ID: 1185057379

View in Genome Browser
Species Human (GRCh38)
Location 22:48588037-48588059
Sequence CAGATGGAGCTTGGCCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 268}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057379_1185057398 20 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057379_1185057399 28 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057379_1185057393 7 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057379_1185057389 -1 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057379_1185057390 4 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057379_1185057397 19 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057379_1185057394 8 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057379_1185057395 12 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057379_1185057392 6 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057379_1185057387 -10 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057387 22:48588050-48588072 GCTCCATCTGTGCATAATGGGGG No data
1185057379_1185057391 5 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057379 Original CRISPR CAGATGGAGCTTGGCCAAGG GGG (reversed) Intronic
900399787 1:2468159-2468181 CTGATCGAGGTTGGCAAAGGTGG + Intronic
901013551 1:6214587-6214609 GAGATGGAGTTTTGCCAAGTTGG + Intronic
901494933 1:9615454-9615476 CAGAGGGAGCTCTACCAAGGTGG + Intergenic
901626757 1:10629269-10629291 CAGATGGGCCTTGCCCAGGGTGG + Intronic
901811812 1:11771665-11771687 GAGATGGAGCCTGGCCACGCAGG + Intronic
902223876 1:14984169-14984191 GAGATGGAGTTTTGCCAAGCTGG - Intronic
902528035 1:17071849-17071871 CAGAAGCAGCATGGCCAAAGGGG + Intronic
902676577 1:18012871-18012893 CAGATGCAGCTGTGCCAAGCAGG - Intergenic
902786980 1:18739039-18739061 CAGATGGACCTGGGCATAGGCGG - Intronic
902819518 1:18935414-18935436 GTGATGGAGCTTGGCACAGGGGG - Intronic
903154928 1:21436778-21436800 CAGCTGGTGCTTGTGCAAGGCGG - Intergenic
903268145 1:22170920-22170942 TGGATGGGGCTTGGCCAAAGAGG + Intergenic
903990773 1:27267428-27267450 GAGATGGAGTTTCGCCAAGTTGG + Intronic
904239958 1:29137618-29137640 CAGATGGGGTTTGGCCATGTTGG + Intergenic
905148694 1:35909002-35909024 CAGATGGAGTTTCGCCATGTTGG + Intronic
905237915 1:36562881-36562903 CAGATGGGGCTTTGCCATGTTGG + Intergenic
905419561 1:37831025-37831047 CAACTGGGGCTTGCCCAAGGTGG + Intronic
906123935 1:43414911-43414933 CTGATGGAGATTGGATAAGGGGG + Intronic
909782254 1:79561624-79561646 CAGGGGGAGCTTGGGCATGGTGG + Intergenic
909900860 1:81133037-81133059 AAGAAGGGGCTTGGCCTAGGAGG - Intergenic
911039649 1:93581909-93581931 CTGATGGAGCTGAGGCAAGGGGG + Intronic
911071091 1:93832386-93832408 CAGATGGAACATGGCTTAGGAGG - Intronic
