTGCCAAGGGGGCTGTGGG + Intergenic
906033900 1:42739219-42739241 AGATTGTCCCTGGGGGCTCCTGG + Intronic
907269198 1:53280740-53280762 AGCTTAGCCAAGGGGGACACAGG + Intronic
907397321 1:54200293-54200315 AGCTCGGCCTTGGGGGCTTCGGG + Exonic
911054435 1:93698188-93698210 AGCTCAGCCAAGGGGGCAACTGG + Intronic
915017010 1:152743766-152743788 TGCTTGGCAAAGACGGCTCCAGG + Intronic
915818521 1:158996119-158996141 TTCTTGGCCAAGGGGACCCCAGG - Intergenic
919078403 1:192839956-192839978 CTCTTGGCCAAGGGGATTCCAGG - Intergenic
920096123 1:203487686-203487708 AGGTTGGGCAAGGGGGCCGCAGG - Exonic
922481565 1:225943034-225943056 CCCTGGGCCAAGGGGGCTGCCGG + Intergenic
923885174 1:238146523-238146545 CTCTTGGCCAACGGAGCTCCTGG - Intergenic
1063254333 10:4309456-4309478 CTCTTGGCCAAGGGGACTCCAGG - Intergenic
1063910947 10:10829961-10829983 AACTTGGCCAGGGGGGTTACAGG - Intergenic
1063970768 10:11379914-11379936 ATCTCGGCCAGCGGGGCTCCGGG - Intergenic
1070048020 10:72858616-72858638 CTCTTGGCCAAGGGGACCCCAGG - Intronic
1070785070 10:79158007-79158029 AGCTTGGCCAGGGGAGCGGCGGG + Intronic
1073056789 10:100708301-100708323 TGCTTGGCCATGGTGGCTCCTGG + Intergenic
1075132701 10:119754163-119754185 ATCTTGGGCCAGGGGACTCCTGG + Intronic
1075776701 10:124993809-124993831 AGCTGGGCCCTGTGGGCTCCTGG + Intronic
1076003345 10:126929501-126929523 AGCTTCACCAAGGAGGCTCCTGG + Intronic
1078092756 11:8277582-8277604 ACCCTTACCAAGGGGGCTCCTGG + Intergenic
1078523974 11:12086643-12086665 AGGCTGGCTAAGGGGGCTCATGG - Intergenic
1079966671 11:26988540-26988562 AGCTTGGCTAAAGGGGATTCTGG - Intergenic
1083765181 11:64838222-64838244 ACCTGGTCCCAGGGGGCTCCTGG - Intronic
1083826855 11:65208833-65208855 AGCCTGGCCCAGGAGGCTCTGGG - Intronic
1087222562 11:95562261-95562283 AGCTTGGGAAAGTGGGCTCAGGG + Intergenic
1091122754 11:133070357-133070379 AGAAGGGCCAAGGGGGTTCCGGG - Intronic
1091306768 11:134541421-134541443 AGCCTGGCCAGGAGGGCCCCTGG + Intergenic
1092662585 12:10755080-10755102 AAATTGGCCAAAGGGGCTACAGG + Intergenic
1092920880 12:13230687-13230709 AGATGCACCAAGGGGGCTCCTGG - Intergenic
1096993040 12:55820544-55820566 AGATTGGCAAATGGGGCTCCTGG + Exonic
1097055031 12:56244023-56244045 TGCCTGGGGAAGGGGGCTCCTGG - Intronic
1105213553 13:18271803-18271825 AGCATGGCAAAGGGGGCTCAAGG + Intergenic
1106193216 13:27472355-27472377 AGCATGGCCAAGGCAGCTCCAGG + Intergenic
1107423552 13:40271792-40271814 GGCTTGGACATGGTGGCTCCTGG - Intergenic
1113711243 13:112466815-112466837 CGCTTGGCCTAGAGGCCTCCAGG + Intergenic
1113904217 13:113811789-113811811 TGCTTGGAGAAGGGGGCTGCAGG - Exonic
1114419655 14:22570716-22570738 AGCTGGAACAAGGGGGCTACAGG - Intronic
1115029025 14:28773243-28773265 ATGTAGGCCAAGGGGGCTCCAGG + Intronic
