ID: 1185057380

View in Genome Browser
Species Human (GRCh38)
Location 22:48588038-48588060
Sequence ACAGATGGAGCTTGGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 268}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057380_1185057394 7 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057380_1185057397 18 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057380_1185057393 6 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057380_1185057399 27 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057380_1185057390 3 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057380_1185057391 4 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057380_1185057395 11 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057380_1185057398 19 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057380_1185057389 -2 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057380_1185057392 5 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057380 Original CRISPR ACAGATGGAGCTTGGCCAAG GGG (reversed) Intronic
901537307 1:9890917-9890939 AGGGATGGAGCCTGGCCCAGAGG + Intronic
904027152 1:27511500-27511522 AGAGATGGAGTTTTGCCATGTGG - Intergenic
904767238 1:32859826-32859848 AGAGATGGACCTTCTCCAAGAGG + Intergenic
904776363 1:32909902-32909924 ACAAATGGAGCTGGGACAATTGG + Intergenic
906123934 1:43414910-43414932 ACTGATGGAGATTGGATAAGGGG + Intronic
906324437 1:44836011-44836033 CCAGATGGAGATTGGCCACAGGG + Intronic
906493365 1:46285551-46285573 AGAGATGGAGATTGGGGAAGTGG - Exonic
906631691 1:47374964-47374986 ACAGAGAGAGCTTGGAAAAGAGG + Exonic
907949459 1:59167716-59167738 ACAGATGGTGCTGGGACAACCGG + Intergenic
908237557 1:62161522-62161544 AGAGATGGAGCTTCCCCATGTGG + Exonic
908310018 1:62871601-62871623 ACAAATGGTGCTTGGACAACTGG - Intergenic
908415450 1:63908966-63908988 ACAGGTGAACCTTGGCCAAGGGG + Intronic
910374345 1:86552673-86552695 GCAGATGGAGCTGGGGCACGGGG + Intronic
911229027 1:95340319-95340341 CCAGATGGAATTTGGGCAAGTGG + Intergenic
913698234 1:121348322-121348344 GCAGATGGAACTCAGCCAAGGGG - Intronic
914139315 1:144931730-144931752 GCAGATGGAACTCAGCCAAGGGG + Intronic
914842202 1:151257749-151257771 AAAGATGGGGTTTGGCCATGTGG + Intronic
914902733 1:151720292-151720314 AAAGACAGATCTTGGCCAAGAGG + Intronic
914946713 1:152073249-152073271 GAAGATGGAGCTTGGCCAGCAGG - Intergenic
914970509 1:152304909-152304931 GCAGATGAAGCTTGTCCACGCGG + Exonic
916265066 1:162882393-162882415 CCAGATGCAGGTTGGCCAATGGG - Intergenic
916684684 1:167133663-167133685 ACAGATGAAGCTAATCCAAGTGG - Intergenic
916851262 1:168706554-168706576 AGAGCTGGGGATTGGCCAAGCGG + Intronic
919121560 1:193347373-193347395 ACAGTAGTAGCTTGTCCAAGTGG - Intergenic
920485633 1:206366978-206367000 GCAGATGGAACTCAGCCAAGGGG - Intronic
920894013 1:210025202-210025224 GCAGACGCAGCTTTGCCAAGGGG - Intronic
1065880284 10:30031727-30031749 ACAGATGGGGCTGGGCGCAGTGG - Intronic
1067259394 10:44674919-44674941 ACAGTTGGCTCTTGCCCAAGTGG - Intergenic