911292905 1:96079791-96079813 CAGCTGGAGCTTCCCCAAGCTGG - Intergenic
914946712 1:152073248-152073270 AAGATGGAGCTTGGCCAGCAGGG - Intergenic
915214464 1:154330573-154330595 CAGATGGAGAGTGGCTGAGGAGG - Intronic
916265065 1:162882392-162882414 CAGATGCAGGTTGGCCAATGGGG - Intergenic
916602467 1:166306388-166306410 CAGATGGAGTTTGCCCATGTTGG - Intergenic
916620431 1:166490536-166490558 AAGATGGGGCTTGGGCAGGGTGG + Intergenic
916941809 1:169685193-169685215 CAGATGGAACATGGCTTAGGAGG - Intronic
918084055 1:181230257-181230279 CGGAAGGACCTTGGGCAAGGTGG - Intergenic
919894304 1:201999336-201999358 GAGTTTGAGCTTGGCCAACGTGG + Intronic
923252659 1:232191768-232191790 AACATGGAGTTTGGCCAGGGCGG + Intergenic
923419371 1:233797472-233797494 CAGGTGTAGCTTTGCCAGGGAGG + Intergenic
923506288 1:234609187-234609209 CAGCAGCAGCTTGGCCACGGCGG - Exonic
923851740 1:237803615-237803637 CAGATGGAGCTAATCTAAGGAGG - Intronic
1063848740 10:10161158-10161180 CAGGTGGGGCTTGGGCATGGCGG - Intergenic
1064231937 10:13536823-13536845 CAGCTGGAGCTCTGCCAAGGTGG + Intergenic
1065721031 10:28629049-28629071 CGGAGGGAGCTTGGCAAAGCCGG - Intergenic
1066131932 10:32402974-32402996 CAGATGGAGTTTCACCAAGTTGG - Intergenic
1067732263 10:48820747-48820769 CAGCTGGAGCCTGGCCCAAGGGG + Intronic
1067787290 10:49259887-49259909 CAGCTGGGGCCTGGGCAAGGAGG - Intergenic
1067989993 10:51201263-51201285 GAGATGGAGTTTGGCCAGGCTGG - Intronic
1069624975 10:69862032-69862054 CAGCTGGAAATTGGCCATGGTGG - Intronic
1070101143 10:73388039-73388061 CAGATGGAGTTTCGCCATGTTGG + Intronic
1071277268 10:84066602-84066624 CAGATGGAGTTTAGCCATGTTGG - Intergenic
1073029716 10:100515974-100515996 AAGAAGGAGCTTTGCCAAGTTGG - Intronic
1076421911 10:130337913-130337935 CAGATGGCGATTGTGCAAGGAGG - Intergenic
1077357170 11:2123704-2123726 CATATGGAGCATGGCCAGAGGGG + Intergenic
1078102402 11:8337618-8337640 CAGAGGGAGCTTGACGACGGCGG + Intergenic
1079631560 11:22684026-22684048 AAGATAGAACTTGTCCAAGGAGG + Intronic
1082614887 11:55347775-55347797 AAGATGGAATTTGGCCAAGTTGG + Intergenic
1084013632 11:66366283-66366305 CACATGGGGCTTGGGCAAGAGGG - Intronic
1084564970 11:69923510-69923532 CAGCTGGAGCTAGGACAGGGAGG + Intergenic
1084912094 11:72398284-72398306 CTGAAGGAGCTTCCCCAAGGGGG + Intronic
1085535391 11:77214289-77214311 AAGTTTGAGCTTGGTCAAGGAGG - Intronic
1089300017 11:117492911-117492933 CAGGTGGAGCTTGGCTAATCAGG - Intronic
1089460600 11:118650950-118650972 CTGATGGAATTTGTCCAAGGGGG - Intronic
1092929335 12:13300413-13300435 CAGATGGAGATTGGGAAGGGAGG + Intergenic
1094196144 12:27751896-27751918 TACATGGAGGTAGGCCAAGGTGG - Intronic
1095850584 12:46799413-46799435 GAGATGGAGCTTTGCCATGTTGG - Intronic