1115514461 14:34171670-34171692 AACTTGTGCAAGTGGGCTCCGGG - Intronic
1117583651 14:57178101-57178123 AGATTGGCCTGGGAGGCTCCTGG - Intergenic
1119286492 14:73458721-73458743 AGCTTGGGCTAGGACGCTCCAGG - Intronic
1119509361 14:75198879-75198901 ACCTTGGCCAAGGGGACTGAGGG - Intergenic
1121546075 14:94764686-94764708 ATCTGGGCCAAGGGGGACCCTGG - Intergenic
1122028469 14:98895071-98895093 TGCATGGCCCAGGGGGCTCTGGG + Intergenic
1122118703 14:99540618-99540640 GGCCTGGCCAAGGGGTCCCCTGG + Intronic
1122365434 14:101192398-101192420 AGCTTTGCCAGGGGACCTCCTGG + Intergenic
1122833865 14:104421506-104421528 GGCTTGGCCAGGGTGGCTCGTGG + Intergenic
1123144941 14:106120340-106120362 AGCTTGGTCCAGCAGGCTCCAGG - Intergenic
1123783537 15:23647378-23647400 GGCTGGGCCATCGGGGCTCCCGG + Exonic
1125595797 15:40885317-40885339 AGCTTGGCCAAGGAGGCCACTGG + Intergenic
1126130142 15:45332905-45332927 AGCATGGCCAACGGAGGTCCAGG + Intergenic
1127672682 15:61211043-61211065 AGCTAGGCCAAGGAGGCACTTGG + Intronic
1127803069 15:62494183-62494205 GGCATAGCCAAGGGGGTTCCAGG + Intronic
1128234274 15:66056874-66056896 AGCTTGGCGAAAGCTGCTCCTGG - Intronic
1128582597 15:68819732-68819754 AGCTGGGGCGAGGGGGCACCGGG + Intronic
1132647874 16:1007402-1007424 GGCATGGCCAAGGGGGATCCTGG + Intergenic
1132994230 16:2814748-2814770 AGCCTGGCCAGAGGGGCGCCAGG + Intergenic
1133232423 16:4372923-4372945 AGCCTGGGGAAGGGGGCTCTAGG - Intronic
1135303064 16:21347314-21347336 ACCTTGGGAAAGGGGGCTGCGGG + Intergenic
1135945173 16:26858918-26858940 TGCTTGGCCATGAGGGCACCAGG - Intergenic
1136284439 16:29232908-29232930 AGCTTATCCACGGGGGCACCTGG - Intergenic
1136772774 16:32856609-32856631 AGCTTGTCCATGGGGCCTGCTGG + Intergenic
1136897840 16:34004910-34004932 AGCTTGTCCATGGGGCCTGCTGG - Intergenic
1137300324 16:47143289-47143311 TGCTGGGCCCAGGGGCCTCCTGG + Intronic
1138660609 16:58515037-58515059 GGCGTGGCCTAGAGGGCTCCTGG - Intergenic
1139360549 16:66396831-66396853 TCCTTGGCCTAGCGGGCTCCTGG - Intronic
1139893517 16:70269816-70269838 ACCTTGCCCAAGGAGGTTCCTGG + Intronic
1141494505 16:84397985-84398007 AGGTTGGCCAAGGGAGCATCAGG + Intronic
1141618940 16:85226464-85226486 GGCCTGACCAAGGGGGCTGCTGG + Intergenic
1141758627 16:86011867-86011889 AGTTTGGCCAGGGGCTCTCCTGG + Intergenic
1142061536 16:88033268-88033290 ACCTTGGGAAAGGGGGCTGCGGG + Intronic
1142089474 16:88202421-88202443 AGCTTATCCACGGGGGCACCTGG - Intergenic
1203075199 16_KI270728v1_random:1118719-1118741 AGCTTGTCCATGGGGCCTGCTGG + Intergenic
1143485374 17:7251321-7251343 AGCTGGGCCGCGGGGGCCCCGGG - Exonic
1143579198 17:7815235-7815257 AGCCTCGCCAAGGTGGCTGCAGG - Intronic
1143727153 17:8856977-8856999 AGCTGGGGGAAGGGTGCTCCAGG - Intronic
