ID: 1185057381

View in Genome Browser
Species Human (GRCh38)
Location 22:48588039-48588061
Sequence CACAGATGGAGCTTGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057381_1185057390 2 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057381_1185057394 6 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057381_1185057395 10 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057381_1185057389 -3 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057381_1185057392 4 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057381_1185057391 3 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057381_1185057393 5 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057381_1185057397 17 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057381_1185057398 18 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057381_1185057399 26 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057381 Original CRISPR CACAGATGGAGCTTGGCCAA GGG (reversed) Intronic
900679501 1:3908898-3908920 TACAGATTAAGATTGGCCAAAGG + Intergenic
900833802 1:4984837-4984859 CACAGATGCAGCTTGGGCGAGGG - Intergenic
903180001 1:21600417-21600439 CACAGAGGCAGCTCAGCCAACGG + Intronic
905478563 1:38245839-38245861 CACAGAAGGAGCCATGCCAAAGG + Intergenic
906324435 1:44836010-44836032 GCCAGATGGAGATTGGCCACAGG + Intronic
907277251 1:53323655-53323677 CACAGATGGAGCTTGCGGGATGG - Intronic
908415449 1:63908965-63908987 CACAGGTGAACCTTGGCCAAGGG + Intronic
908792608 1:67798002-67798024 CAAAAATGGAGTTTGGGCAAGGG - Intronic
909149496 1:71983708-71983730 CACAAATAGAGATTGGACAAAGG + Intronic
910037469 1:82805264-82805286 CACAGATGGTACTTCCCCAATGG + Intergenic
910692087 1:89975284-89975306 CTCAGATGGAGCTCTGCCCAAGG - Intergenic
915087820 1:153399982-153400004 CACAGTTGTAGCTTGGCACAGGG - Intergenic
915274962 1:154782181-154782203 CACAGAAGGAGCTTCCTCAAAGG + Intronic
915523376 1:156461768-156461790 CTCAGATGGTGGTTGGCAAAAGG + Intergenic
915850252 1:159314168-159314190 CACAGATGTTACTTGGACAATGG + Exonic
916265068 1:162882394-162882416 GCCAGATGCAGGTTGGCCAATGG - Intergenic
918413767 1:184286868-184286890 CACAGATGGGGCTGGGGCATTGG - Intergenic
918689759 1:187465981-187466003 CACAGAGGCTGCTTGGCCATTGG + Intergenic
920004093 1:202820173-202820195 CACAGAGGGAGCTTAGCTCAAGG + Intergenic
921151858 1:212409132-212409154 CACAGATGGAGGTTGGGGGATGG - Intronic
921690083 1:218138619-218138641 CAGAGATGGGGCTTGGACACTGG - Intergenic
923859709 1:237881267-237881289 CACAGGTGCAGCTTGACAAAGGG - Intronic
1062851407 10:745571-745593 CACACATGGAGCTTGAAAAAGGG + Intergenic
1064704398 10:18056768-18056790 CACAGTTGGTGCTTGACAAATGG - Intergenic
1064784249 10:18876478-18876500 GACAGATGGATCTTGGAGAATGG + Intergenic
1065428938 10:25633905-25633927 CAGAGATGGAACTTAGCTAAAGG - Intergenic
1065858985 10:29854909-29854931 CACAGTTGTAACTTGGCCAAAGG - Intergenic
1067227031 10:44383143-44383165 TACAGAGAGAGCTTGGCCAGGGG - Intronic
1067732260 10:48820745-48820767 CCCAGCTGGAGCCTGGCCCAAGG + Intronic
1073467739 10:103704204-103704226 GACAGAATGGGCTTGGCCAAAGG + Intronic
1073682501 10:105719428-105719450 CACAGATGGAGGTGGGCATAGGG + Intergenic
1075577159 10:123585712-123585734 CACAGATGAGGCTTTGCAAAGGG - Intergenic
1076578274 10:131487586-131487608 GACTGAGGGAGTTTGGCCAAGGG - Intergenic
1077357167 11:2123702-2123724 CCCATATGGAGCATGGCCAGAGG + Intergenic
1077776989 11:5282857-5282879 CAAAGTTGCAGCTTGACCAAGGG + Intronic
1080754420 11:35182483-35182505 CACAAATGGAGTTTGACTAAAGG + Intronic
1081787181 11:45755920-45755942 CAGAGCTGGAGCTTGACCAAGGG - Intergenic
1082262565 11:50088562-50088584 CACAGATGGAATTTGGGCATAGG - Intergenic
1083399483 11:62413899-62413921 CCCAGCTGGAGCCTGGGCAAGGG + Intronic
1083510348 11:63203295-63203317 CACAGAATGAGCTTGACAAATGG + Intronic
1083916591 11:65748955-65748977 AACAAATGGAGCTAGGACAAAGG - Intergenic
1086877371 11:92112611-92112633 CACAGCTGGAGCTTTGCTCATGG + Intergenic
1087127255 11:94640292-94640314 CACACATGGAGCTCAGCAAACGG + Intergenic