1096425319 12:51496647-51496669 CTGCTGGAGCTGGGCCATGGTGG - Intronic
1096477990 12:51920351-51920373 CCTATGGATCTTGGCAAAGGTGG + Intronic
1096600389 12:52724646-52724668 CAGATGATGCTGGGCCAGGGAGG + Intergenic
1098038758 12:66333705-66333727 CAGAGGAAGGTTGGCTAAGGTGG + Intronic
1098465774 12:70784156-70784178 CAGCTGCAGCCTGGCCCAGGAGG + Intronic
1098550861 12:71759668-71759690 CAGATGTAGCTTGGGCAAAAAGG - Intronic
1099662501 12:85582377-85582399 AAGGTGGAGGTTGGACAAGGTGG - Intergenic
1100629700 12:96375434-96375456 CAGAATGAGCTTGCCTAAGGAGG - Intronic
1101984308 12:109433692-109433714 CAGATGGAGAGAGGCCAAGGCGG - Intronic
1102031071 12:109740464-109740486 TGGATGGTGCTTGGCCAGGGGGG + Intronic
1103625028 12:122212020-122212042 CAGATGGAGTTTTGCCATGTTGG + Intronic
1103680597 12:122690537-122690559 CAGATGGAGTTTTGCCATGTTGG - Intergenic
1104466527 12:128995026-128995048 CAGCTGGAGTTTTGCCAGGGAGG - Intergenic
1104880111 12:132064855-132064877 CACCTGGAGGTTGGCCACGGTGG - Exonic
1106287322 13:28329170-28329192 CAGATAGACCTTACCCAAGGGGG - Intronic
1107658201 13:42613409-42613431 TAGATGGAGCTTTCCCCAGGGGG + Intergenic
1108508500 13:51134649-51134671 CAGCTGGAGCTGGGCCCAGCAGG - Intergenic
1109394566 13:61739287-61739309 CAGATGGAGTTTTGCCATGTTGG + Intergenic
1112675362 13:101695250-101695272 TACATGGAACTTGGCCAAGTAGG + Intronic
1113015537 13:105824363-105824385 TAGGTGGAGCATGGTCAAGGAGG - Intergenic
1113499369 13:110761086-110761108 GAGATGGAGCAAGGGCAAGGGGG - Intergenic
1113731892 13:112647567-112647589 CATACCGAGCTTGGGCAAGGAGG + Exonic
1115480092 14:33852128-33852150 CAAATGAAGCTTGGGCACGGGGG - Intergenic
1120735546 14:88047975-88047997 CAGAGGGTGCCTGGCCAAGCTGG - Intergenic
1120890198 14:89484768-89484790 CAGATGGTGTGTGGCCAGGGAGG + Intronic
1121813913 14:96914603-96914625 CAGATTGTGCTTTGCCAAGATGG + Intronic
1123821594 15:24036055-24036077 TAGATGGAGCTTTGGCAGGGAGG + Intergenic
1125833001 15:42729484-42729506 CCAAGGGAGCTGGGCCAAGGGGG + Intronic
1127285352 15:57528068-57528090 CAGATGGAGCTTCACCATGGTGG - Intronic
1127399137 15:58568291-58568313 AAACTGGAGCTTGTCCAAGGAGG + Intronic
1127678629 15:61270823-61270845 CTGATGGATATTGGCCAAAGTGG - Intergenic
1128677920 15:69625256-69625278 CAGAGGGGGCTTGGGGAAGGGGG + Intergenic
1128769673 15:70272542-70272564 CAGACGGAGCTTTGCCATGTTGG + Intergenic
1129383194 15:75180751-75180773 CAGATGGTGCTTGGCAGAGCAGG - Intergenic
1129532231 15:76277687-76277709 CAGATGGGGTTTCGCCAAGTTGG + Intronic
1130180394 15:81621234-81621256 CAGATGGGGTTTGGCCATGTTGG + Intergenic
1132553363 16:562256-562278 CAGATGGAGCTGGGCTGAGCAGG + Intronic
1132593774 16:738832-738854 CAGATGGGGGTTGGCCAGGCTGG + Intronic
1132790823 16:1686500-1686522 CAGATGGAGTTTTGCCATGTCGG - Exonic