1148772220 17:50074083-50074105 AGCAGGGCCCAGGGGGCTACAGG - Intronic
1148819753 17:50353756-50353778 ACCTTGGCCACGGGCACTCCTGG - Exonic
1149543987 17:57489502-57489524 AGAGTGGCCAGGGAGGCTCCTGG + Intronic
1150398186 17:64837070-64837092 AGCGAGGCGAGGGGGGCTCCCGG + Intergenic
1156509863 18:37627309-37627331 AGCTTGGCCAAAGTGGCACAGGG - Intergenic
1157493078 18:48137218-48137240 AGGTGGACCAAAGGGGCTCCCGG - Intronic
1158413843 18:57232076-57232098 GCCTTATCCAAGGGGGCTCCAGG + Intergenic
1159198014 18:65143508-65143530 AGCCTGGTCAAGGGGTCACCAGG + Intergenic
1160410316 18:78671255-78671277 AACCTGCGCAAGGGGGCTCCTGG + Intergenic
1160543544 18:79638385-79638407 AGCTTGGCCTGGTGGGTTCCAGG + Intergenic
1160787489 19:907747-907769 TGCTAGGCCAAGGGGGAGCCAGG - Intronic
1161085695 19:2333969-2333991 AGGTGGGCCAAGGGGCCTACGGG - Intronic
1161594382 19:5143789-5143811 GGCTTGGCCAGGGAGGCTGCGGG + Intronic
1162781649 19:13009992-13010014 TGCCTGGGCCAGGGGGCTCCTGG - Intronic
1162928818 19:13945372-13945394 AGGTTGGGCAAGGTGGCTCACGG + Intronic
1163314246 19:16531553-16531575 AGCTTGCCGCAGGGGGCTCAGGG + Intronic
1163867517 19:19786462-19786484 AGCTTTGCCAAGGCTTCTCCTGG - Exonic
1164115496 19:22215400-22215422 AGCTGCCCCAAGAGGGCTCCAGG + Intergenic
1164643867 19:29844543-29844565 AGCCTGGCCAAGGCGGATGCTGG + Intergenic
1164931821 19:32181803-32181825 AGCTTTGCCTACTGGGCTCCAGG + Intergenic
1165871363 19:38975674-38975696 GGCGTGGCCCAGGGGGCCCCGGG + Exonic
926221584 2:10939380-10939402 AGCATGGCCAAGGAGGCCTCAGG + Intergenic
927206477 2:20614326-20614348 TGCTTTGCCAAGGCAGCTCCAGG + Intronic
927707336 2:25304623-25304645 ACCTTTGCCACGGGGGTTCCCGG + Intronic
928200310 2:29243583-29243605 GGCATGGCCAAGGGGGCTTGGGG + Intronic
930086800 2:47503468-47503490 AGCCTGGCAAATGTGGCTCCTGG - Intronic
931173331 2:59828485-59828507 AGATAGGGTAAGGGGGCTCCTGG - Intergenic
931230641 2:60371789-60371811 AGGTTGGCAGAGGGGGCTTCTGG + Intergenic
932463778 2:71899939-71899961 AGCATGGCCAAGAGTGGTCCTGG + Intergenic
932483200 2:72062302-72062324 CTCTTGGCCAAGGGGACCCCAGG + Intergenic
933832069 2:86219067-86219089 AGCAAGGCCCAGGAGGCTCCAGG + Intronic
933939380 2:87232784-87232806 GTCTTGGCGAGGGGGGCTCCTGG - Intergenic
934300775 2:91774943-91774965 AGCATGGCAAAGGGGGCTCAAGG - Intergenic
934776329 2:96940041-96940063 AGCTGGGCCCTGGGGTCTCCTGG + Intronic
934951798 2:98580638-98580660 AGCAGGGCCATGGGGGCTTCGGG + Intronic
936145204 2:109976108-109976130 AGCTTGCCCAAGGGGCACCCGGG - Intergenic
936164229 2:110105828-110105850 AGTTGGCCCTAGGGGGCTCCCGG + Intronic
936199481 2:110395370-110395392 AGCTTGCCCAAGGGGCACCCGGG + Intergenic