1067813457 10:49450227-49450249 ACAAATGGTGCTGGGACAAGTGG - Intergenic
1073314292 10:102567618-102567640 ACAGTTGGAGCTTGAGCCAGGGG + Intronic
1075577158 10:123585711-123585733 ACAGATGAGGCTTTGCAAAGGGG - Intergenic
1076436922 10:130452929-130452951 GCAGATGGAACTGGGCCGAGGGG - Intergenic
1077776990 11:5282858-5282880 AAAGTTGCAGCTTGACCAAGGGG + Intronic
1081705881 11:45181585-45181607 ACAGCTGTAGCCCGGCCAAGAGG - Intronic
1083399485 11:62413900-62413922 CCAGCTGGAGCCTGGGCAAGGGG + Intronic
1083916590 11:65748954-65748976 ACAAATGGAGCTAGGACAAAGGG - Intergenic
1084013633 11:66366284-66366306 CCACATGGGGCTTGGGCAAGAGG - Intronic
1084076735 11:66784352-66784374 AGAGATGGGGTTTTGCCAAGGGG + Intronic
1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG + Intergenic
1086203768 11:84234251-84234273 ACACTTGGAGGCTGGCCAAGTGG - Intronic
1088428974 11:109736515-109736537 ACAGATGGACCTTCACAAAGGGG + Intergenic
1093156649 12:15693890-15693912 TCAGATGGAGGTGGGGCAAGAGG + Intronic
1093337213 12:17920884-17920906 ACAGATGCTGCCTGGCCAAGGGG + Intergenic
1096443544 12:51667448-51667470 AGAGATGGAGGTTGCCCAGGAGG - Intronic
1096722271 12:53532223-53532245 ACAGATGGAGGGTGGGCGAGTGG - Intronic
1097652988 12:62325896-62325918 GAAGATGGAACATGGCCAAGGGG + Exonic
1098962999 12:76758662-76758684 ACAGATGGTGCTGGGAAAAGTGG + Intergenic
1100372083 12:93977764-93977786 ACAGATGGAGATGGGAGAAGAGG + Intergenic
1101462087 12:104906377-104906399 GTAGATGGAGCTTGGACATGGGG + Intronic
1101542373 12:105676803-105676825 ACAGATTGGTCTTGGCCAGGAGG - Intergenic
1102246492 12:111359754-111359776 ACAGATGGAGGCTGGGGAAGTGG - Intergenic
1102642714 12:114381130-114381152 ACACAGGGAGTTGGGCCAAGAGG + Intronic
1103767671 12:123293247-123293269 ACAGATGGGGTTTTGCCATGTGG + Exonic
1104004152 12:124880390-124880412 AGAGATGGGGTTTCGCCAAGTGG - Intronic
1104087088 12:125485332-125485354 ACAAATAGAACTTTGCCAAGGGG - Intronic
1104530553 12:129566377-129566399 TCAGAAGGACCTTGGCTAAGAGG - Intronic
1105261702 13:18784331-18784353 ACATCTGCAGCCTGGCCAAGTGG - Intergenic
1105264055 13:18800911-18800933 ACATCTGCAGCCTGGCCAAGTGG - Intergenic
1105264512 13:18804080-18804102 AAATTTGGAGCCTGGCCAAGTGG - Intergenic
1105643870 13:22295594-22295616 ACAAATGCAGTGTGGCCAAGAGG - Intergenic
1106583236 13:31035612-31035634 AAAGACGGAGCTTTGCAAAGAGG - Intergenic
1108377751 13:49829124-49829146 AGAGATGGGGCTTCGCCATGTGG - Intergenic
1113499370 13:110761087-110761109 AGAGATGGAGCAAGGGCAAGGGG - Intergenic
1116138827 14:40961640-40961662 ACAGATGGACTTTTGCAAAGAGG - Intergenic
1117244513 14:53870869-53870891 AAGGATGGAGCTTGGACATGAGG - Intergenic
1117912294 14:60647794-60647816 ACAGAAGGAGCCTGCCCAGGTGG + Intronic
1121316880 14:92966861-92966883 ACAAATGGTGCTTGGACAACTGG + Intronic
1123911314 15:24970391-24970413 ACAGATGGGGTTTCGCCATGTGG - Intronic
1124239618 15:28018826-28018848 AAAGATGGAGGGAGGCCAAGAGG + Intronic
1124427704 15:29576248-29576270 ACAGATGGTGCTGGGACAACTGG + Intergenic