1133588345 16:7217315-7217337 GAGATGGAGTTTTGCCAAGTTGG + Intronic
1134076475 16:11295550-11295572 GAGATGGAGTTTGGCCATGTTGG + Intronic
1135425894 16:22335735-22335757 CAGATGGGGCTGGACCAGGGTGG - Intergenic
1137732600 16:50699659-50699681 CAGAAGGCGCCTGGCCAAGTGGG - Exonic
1139403753 16:66702270-66702292 GAGATGGAGTTTGGCCACGTTGG - Intergenic
1139405816 16:66716883-66716905 CAGGTCCAGCTTGGCCAACGTGG - Intergenic
1140358248 16:74323889-74323911 CAGAAAGAGCTTAACCAAGGAGG + Intergenic
1142210340 16:88805592-88805614 CCGCTGGACCTTGGCAAAGGTGG - Exonic
1203143489 16_KI270728v1_random:1784126-1784148 CAGATGGTGTTTGGCCATGTTGG + Intergenic
1143760952 17:9103897-9103919 GAGATGGAGTTTCGCCAAGTTGG - Intronic
1145242073 17:21245892-21245914 CAGCTGGGCCTTGGCCAGGGTGG - Intronic
1147695930 17:42353159-42353181 GAGATGGAGCTTTGCCATGTTGG - Intronic
1150284847 17:63948898-63948920 CAGATGGAGCTGGGTGAGGGAGG - Intronic
1151916342 17:77120962-77120984 CAGAGGGAGCTTGGCTCTGGAGG + Intronic
1152779110 17:82218591-82218613 CAGGTGGAGCTTGGTCAGGGAGG + Intergenic
1152780782 17:82226639-82226661 CAGATGGAGCCTGGCCACCTGGG + Intergenic
1153563118 18:6392360-6392382 GAGATGGAGCTTTGCCATGTTGG - Intronic
1154027843 18:10724819-10724841 CAGATGCACCTGGGCCACGGCGG + Intronic
1154305165 18:13225213-13225235 AAGATTTAGCTTGTCCAAGGTGG - Intronic
1157532433 18:48432660-48432682 CAGATGGAGTTTCACCAAGTTGG + Intergenic
1157861390 18:51144016-51144038 GAGATGGAGTTTTGCCAAGTTGG - Intergenic
1159170648 18:64762175-64762197 CATATGGAGGCTGGGCAAGGTGG + Intergenic
1159328061 18:66949564-66949586 CAGACGGAGTTTGGCCAGGGCGG - Intergenic
1160420467 18:78740463-78740485 CAGCTGCTGCTTGGCCCAGGGGG - Intergenic
1160586109 18:79914570-79914592 CAGACGCAGCTTGGGCAAGGGGG - Intronic
1163181273 19:15605534-15605556 GAGATGGAGTTTCGCCAAGTTGG + Intergenic
1163505899 19:17705924-17705946 GAGATGGAGTTTTGCCATGGTGG - Intergenic
1163636801 19:18440821-18440843 CAGGTGGAGCTTGGTACAGGAGG + Intergenic
1165384947 19:35504867-35504889 CAGCTGCTGCTTGGCCCAGGTGG - Intronic
1166103416 19:40584821-40584843 CATATTGAGCCTGGCCAACGTGG - Intronic
1166697250 19:44859126-44859148 CTGATGGAGATGGGCCATGGAGG - Intronic
1167124461 19:47539701-47539723 CATAGGGAGCATGGCCATGGTGG - Exonic
1167339944 19:48909431-48909453 CAGATGGAGTTTTGCCATGTTGG + Intronic
1167556238 19:50197675-50197697 CAGATGGAGCAGGGCCATGTGGG + Intronic
926151581 2:10428517-10428539 AAGATGGCCCTTGGCCAAGGTGG + Intergenic
927081543 2:19635670-19635692 CAGAAGGAGATTGGCTGAGGAGG - Intergenic
927362712 2:22254967-22254989 CTAATGAATCTTGGCCAAGGAGG + Intergenic
927981502 2:27377678-27377700 CAGAAGGTGCATGGCCACGGTGG - Exonic