936353753 2:111732994-111733016 GTCTTGGCGAGGGGGGCTCCTGG + Intergenic
936510033 2:113137826-113137848 TGCTTGGCCAAGGGCCCCCCAGG - Intergenic
940004070 2:148995356-148995378 AGCTTGTTCAAGGGGGTGCCAGG - Intronic
943765823 2:191661087-191661109 AGCTTGGAGAAGGAAGCTCCAGG - Intergenic
944565037 2:200981316-200981338 TGCTTGGTCAAGGGGGCTCCTGG + Exonic
948681578 2:239638688-239638710 ATCTTGGCCAAGGGGACCCCAGG + Intergenic
948728505 2:239949002-239949024 AGCTTGGGGTTGGGGGCTCCAGG - Intronic
949042195 2:241854567-241854589 ATCAGGGCCAAGAGGGCTCCTGG + Intronic
1170426097 20:16236855-16236877 AGTGTGGCCAAGGGGGCTGTCGG - Intergenic
1173191180 20:40876691-40876713 AGCCTGGCCAAAAGGGCTCTTGG + Intergenic
1173401472 20:42729885-42729907 AGCCTGGCCAAGGGAAGTCCAGG - Intronic
1173959536 20:47060442-47060464 GTTTTGGCCAAGGGGGCTTCTGG - Intronic
1175057340 20:56210328-56210350 CTCCTGGCCAAGGGGACTCCAGG - Intergenic
1175915336 20:62423397-62423419 TTCCTGGCCAAGGGGGCCCCTGG + Intronic
1176075749 20:63247552-63247574 AGCGTGGGGAAGGGGGCCCCCGG - Intronic
1179608345 21:42532824-42532846 AGCTCTGCCAAGGGAGCTGCTGG + Intronic
1180816385 22:18792194-18792216 AGCATGGCAAAGGGGGCTCAGGG + Intergenic
1180846582 22:18986109-18986131 AGCATGGCCAAGTGGGGGCCGGG - Intergenic
1181116444 22:20635042-20635064 AGCTTGGCCCAGGGAGCGCCTGG + Intergenic
1181440528 22:22933207-22933229 TCCTGGGCCAAGGGAGCTCCAGG - Intergenic
1181699131 22:24610079-24610101 AGCATGGCAAAGGGGGCTCAGGG - Intronic
1181710052 22:24678889-24678911 AGGTTGGGCAATGGGGTTCCTGG + Intergenic
1184229794 22:43152298-43152320 AGGCTGGCCAGAGGGGCTCCAGG - Intronic
1184733831 22:46386289-46386311 AGCATGGCCAAGGGGGGGCCGGG + Intronic
1184777138 22:46628843-46628865 AGCTTGGAGAATGTGGCTCCTGG + Intronic
1184839785 22:47046006-47046028 ACCTAGGCCAAGGAGGTTCCCGG + Intronic
1185057378 22:48588030-48588052 AGCTTGGCCAAGGGGGCTCCTGG - Intronic
1203224341 22_KI270731v1_random:68887-68909 AGCATGGCAAAGGGGGCTCAGGG - Intergenic
1203266485 22_KI270734v1_random:17905-17927 AGCATGGCAAAGGGGGCTCAGGG + Intergenic
950523388 3:13509392-13509414 AGCCTGGACAATGGAGCTCCAGG - Intergenic
951272964 3:20650046-20650068 AGCATGGCTAAGGAGGCCCCAGG - Intergenic
953745926 3:45573960-45573982 CTCTTGGCCAAGGGGACCCCAGG + Intronic
953979754 3:47407693-47407715 GGCTTCACCAAGGGGGCTCCTGG - Exonic
954951366 3:54477288-54477310 AGCTTGGCCAAGGTCGTTGCGGG + Intronic
957453035 3:80403845-80403867 CCCTTGGACATGGGGGCTCCTGG + Intergenic
961107860 3:124257653-124257675 AACCTGGCCAAGGGGGCCTCAGG + Intronic
961363071 3:126380246-126380268 AGAGTGGCCACGGGGTCTCCCGG - Intergenic
966862219 3:184236829-184236851 AGGCAGGCCATGGGGGCTCCTGG + Intronic