1124578649 15:30931646-30931668 ACACATGGAGCTGGAACAAGTGG - Intronic
1128355732 15:66925181-66925203 ACAGATGGAGCCTGGCCCCAGGG + Intergenic
1128677919 15:69625255-69625277 ACAGAGGGGGCTTGGGGAAGGGG + Intergenic
1129759912 15:78123368-78123390 ACAGATGGAGCTTAGCAACTTGG - Intronic
1130330021 15:82914894-82914916 ACAGATGGAGGTGGGCACAGTGG + Intronic
1130602570 15:85286616-85286638 ACAGATGGGGCTGGGCACAGTGG + Intergenic
1130767119 15:86881819-86881841 AGAGATGGAGTTTTGCCATGTGG + Intronic
1131071673 15:89470118-89470140 GCATATGGGGCTGGGCCAAGCGG + Intergenic
1131168212 15:90158103-90158125 ACTCCTGGACCTTGGCCAAGAGG - Intergenic
1132108733 15:99086453-99086475 CCAGATGGAGGCTGGCCATGGGG + Intergenic
1133150571 16:3826034-3826056 AGAGATGGAGATTTGCCATGTGG - Intronic
1135048657 16:19174439-19174461 ACAGCTGGAGCCTGGCAGAGTGG + Intronic
1136779561 16:32887671-32887693 TCAGATGTTGCTTGTCCAAGGGG + Intergenic
1136891055 16:33973847-33973869 TCAGATGTTGCTTGTCCAAGGGG - Intergenic
1137732601 16:50699660-50699682 CCAGAAGGCGCCTGGCCAAGTGG - Exonic
1141788121 16:86215239-86215261 ACGGAAGGAGCTTGGTAAAGTGG + Intergenic
1203081977 16_KI270728v1_random:1149759-1149781 TCAGATGTTGCTTGTCCAAGGGG + Intergenic
1144158009 17:12526780-12526802 ACAGATGGTGCTGGGACAACTGG - Intergenic
1145210467 17:21009370-21009392 ACAGGTGCAGCTTTGCCCAGAGG - Intronic
1145976836 17:28988732-28988754 CCACTTGGAGCCTGGCCAAGAGG - Intronic
1148849731 17:50548745-50548767 TCAGAGGGAGGCTGGCCAAGTGG - Intronic
1148893650 17:50826799-50826821 ACAGACGGTGCTGGGCCAAGTGG - Intergenic
1150273798 17:63883141-63883163 AGAGATGGAGTTTTGCCATGTGG - Intergenic
1150978094 17:70111348-70111370 GGAGATGGAGCTGGGCTAAGGGG + Intronic
1151366438 17:73619506-73619528 ACAAATGGAGCTTGGATAACTGG + Intronic
1151393242 17:73801937-73801959 AAGGATGGAGCCTGGCCAGGTGG - Intergenic
1151665857 17:75544805-75544827 CCTGATGGAGCTTTGCCACGAGG + Intronic
1152182074 17:78828715-78828737 ACAGATGGAGAATGGCACAGTGG + Intronic
1152780781 17:82226638-82226660 TCAGATGGAGCCTGGCCACCTGG + Intergenic
1154423880 18:14257481-14257503 AAATTTGGAGCCTGGCCAAGTGG + Intergenic
1154427008 18:14279830-14279852 ACATCTGTAGCCTGGCCAAGTGG + Intergenic
1156494285 18:37515802-37515824 ACAGATGGAGCTTCGCAGAGGGG + Intronic
1156746474 18:40397747-40397769 AGAGATGGAGTTTTGCCATGTGG - Intergenic
1156914834 18:42453620-42453642 AGAAATGGAGCTGGGCCAAAGGG + Intergenic
1158609570 18:58926880-58926902 AAATATGCAGCTTGACCAAGTGG - Intronic
1160586110 18:79914571-79914593 CCAGACGCAGCTTGGGCAAGGGG - Intronic
1161181740 19:2888301-2888323 ACAAAGGAAGCTTGTCCAAGTGG + Intergenic
1161784553 19:6315698-6315720 ACAGATGGGATTTGGCCATGTGG + Intronic
1162016901 19:7851054-7851076 AGAGGTGGAGCATGGGCAAGTGG - Intronic
1162206087 19:9057176-9057198 AGAGATGGAGCTGGGCATAGTGG - Intergenic
1163654071 19:18535482-18535504 GAAGATGGAGCTGGGCGAAGTGG + Intronic
1163674350 19:18647934-18647956 ACAGATGGACCCTGCCCATGGGG + Intronic