928877697 2:36060124-36060146 GAGATGGTGCTTGGCCCTGGAGG - Intergenic
929213670 2:39386998-39387020 CAGATGGAGTTTTGCCATGTTGG + Intronic
930002230 2:46869213-46869235 CACAGGGAGCTTGGCCTAGGAGG - Intergenic
932159442 2:69447034-69447056 CAGATGGGACATGGCTAAGGAGG + Intergenic
937154302 2:119707837-119707859 GAGATGGGGCTTGGCCAACGGGG + Intergenic
940565710 2:155357220-155357242 CAGATAGTGCTTGACCAAGAGGG - Intergenic
940908352 2:159188736-159188758 CAGAAGAGGCTTGGCCAGGGTGG - Intronic
941927783 2:170913647-170913669 CAGATGGAGCTTCACCATGTTGG + Intergenic
942513568 2:176728263-176728285 CAGATGGAGCTGGTCCACGGTGG - Intergenic
942977353 2:182034316-182034338 CAGATGTAGCTTAGTCTAGGTGG + Intronic
946358925 2:219207177-219207199 CAGAGGGGGCGTGGCCAAGGAGG + Intronic
947123328 2:226840144-226840166 CAGCTGGAGCTTGGGGGAGGGGG + Intronic
1169217881 20:3803921-3803943 CAGAAGGAGCTCAGCCAGGGAGG - Intronic
1171898906 20:30838466-30838488 CAGATGGGGCTTTGCCATGCTGG - Intergenic
1173841278 20:46158661-46158683 CAGTGGGAGGTGGGCCAAGGGGG + Intergenic
1173879672 20:46402559-46402581 GAGATGGAGCTTGGGTAGGGAGG + Intronic
1174210998 20:48877920-48877942 GAGATGGAGCTTCGCCATGTTGG - Intergenic
1175457825 20:59128500-59128522 CAGATGGAGGATGGTCCAGGAGG + Intergenic
1175967034 20:62664920-62664942 CAGATGGAGCTGGGCAGAGGTGG - Exonic
1178858823 21:36272461-36272483 GAGATGGAGTTTCGCCAAGTTGG - Intronic
1178889088 21:36506408-36506430 CAGATGGGGCTTTGCCATGCTGG - Intronic
1179174123 21:38995162-38995184 CAAAAGGTGCTTGGCCATGGCGG - Intergenic
1181550586 22:23636974-23636996 CAGAAGGAGCCTGGCCCAGCTGG + Intergenic
1182558471 22:31141529-31141551 CAGATGGAGCCTGGGGCAGGGGG - Intergenic
1182749136 22:32627771-32627793 CAGGTGGAGCTTCTTCAAGGAGG - Intronic
1183043853 22:35203876-35203898 CAGAGGCAGCTTCCCCAAGGAGG - Intergenic
1183044193 22:35206675-35206697 CAGAGGCAGCTTCTCCAAGGAGG - Intergenic
1183300833 22:37058340-37058362 GAGATGTAACTTGCCCAAGGTGG - Intronic
1184104644 22:42360281-42360303 CAGAGGGAGCTCCCCCAAGGAGG - Intergenic
1184409949 22:44320676-44320698 CGGCTGGAGCTGGGCCAAAGAGG - Intergenic
1185057379 22:48588037-48588059 CAGATGGAGCTTGGCCAAGGGGG - Intronic
950011710 3:9728840-9728862 GAGATGGAGCTGGGGCAAGAAGG - Intronic
950196212 3:11011029-11011051 CAGAGGGAGATTGTCCAAGGCGG + Intronic
950306172 3:11916559-11916581 GAGCTGGAGCCTGGCCAAGGAGG - Intergenic
950646782 3:14382088-14382110 CAGAGGGAGCAAGGACAAGGAGG + Intergenic
952185999 3:30969295-30969317 GAGATGGAGTTTTGCCAAGTTGG - Intergenic
954025046 3:47776413-47776435 GAGATGGAGTTTGGCCATGTTGG - Intronic
954130976 3:48560855-48560877 GAGAGGGGGCTGGGCCAAGGGGG - Intronic
954927190 3:54246504-54246526 GAGATGGAGTTTCGCCAAGTTGG - Intronic