967963029 3:194940488-194940510 ATATTGGCCATGGGGGCTACAGG - Intergenic
968702506 4:2063603-2063625 AGCTAGGCCCCGGGGGCTGCCGG + Intronic
968910078 4:3473081-3473103 AGTGTGGCCCAGGGGGCTCCAGG + Intronic
969100965 4:4767982-4768004 AGCTGGGCCCAGGGGGTTCAAGG + Intergenic
969340631 4:6538644-6538666 CCCTTGGCCAAAGGGGCTCAGGG + Intronic
969496702 4:7530361-7530383 AGCTTGGGCAAGGGGGCCTTGGG - Intronic
972322263 4:37982941-37982963 AGCTCCACCAAGGGGCCTCCAGG - Intronic
974204035 4:58675805-58675827 AGCATGGCCAAGGGGGTCCCAGG + Intergenic
974482430 4:62462943-62462965 AGCATGGCCAGGGAGGCTCAAGG - Intergenic
976737632 4:88327031-88327053 AGCTTGGCAAAGGAAGATCCAGG + Intergenic
978267986 4:106849966-106849988 AGCATGGCCAAGTGGGATCCAGG + Intergenic
980729940 4:136812125-136812147 AGCCTGGGGCAGGGGGCTCCAGG + Intergenic
981002808 4:139843910-139843932 AGCTTGGCCCACAGGGCCCCTGG + Intronic
983069747 4:163254265-163254287 AGGGAGGCCAAGGGGGCTCTGGG - Intergenic
984828195 4:183947083-183947105 GGGTGGGGCAAGGGGGCTCCTGG + Intronic
985899986 5:2780682-2780704 TGGTTGACCAAAGGGGCTCCAGG + Intergenic
987112550 5:14701192-14701214 ACCTTGACCAAGGCAGCTCCTGG + Intergenic
989147091 5:38259273-38259295 AGATGGGCAGAGGGGGCTCCAGG - Intronic
991207784 5:64069316-64069338 CTCTTGGCCAAGGGGACCCCAGG + Intergenic
992056585 5:72996854-72996876 AGCTGTGCCACGGGGGCCCCCGG + Intronic
994196664 5:96930012-96930034 GTCTTGGCCAAGGGGACCCCAGG + Intronic
997625533 5:135328314-135328336 AGCTTGGCCCAGTGGGCTCATGG + Intronic
997674806 5:135705015-135705037 TGCTTGGCCAAGAGGTCTCCTGG - Intergenic
999110292 5:149114559-149114581 AGCTTGGCCAAGGTGGCTATGGG - Intergenic
1001022439 5:168194961-168194983 AGCTGGGCCCAGGGGTCTCCTGG - Intronic
1001658671 5:173373946-173373968 AGCTTGGCCAATGAGACTCATGG - Intergenic
1001796834 5:174509502-174509524 AGGCAGGCCAAGGGAGCTCCAGG - Intergenic
1001930985 5:175672841-175672863 AGCTCTGCCGAGGGGCCTCCTGG - Intronic
1002098049 5:176843739-176843761 AGCCTGAGCAGGGGGGCTCCAGG - Intronic
1002925671 6:1604639-1604661 GGGTCGGCCAAGGGGCCTCCGGG + Intergenic
1003461264 6:6330917-6330939 AGCTGGGCCCATGGTGCTCCTGG + Intergenic
1004187873 6:13437012-13437034 AACTTGGCCAAGGGATATCCAGG - Intronic
1006764729 6:36494849-36494871 ACCTTAGCCAAGAGGGTTCCAGG + Exonic
1014220711 6:118796119-118796141 CCCTTGGCAAAGTGGGCTCCTGG - Intergenic
1018058271 6:160070812-160070834 AGCTTGGGATGGGGGGCTCCAGG + Intronic
1018613046 6:165662140-165662162 GGCCTGGCCAAGGGGGAGCCGGG + Intronic
1018679508 6:166252702-166252724 CCCTTGGGCAAGGGGCCTCCCGG + Intergenic
1026131229 7:67622530-67622552 AGCTTGGAGAAGGGGGCTTTGGG - Intergenic
1029611816 7:101630617-101630639 AGCCTGGCCCTGGGGCCTCCTGG + Intergenic