1164597545 19:29540094-29540116 ACAAATGCCGCTTGGCCCAGAGG + Intronic
1166107868 19:40606256-40606278 CCAGATGGACCTTGTCCAACCGG + Exonic
1166166167 19:40990576-40990598 ACAGATGGGGTTTTGCCATGTGG + Intergenic
1166183376 19:41123981-41124003 AGAGATGGAGCTTGGGGAGGTGG - Intronic
1166780136 19:45337838-45337860 ATAGCTGGAGCTTGGCACAGTGG + Intronic
1167556237 19:50197674-50197696 CCAGATGGAGCAGGGCCATGTGG + Intronic
925142453 2:1559391-1559413 AGAGGTGGAACTTGGCCCAGGGG - Intergenic
927220960 2:20708598-20708620 ACAACTGGAACTTGGACAAGTGG + Intronic
931351354 2:61491706-61491728 AGAGATGGGGTTTTGCCAAGTGG - Intronic
932669992 2:73728793-73728815 GCACATGGAGCCTGGGCAAGGGG - Intergenic
932886498 2:75553935-75553957 TCAGAGGTTGCTTGGCCAAGTGG + Intronic
934493732 2:94780036-94780058 ACATTTGCAGCCTGGCCAAGTGG - Intergenic
934894908 2:98108790-98108812 AAAGATAGAGATTGGCAAAGAGG - Intronic
937154301 2:119707836-119707858 GGAGATGGGGCTTGGCCAACGGG + Intergenic
937178967 2:119971867-119971889 ACAAATGGTGCTGGGACAAGTGG - Intronic
938539725 2:132275924-132275946 ACAGCGGGAGCTTGGCTGAGTGG - Intergenic
939141703 2:138361549-138361571 ACAAATGGTGCTAGGCCAATTGG - Intergenic
940565711 2:155357221-155357243 ACAGATAGTGCTTGACCAAGAGG - Intergenic
940651744 2:156447518-156447540 AGAGATGGAGCCTTGCCATGTGG + Intronic
941858543 2:170254592-170254614 ACAGCTGGTGCTTGACCCAGAGG + Intronic
942409217 2:175690265-175690287 TCACATGTAGCTTGGGCAAGAGG - Intergenic
943467575 2:188247616-188247638 ACAGATGGAACTTCACTAAGAGG + Intergenic
943563130 2:189487084-189487106 AGAGATGGAGTTTTGCCATGTGG + Intergenic
946353293 2:219169380-219169402 AAGGATGGAGCCTGGACAAGAGG + Exonic
946802681 2:223437067-223437089 ACAGCCGGATCTTTGCCAAGAGG + Intergenic
947123327 2:226840143-226840165 ACAGCTGGAGCTTGGGGGAGGGG + Intronic
947919790 2:233859514-233859536 ATAAATGGAGTTTGGCAAAGAGG - Intergenic
948174082 2:235929321-235929343 ACAGAAGCAGCATCGCCAAGAGG - Intronic
948996613 2:241583568-241583590 ACAGATGGAGCATTCCCAAGAGG - Intergenic
1168897600 20:1334579-1334601 AGAGCAGGAGCTTGGCAAAGAGG + Intronic
1171085125 20:22231419-22231441 ACAGATGGAGTTTGACCAGCTGG + Intergenic
1171309392 20:24134452-24134474 GCAGATGGAGCTTGGACATGTGG + Intergenic
1171413687 20:24963332-24963354 GCAGAGGGAGCATGGCCCAGGGG - Exonic
1171885337 20:30647824-30647846 AAATTTGGAGCCTGGCCAAGTGG - Intergenic
1171992405 20:31706895-31706917 ACAGGCAGAGCTTGGGCAAGAGG + Intronic
1172521249 20:35567470-35567492 ACAGATGGAGCTGAGACAACTGG + Intergenic
1175199590 20:57268028-57268050 GCAGAAGTAGTTTGGCCAAGTGG + Intergenic
1176551331 21:8223770-8223792 ACGGAGGGAGCTTGGCTGAGTGG + Intergenic
1176570240 21:8406769-8406791 ACGGAGGGAGCTTGGCTGAGTGG + Intergenic
1176578149 21:8450956-8450978 ACGGAGGGAGCTTGGCTGAGTGG + Intergenic
1176849590 21:13902527-13902549 AAATTTGGAGCCTGGCCAAGTGG - Intergenic
1179638639 21:42732027-42732049 ACAGATGGAACACGGACAAGAGG - Intronic