955322840 3:57986560-57986582 CAGATGGAAAATGGCTAAGGAGG - Intergenic
955555637 3:60134191-60134213 CTAATGGAGTTGGGCCAAGGTGG + Intronic
955693291 3:61610994-61611016 GAGATGGAGCTTTGCCATGTTGG + Intronic
956195481 3:66649883-66649905 CAGATGGGGCCTGGGCCAGGAGG + Intergenic
956650185 3:71497805-71497827 CAGAAGTACCTTGGCCCAGGAGG + Intronic
956835094 3:73090050-73090072 CAGATGCAGCGTGGCCAGGTAGG - Intergenic
958470412 3:94510366-94510388 CAGAGGGAGGTGGGCCAATGAGG - Intergenic
958636179 3:96750235-96750257 CAGCTGCAGCTGGGCCAATGAGG - Intergenic
964725074 3:159805994-159806016 CAGATGGAGTTTCACCAAGTTGG + Intronic
965330788 3:167372022-167372044 GAGATGGTGCTTGGCCATGTTGG - Intronic
965761251 3:172079351-172079373 AAGATGGAGTTTGGCCTTGGTGG + Intronic
968574878 4:1361006-1361028 TGGATGGAGCTGGGCCAGGGCGG - Intronic
970433863 4:16014227-16014249 CTGATGTAGCTAGGCTAAGGTGG - Intronic
971928950 4:33053260-33053282 GAGTTAGAGTTTGGCCAAGGAGG - Intergenic
976192184 4:82498476-82498498 CAGATGGAGTTTCGCCATGTTGG + Intronic
976281394 4:83330275-83330297 AAGTTGTAGCTTGGACAAGGAGG + Intronic
976794414 4:88916349-88916371 TAGATGGAGCTTCTCCAAAGAGG - Intronic
977135133 4:93294744-93294766 CAGATGGAGTTTTGCCATGTTGG + Intronic
979227890 4:118310862-118310884 CAGATGGAGTTTTGCCATGTTGG - Intronic
980924015 4:139116028-139116050 CAGATGGGGTTTTGCCAAGTTGG + Intronic
981933707 4:150216804-150216826 CTGATTCTGCTTGGCCAAGGAGG - Intronic
982050369 4:151495314-151495336 CAGATGGAGTTTCGCCATGTTGG - Intronic
982525359 4:156470973-156470995 CAGATGGGGCATGGGCAATGGGG + Intergenic
983000554 4:162409049-162409071 GAGGTGGAGCTGGGCCCAGGTGG - Intergenic
984289866 4:177781713-177781735 AACATGGAGTTTGGCCAGGGTGG - Intronic
984719622 4:182957602-182957624 GAGATGGAGTTTGGCCATGTTGG + Intergenic
985553212 5:543584-543606 CAGAGGGAGCTGGGCTATGGAGG + Intergenic
985816993 5:2134562-2134584 CAGGTGGGGCTTGGCCTTGGTGG - Intergenic
986734823 5:10660989-10661011 CAGATGGGGCTTGGCGAGGCAGG - Intergenic
987309908 5:16672106-16672128 CAGATGGGGTTTGGCCATGTTGG - Intronic
990254005 5:53946265-53946287 CAGATGGGGCTTCGCCATGTTGG - Intronic
993610415 5:90046640-90046662 CAGATGGAGTTTTGCCATGTTGG - Intergenic
994324892 5:98436890-98436912 CAGATGGAACTTGGCTTAGGAGG - Intergenic
996196722 5:120616343-120616365 CAGTTGGAGCTTGGCCTGTGAGG - Intronic
996435407 5:123428590-123428612 GAGATGGGGTTTGGCCATGGTGG - Intergenic
996885550 5:128349986-128350008 CAGATACAGCTTGCCCAAGAGGG - Exonic
997555691 5:134796664-134796686 CAGATGGAGTTTCGCCATGTTGG - Intronic
997962828 5:138335520-138335542 CAGATGGGGTTTGGCCCATGAGG + Intronic
998245773 5:140503466-140503488 GAGATGGAGTTTGACCACGGGGG - Intronic
998399983 5:141843580-141843602 CAGATGGAGCTAGAACCAGGAGG - Intergenic