1030102238 7:105956608-105956630 AGCTTGGGGTAGGGGGCTCCAGG + Intronic
1030415558 7:109238704-109238726 AAATTGGCCAAAGGGGCTACAGG - Intergenic
1031304186 7:120103356-120103378 GTCTTGGCCAAGGGGACCCCAGG - Intergenic
1032389227 7:131544957-131544979 AGCTTGGAGAAGGGGATTCCAGG - Intronic
1035020589 7:155797844-155797866 AGCTTGGCCCTGGGGGAACCAGG + Intergenic
1035131777 7:156661269-156661291 CTCTTGGCCAAGGGGGCCCTAGG - Intronic
1036748705 8:11429449-11429471 AGCTCTGCCAAGGGGCCCCCTGG + Intronic
1036773396 8:11593790-11593812 AGCTAGGCCGAGAGGGGTCCTGG - Intergenic
1037425063 8:18746491-18746513 AGCGTGGCCAAGGGAGGTCCAGG + Intronic
1039877823 8:41602606-41602628 AACTTGGCCCAGTGGGCTTCAGG + Intronic
1039934525 8:42030157-42030179 GTCTCGGACAAGGGGGCTCCAGG + Intronic
1040340011 8:46435684-46435706 AGGATGGCCATGGGGGCTTCTGG + Intergenic
1041910949 8:63087524-63087546 AGCTTGGCCCAGGGGTATCTGGG + Intergenic
1043441147 8:80278149-80278171 AGCTTGTCCAAGGTGGTTTCGGG - Intergenic
1044063385 8:87667337-87667359 AGTTTGGCCAAGGGTTCTTCAGG - Intergenic
1049257399 8:141621234-141621256 GCCTTGGCCAGAGGGGCTCCGGG - Intergenic
1049306251 8:141905861-141905883 AGCTTGGCCAAGGGGCGTGGGGG + Intergenic
1049354253 8:142179838-142179860 AGCAGGGCCAAGGGGGCGCTGGG - Intergenic
1049372235 8:142273408-142273430 AGCTAGGCCCAGGGGCCTCCAGG - Intronic
1049406463 8:142453764-142453786 AGCTCTGCCAAGGAGGCTCTGGG + Intronic
1053306295 9:36986685-36986707 AGCTAGGCCCACGGGGCGCCCGG + Intronic
1053357108 9:37455517-37455539 AGCATGCCCAATGGGGCTTCGGG + Intronic
1053371417 9:37564681-37564703 AGATTGGCCAAAGGGGCTACAGG - Intronic
1056781088 9:89551641-89551663 TTCTTGGCCAAGGGGACCCCAGG - Intergenic
1056867015 9:90236896-90236918 CGGTTGGCCAAGGGGACCCCAGG + Intergenic
1057048754 9:91906118-91906140 AGCCTGGCCACGGGAGCTTCAGG - Intronic
1061204877 9:129157062-129157084 AGCTTGTCCAAGTGGGTTCAGGG + Intergenic
1061481094 9:130898089-130898111 AGCTTGGCCATGCGGGCACCTGG - Intergenic
1061498742 9:130990382-130990404 AGCCTGGCCCAGGGTGCTCTGGG - Intergenic
1061912875 9:133734163-133734185 AGTGAGGCCATGGGGGCTCCAGG + Exonic
1061918292 9:133768652-133768674 AGCTTGGCCCAAGGGCCTCCTGG - Intronic
1062256700 9:135626521-135626543 AGCTTGGAAAAGGCAGCTCCTGG - Intronic
1062479951 9:136746576-136746598 AGCTGGGACCAAGGGGCTCCAGG - Intronic
1188943050 X:36263753-36263775 AGCATGGCCACAGGGGCTCTTGG - Intronic
1190634160 X:52417978-52418000 ACCATGGCCAAGAGGGATCCTGG - Intergenic
1198179124 X:134187639-134187661 AGCCTCTCCAAGGGGGCACCAGG - Intergenic
1199537145 X:148915541-148915563 AGCCTGGCAAAGGGAGCTCAGGG + Intronic
1201392499 Y:13513324-13513346 AGCTTTGCCCAGGGGACTCAAGG + Intergenic