1182794833 22:32984438-32984460 GTAGATGAAGCTTGGCCACGTGG - Intronic
1183473329 22:38021292-38021314 AGAGAGGGAACTTGGCCATGGGG + Intronic
1183646640 22:39131137-39131159 ACAGGAGGAGCTTGGCAACGAGG + Exonic
1184287699 22:43481251-43481273 ACACATGGTGCTAGGCCAGGAGG - Intronic
1185019898 22:48367939-48367961 ACAGCTGGAGCCTGGCCCAAGGG - Intergenic
1185057380 22:48588038-48588060 ACAGATGGAGCTTGGCCAAGGGG - Intronic
1203256354 22_KI270733v1_random:140714-140736 ACGGAGGGAGCTTGGCTGAGTGG + Intergenic
949467217 3:4356096-4356118 TCAGATGGAGCTTTGGCACGTGG - Intronic
949588932 3:5473114-5473136 ACAGATTGAGATTGGCACAGAGG + Intergenic
950482274 3:13251624-13251646 AGAGCTGGAGCCTGGCCAAGGGG + Intergenic
953971363 3:47350366-47350388 ACAAATGGTGCTTGGACAAATGG - Intergenic
954046087 3:47931780-47931802 ACAGATGGAGCCAGGCACAGTGG - Intronic
954260325 3:49434011-49434033 ACAGATGGAGTTTCGCCCTGTGG - Intergenic
954928905 3:54262707-54262729 GCAGATGGTTCCTGGCCAAGCGG + Intronic
955567616 3:60265340-60265362 AGAGATGGTCCTTGGACAAGTGG + Intronic
956619423 3:71206033-71206055 ACAAATGGAGCTGGGGAAAGTGG - Intronic
956811494 3:72867874-72867896 ACGGATGAAGCTTGGACATGTGG + Intergenic
957704694 3:83765415-83765437 ACAGATGCAACTTGGTCAATTGG - Intergenic
960077825 3:113508049-113508071 ACAGATGGTGCTGGGACAACTGG + Intronic
960646901 3:119895632-119895654 ACAAATGGTGCTTGGACAACTGG - Intronic
964725610 3:159811508-159811530 ACAGATGGTGCTGGGACAACTGG - Intronic
965147937 3:164930012-164930034 ACAGATAGAACTTGGACAATTGG + Intergenic
965461464 3:168970005-168970027 ACAGATAGAGTTTAGCCATGAGG - Intergenic
965484013 3:169256608-169256630 AAAGATGGAGTTAGTCCAAGAGG + Intronic
965553434 3:169994871-169994893 ACATTTGGAGCATGGCCAACAGG + Exonic
968691579 4:1992889-1992911 ACAGAAGGGGCTGGGCCACGCGG - Intronic
969565593 4:7975515-7975537 ACTGATGGGGCATGGCCAAGGGG - Intronic
972631361 4:40844601-40844623 ACAGAGGGACCTGAGCCAAGGGG - Intronic
973368529 4:49226932-49226954 ACATTTGCAGCCTGGCCAAGTGG - Intergenic
973392051 4:49565323-49565345 AAATTTGGAGCCTGGCCAAGTGG + Intergenic
973392520 4:49568494-49568516 ACATTTGCAGCCTGGCCAAGTGG + Intergenic
976209257 4:82651137-82651159 ACAGATGGTAGTTGGACAAGAGG + Intronic
976754868 4:88487389-88487411 AGGGATGGAGCTTGGACAACTGG + Intronic
976883518 4:89959923-89959945 ACAGATACATCTTGGCCAAGGGG + Intergenic
985314428 4:188640485-188640507 ACAGATGGAGAAAGGGCAAGAGG - Intergenic
985983280 5:3489585-3489607 AGAGAGGGAGCTGGGCCTAGGGG + Intergenic
986627452 5:9735959-9735981 ATAGATGGAGCTTTTTCAAGGGG - Intergenic
986794607 5:11197137-11197159 AGAGTGGAAGCTTGGCCAAGTGG + Intronic
989213571 5:38880994-38881016 AGAGATGGAGTGTGGCCATGTGG + Intronic
989952529 5:50316566-50316588 AAAAATTGAGCTTGGACAAGAGG - Intergenic
991561597 5:67959214-67959236 AAAGATGTAGCTTGGTGAAGAGG - Intergenic
991570828 5:68051618-68051640 GCAGATGGAGCTGTGTCAAGAGG - Intergenic
993029934 5:82694384-82694406 ACAGATGGACCTTGGACCAGAGG - Intergenic