998492349 5:142558220-142558242 CAAATGGAACTTGTCCAAGGAGG + Intergenic
1000097846 5:157986790-157986812 CAGAAGCAGCTTGGCCCTGGCGG - Intergenic
1002902087 6:1417657-1417679 CAGTTGGAGCTGGGACATGGAGG - Intergenic
1003198816 6:3939859-3939881 CAGATGGAGCCTGGCCCATGTGG - Intergenic
1003481638 6:6539366-6539388 CTCATGGAGCTTGGATAAGGTGG - Intergenic
1004147057 6:13077703-13077725 CAGGGGGAGCCTGGCCAGGGAGG + Intronic
1004547502 6:16612702-16612724 CAGATGGAGTTTTGCCATGTTGG - Intronic
1004575237 6:16888280-16888302 CAGATGGGACTTGGCTTAGGAGG - Intergenic
1005630191 6:27700111-27700133 GAGATGGAGTTTGGCCATGTTGG + Intergenic
1006743768 6:36326957-36326979 CAGGTGGAGCTTGGCAGAGGAGG + Intronic
1007573133 6:42907601-42907623 CTGAGGGAGCTAGACCAAGGTGG + Intergenic
1007658830 6:43469641-43469663 AAGAGGGAGCTGGGCCAGGGAGG + Intergenic
1008476543 6:51940507-51940529 CAGATGGGGCATGGCTTAGGAGG - Intronic
1009563563 6:65279000-65279022 GAGATGGAGTTTAGCCATGGTGG - Intronic
1009981132 6:70727293-70727315 GAGATGGAGTTTGGCCATGTTGG + Intronic
1010997948 6:82554894-82554916 CCCATGGAGCCTGGCCAATGAGG - Intergenic
1013131826 6:107240582-107240604 CAGATGGAGTTTCGCCATGTTGG + Intronic
1015793912 6:136991684-136991706 TATATGGAGCTTGGCCAAAGTGG + Intergenic
1016525772 6:145000091-145000113 CAGATGGAGTTTTGCCATGTTGG - Intergenic
1017181582 6:151557910-151557932 GAGATGGAGTTTGGCCATGTTGG - Intronic
1017786358 6:157760275-157760297 CAGCTGGAAATTGGCCATGGGGG + Intronic
1018943000 6:168322132-168322154 GAGATGGGGCTTGGCCATGTTGG + Intergenic
1019146349 6:169977800-169977822 CCGATGGAGGTGGGCAAAGGAGG + Intergenic
1019292151 7:256072-256094 CAGAGGGAGCTGGGCCTGGGCGG + Intronic
1020198415 7:6060066-6060088 TAGATGGAGTGTGGCCAGGGCGG - Intergenic
1023117508 7:36876683-36876705 CTGGTCTAGCTTGGCCAAGGTGG + Intronic
1023831249 7:44040057-44040079 GAGATGGAACTCGGACAAGGTGG + Intergenic
1024385188 7:48743001-48743023 CAGGTGGTGCCTGGCCAAAGTGG - Intergenic
1024581767 7:50806374-50806396 CAGATTGAGCTTGCTGAAGGTGG - Intergenic
1028574465 7:92331467-92331489 CAGATGGGGTTTGGCCAGGCTGG + Intronic
1029425006 7:100489469-100489491 CAGCTGGATCTTGACCATGGGGG - Exonic
1029741579 7:102494363-102494385 GAGATGGAGCTCGGACAAGGTGG + Intronic
1029759570 7:102593532-102593554 GAGATGGAGCTCGGACAAGGTGG + Intronic
1029776937 7:102689442-102689464 GAGATGGAGCTCGGACAAGGTGG + Intergenic
1030721984 7:112881783-112881805 CAGCTGGAGGGTGGGCAAGGTGG - Intronic
1031777361 7:125919937-125919959 CAGATGGGACTTGGCTTAGGAGG - Intergenic
1035280140 7:157773228-157773250 CAGCCGGAGCATGACCAAGGAGG - Intronic
1036436863 8:8742842-8742864 CAGATGCAGCCTGGCACAGGTGG + Intergenic
1038493978 8:27988986-27989008 CAGAGGGAGGGTGGGCAAGGAGG + Intronic
1039043890 8:33433045-33433067 GAGATGGAGTTTTGCCATGGTGG - Intronic
1039514176 8:38117869-38117891 GAGATGGGGCTTTGCCATGGTGG - Intronic
1039865690 8:41499554-41499576 CAGGTGGAGTTTGGCCAGGGTGG - Intronic
1041757292 8:61328442-61328464 CAGCTACAGCTTGGTCAAGGTGG + Intronic
1042532708 8:69832326-69832348 CTCCTGGAGCATGGCCAAGGCGG + Exonic
1043430628 8:80191041-80191063 CAGATGGAGTTTTGCCATGTTGG - Intronic
1044822165 8:96161707-96161729 CAGAAGGAACTTGGGGAAGGAGG - Intergenic
1044929981 8:97242719-97242741 GAGAAGTAACTTGGCCAAGGTGG + Intergenic
1046077822 8:109333889-109333911 CAGCTGGAGCTTGACGCAGGTGG - Exonic
1046654972 8:116883656-116883678 CAGATGCAACTTAGCCAATGAGG - Intergenic
1047952848 8:129949549-129949571 CAGGTGGAGCTTGGTCACTGAGG - Intronic
1048292822 8:133193386-133193408 CAGAAGGAGATCAGCCAAGGAGG + Intronic
1048319653 8:133388272-133388294 CAGATGGAGTTAGGACATGGTGG + Intergenic
1049395006 8:142395948-142395970 CAGATGGAGGGCAGCCAAGGTGG + Intronic
1051508011 9:17846599-17846621 CAGATGGTGGAAGGCCAAGGTGG - Intergenic
1051813174 9:21073892-21073914 GAAATAGAGCTTGGCCAAGAGGG + Intergenic
1052013780 9:23442097-23442119 CAGAATGAGCTCGGCCCAGGTGG + Intergenic
1057356219 9:94333608-94333630 CAGATGGCGTTTTGCCAAGTTGG - Intergenic
1057651531 9:96924020-96924042 CAGATGGCGTTTCGCCAAGTTGG + Intronic
1058039277 9:100286365-100286387 GAGATGGAGTTTCGCCAAGTTGG - Intronic
1059051953 9:110935901-110935923 CAGATGGAGTTTTGACAAGAGGG - Intronic
1059668829 9:116474580-116474602 CAGATGGAGATGGGCATAGGGGG + Intronic
1059766294 9:117386797-117386819 TAGCAGGAGCTTAGCCAAGGAGG - Intronic
1060203546 9:121667682-121667704 CAGATGGAGTTTTGCCATGTTGG + Intronic
1060724560 9:125998359-125998381 CAGATTGAGGCTGGGCAAGGTGG + Intergenic
1060846859 9:126844346-126844368 CACAGGGAGCTCTGCCAAGGAGG + Intergenic
1061038029 9:128124268-128124290 GAGATGGAGCTTCGCCATGTTGG + Intronic
1061855697 9:133440856-133440878 CAGATGTTGCTGGGCCAAGCAGG + Intronic
1062552589 9:137096705-137096727 CAGATGGGGCTCGGGAAAGGAGG - Intronic
1185445787 X:257450-257472 CAGATGGGGTTTTGCCAAGTTGG - Intergenic
1186805755 X:13139106-13139128 CAGATGCAGCTGCGCCTAGGAGG - Intergenic
1187519780 X:20003274-20003296 CAGCTGGAACTTGGCAAAGCTGG - Intergenic
1189447916 X:41098324-41098346 GAGATGGAGTTTGGCCATGTTGG + Intronic
1191720117 X:64222373-64222395 CGAATGGGGCCTGGCCAAGGTGG - Intergenic
1194465889 X:94235067-94235089 CAGATGGAGCTAGCCCAACCTGG + Intergenic
1197555502 X:127947542-127947564 CAGATGCCACTAGGCCAAGGAGG - Intergenic
1201630205 Y:16063451-16063473 GAGAGGGAGAATGGCCAAGGTGG + Intergenic
1201706123 Y:16939114-16939136 CAGATGCCTCTTGACCAAGGGGG + Intergenic