993645116 5:90452298-90452320 ACAAATGGAGATTGGACAACTGG + Intergenic
995344232 5:111092814-111092836 TCAGAGGCAGCCTGGCCAAGGGG + Intronic
996885551 5:128349987-128350009 ACAGATACAGCTTGCCCAAGAGG - Exonic
997789311 5:136743031-136743053 ACAGCTGGAGCTGGGGCAATTGG - Intergenic
998245774 5:140503467-140503489 AGAGATGGAGTTTGACCACGGGG - Intronic
998320697 5:141227015-141227037 AGAGATGGAGTTTTGCCATGTGG + Intergenic
999210559 5:149884836-149884858 ACCCATGGAGCTTGGCCAGTGGG + Exonic
999287335 5:150402027-150402049 ACAGATGGAGATTGGGCAGCAGG + Intronic
1001769735 5:174284624-174284646 ACAACTGCAGCTTGGCTAAGAGG + Intergenic
1003026212 6:2558045-2558067 ACAGTTGGAGCTGGACTAAGTGG - Intergenic
1003556820 6:7147220-7147242 ACAGACCCAGCTCGGCCAAGTGG - Intronic
1004156916 6:13177713-13177735 TCAAATGGACCTTGTCCAAGTGG - Intronic
1004420301 6:15463615-15463637 AGAGATGGAGTTTCGCCACGTGG + Intronic
1005246317 6:23889624-23889646 ACACAAGGAGTTTGTCCAAGAGG - Intergenic
1006700146 6:35965803-35965825 AGAGATGGAGTTTCGCCATGTGG - Intronic
1007397884 6:41587657-41587679 ACAGATGGTGCTTGGCCGCTGGG + Intronic
1012332177 6:98006150-98006172 ACAAATGGAGCTGGGACAAATGG - Intergenic
1013229041 6:108144742-108144764 ACAAATGGAGCTGGGCACAGTGG + Intronic
1013881403 6:114906137-114906159 ACAAATGGAGGTTAGCAAAGTGG + Intergenic
1017184033 6:151582889-151582911 ACAGTTGGAGGTGGGCCTAGTGG - Intronic
1017786357 6:157760274-157760296 ACAGCTGGAAATTGGCCATGGGG + Intronic
1018298804 6:162377896-162377918 CCAGATGGTTCTTGGGCAAGAGG + Intronic
1019325923 7:438256-438278 ACAGAGGGAGCTTGGGAATGAGG - Intergenic
1021884133 7:25121746-25121768 AGAGATGGAGTTTTGCCATGTGG - Exonic
1023325174 7:39046925-39046947 ACAAATGGTGCTGGGACAAGTGG - Intronic
1023368994 7:39493670-39493692 ACAGAAGGAACCTGACCAAGAGG + Intergenic
1024175998 7:46841746-46841768 AGAGACGGAGCTTGAGCAAGTGG + Intergenic
1029954401 7:104622296-104622318 AGAGATGGAGTTTTGCCATGTGG + Intronic
1031979714 7:128116726-128116748 ACAGAAGGAACTTGCCCAGGTGG - Intergenic
1033591056 7:142808914-142808936 AGAGATGGAGCTAGGGCAGGTGG - Intergenic
1036617628 8:10400775-10400797 ACAGATGGTGCTGGGACAACTGG + Intronic
1038408562 8:27340925-27340947 ACAGACAGGGCTTGGCCAGGCGG + Intronic
1038848041 8:31248005-31248027 ACAGATGGGGCTTGGGAAGGGGG + Intergenic
1039358905 8:36853162-36853184 AGAGATGGAGTTTTGCCATGTGG - Intronic
1039414936 8:37385768-37385790 AGAGAGGGAGCTGGGGCAAGAGG + Intergenic
1039708709 8:40033782-40033804 GGAGATGGATCTTGGCCAGGTGG + Intergenic
1041857695 8:62477165-62477187 ACACATGGAGCTGAGCCAGGTGG + Intronic
1046217056 8:111162342-111162364 ACAAATGGATCTTGGAGAAGGGG + Intergenic
1046373133 8:113337409-113337431 ACAAATGGAACTGGGACAAGTGG + Intronic
1048745496 8:137610418-137610440 ACAGAAGGAGCTGGGCCCTGAGG - Intergenic
1049466089 8:142751905-142751927 CCAGAAGCAGCTTGGCCCAGAGG - Intronic
1049652335 8:143776914-143776936 TCAGAAGGAGCTTGGCTCAGTGG + Intergenic
1050272768 9:3963488-3963510 ACTTTTGGTGCTTGGCCAAGTGG + Intronic
1051813173 9:21073891-21073913 AGAAATAGAGCTTGGCCAAGAGG + Intergenic
1051994081 9:23192958-23192980 ACAAATGGTGCTTGGAAAAGTGG + Intergenic
1052048709 9:23822529-23822551 AGGGATTGAGCTTGGCGAAGGGG - Intronic
1052999677 9:34571072-34571094 TCAGAAGGAGCCAGGCCAAGTGG - Intronic
1053428731 9:38027906-38027928 AGGGATGGAGCTGAGCCAAGAGG + Intronic
1053497820 9:38561169-38561191 ACATTTGCAGCCTGGCCAAGTGG - Intronic
1053665701 9:40316131-40316153 AAATTTGGAGCCTGGCCAAGTGG + Intronic
1054376857 9:64456161-64456183 AAATTTGGAGCCTGGCCAAGTGG + Intergenic
1054518913 9:66060153-66060175 AAATTTGGAGCCTGGCCAAGTGG - Intergenic
1055648338 9:78382219-78382241 ATAGATGGAGCTTTGTCAAATGG + Intergenic
1056394679 9:86170871-86170893 ACAAATGGAGCTGGGACAACTGG - Intergenic
1056394784 9:86172008-86172030 ACAAATGGAGCTGGGACAACTGG - Intergenic
1056506179 9:87260261-87260283 ACATCTGGGGCCTGGCCAAGGGG - Intergenic
1057673771 9:97120456-97120478 AAAGATGGAGATTGGCAGAGTGG + Intergenic
1057677290 9:97145660-97145682 ACATTTGCAGCCTGGCCAAGTGG - Intergenic
1058193726 9:101950021-101950043 CCAGATGTAGCTGTGCCAAGAGG - Intergenic
1059051954 9:110935902-110935924 CCAGATGGAGTTTTGACAAGAGG - Intronic
1059413401 9:114148552-114148574 ACAGACTGAGGGTGGCCAAGAGG - Intergenic
1059668828 9:116474579-116474601 ACAGATGGAGATGGGCATAGGGG + Intronic
1060501042 9:124155643-124155665 ACAGATGGAACTGGGACAACTGG - Intergenic
1061197778 9:129117230-129117252 AGAGATGGGGTTTGGCCATGTGG + Intronic
1062241470 9:135542198-135542220 ACATATGGAGCTGGGTCAGGAGG - Intergenic
1062370384 9:136235761-136235783 ACAGAGGCAGCATGGCCCAGTGG + Intronic
1203472510 Un_GL000220v1:122414-122436 ACGGAGGGAGCTTGGCTGAGTGG + Intergenic
1187254297 X:17628209-17628231 ACAACTGGAGCTCTGCCAAGTGG + Intronic
1189761797 X:44329506-44329528 ACAGATGGTGCTTGAGCAACTGG + Intronic
1190724936 X:53183058-53183080 ACAGATGGTGCTGGGACAACTGG - Intergenic
1192596840 X:72418859-72418881 ACAAATGGTGCTTGGACAACAGG - Intronic
1193436273 X:81478129-81478151 AGAGATGGTGCTTGCCGAAGAGG - Intergenic
1194713511 X:97263872-97263894 ACAGTTGGAGCTGGGCGCAGTGG - Intronic
1195142992 X:101982406-101982428 ACAAATGGTGCTTGGACAACTGG + Intergenic
1195247081 X:103004566-103004588 ACAGATGGAGCATGGGGAATTGG + Intergenic
1195530002 X:105943259-105943281 ACAAATGGTGCTGGGACAAGCGG - Intronic
1195717926 X:107836085-107836107 ACAAATGGTGCTTGGACAACTGG - Intronic
1195907847 X:109863186-109863208 ACAGAAGCAGCTTTTCCAAGAGG - Intergenic
1196901796 X:120390947-120390969 ACAGATGGCGCCTGGACAATAGG - Intergenic
1197711160 X:129669381-129669403 ACAAATGGTGCTGGGACAAGTGG - Intergenic
1198367458 X:135956024-135956046 ACAAATGGTGCTAGGACAAGCGG + Intergenic
1199034744 X:143036498-143036520 ACAAATGGTGCTTGGACAACTGG - Intergenic
1201706122 Y:16939113-16939135 ACAGATGCCTCTTGACCAAGGGG + Intergenic
1202364438 Y:24147545-24147567 AGAGATGGGGCTTCGCCATGCGG - Intergenic
1202506343 Y:25522577-25522599 AGAGATGGGGCTTCGCCATGCGG + Intergenic