1088449248 11:109964468-109964490 GACAGATGGATCTTGGAGAATGG + Intergenic
1091009443 11:131985322-131985344 CACAGATTGCACTTGGGCAATGG - Intronic
1091082468 11:132683794-132683816 CTCAGAGGGACCTTGGGCAAGGG + Intronic
1093337212 12:17920883-17920905 CACAGATGCTGCCTGGCCAAGGG + Intergenic
1096115776 12:49054289-49054311 CACAGGTGGGGCTGGGCCAGGGG - Exonic
1096678172 12:53236796-53236818 CACAGATGTAGTTTGGTCAAAGG - Intergenic
1100194750 12:92231962-92231984 CACAGATTGAGCCTTTCCAAAGG - Intergenic
1100194778 12:92232295-92232317 CACAGATTGAGCCTTTCCAAAGG + Intergenic
1100874909 12:98951646-98951668 CACAGACAGGGCTTGGGCAATGG - Intronic
1101639945 12:106580736-106580758 CGTAGATGGAGCCTGGCCAGGGG - Intronic
1104812896 12:131629040-131629062 CACAAATGGGGCACGGCCAAAGG - Intergenic
1106766873 13:32922180-32922202 CACAGGTGGAGCTTTGGCTAAGG + Intergenic
1106872468 13:34036796-34036818 CACAGACATTGCTTGGCCAATGG + Intergenic
1108509914 13:51147311-51147333 CACGGAGGGAGCTAGGCCACAGG - Intergenic
1108587493 13:51883218-51883240 CACACCTGCAGCTTGGCAAATGG + Intergenic
1113499371 13:110761088-110761110 CAGAGATGGAGCAAGGGCAAGGG - Intergenic
1113682504 13:112254228-112254250 CACAGAGGGAGATCGGCCCAGGG + Intergenic
1114779843 14:25526395-25526417 CTCAGTTGGAGATTGACCAAAGG + Intergenic
1115640804 14:35334509-35334531 CACAGATGGAGAGAGGCCAGAGG + Intergenic
1118762835 14:68890934-68890956 GACAGATGTAGCTTGGCCTGGGG - Intronic
1118917818 14:70122600-70122622 CATGGATGGCGCTTAGCCAAGGG + Intronic
1120901613 14:89580574-89580596 CACAGATGGAGGTTGGGCAGAGG - Intronic
1121505746 14:94475148-94475170 CACACATGGAGCCTTGCCACAGG - Intronic
1121924312 14:97914153-97914175 CAGAGGTTGAGCTTGACCAAAGG - Intergenic
1122121310 14:99554937-99554959 CACAGATGGACATAGGCCCATGG + Intronic
1122417750 14:101558365-101558387 CACAGGTGGAGCTGGGCCTTTGG + Intergenic
1122599697 14:102915141-102915163 CCGAGATGGAGCTGGGCCCACGG - Intergenic
1122799653 14:104223259-104223281 CAGAGCGGGAACTTGGCCAACGG - Intergenic
1124222659 15:27863563-27863585 CTCAGATGGGGCTTGGGCACCGG - Intronic
1125524510 15:40366725-40366747 CACAGATAGAACAGGGCCAAGGG - Intronic
1125558236 15:40604053-40604075 CACAGGTGGGGCTTGGACACAGG - Intronic
1126489952 15:49225813-49225835 CACAGTTGGTGCTGTGCCAAAGG - Intronic
1126962448 15:54012716-54012738 CACAGATGGAGCTTTGCTTCTGG + Intergenic
1128281840 15:66401689-66401711 CACTGTTGGAGCTTGGCCTGAGG + Intronic
1128355731 15:66925180-66925202 CACAGATGGAGCCTGGCCCCAGG + Intergenic
1128677918 15:69625254-69625276 CACAGAGGGGGCTTGGGGAAGGG + Intergenic
1129304984 15:74653504-74653526 CACAGACGCTGCTTGGCAAAAGG + Intronic
1131322693 15:91410381-91410403 CAAAGCTGGAGCTTGGTCATAGG - Intergenic
1133781630 16:8943437-8943459 CACAGATGCAGTTAGGGCAAGGG + Intronic
1133836577 16:9373098-9373120 CACAGCTGGAGTGTGGCCCATGG + Intergenic
1135808968 16:25570056-25570078 CAGAGCTGGAGGTGGGCCAAGGG + Intergenic
1144067541 17:11638240-11638262 CCCACATAAAGCTTGGCCAACGG - Intronic
1145246427 17:21272824-21272846 CCCTGAGGGAGATTGGCCAAGGG + Intergenic
1145752721 17:27366982-27367004 CCAAGATGGAGCCTGGCCTAGGG - Intergenic
1149834150 17:59897222-59897244 CACAGAGTGAGTATGGCCAAAGG - Intronic
1153749680 18:8215973-8215995 CACAGATAGAGCTTAGGCTAGGG - Intronic
1154259302 18:12815819-12815841 CACACAAGGAGCTTGATCAATGG - Intronic
1155865284 18:30957234-30957256 CACAGATGGTGCTTGGATGAAGG + Intergenic
1156494284 18:37515801-37515823 GACAGATGGAGCTTCGCAGAGGG + Intronic
1156914833 18:42453619-42453641 CAGAAATGGAGCTGGGCCAAAGG + Intergenic
1157170831 18:45403586-45403608 CACAGATGGAGCATGGCAACAGG + Intronic
1158717752 18:59895755-59895777 CAGACATTGAGCTAGGCCAAGGG - Intergenic
1160391839 18:78539837-78539859 CACAAATGGAGCCAGGCTAATGG + Intergenic
1163537952 19:17888547-17888569 CACAGTGGCAGTTTGGCCAATGG - Intronic
1165116344 19:33531259-33531281 CTGAGATGAAGCTTGGCCACTGG + Intergenic
926675829 2:15619118-15619140 CTGAGATGGAGCTGGGCCCAGGG - Intronic
930172881 2:48269114-48269136 CACAGATTCTGCTTGGCCCAGGG - Intergenic
933373095 2:81442182-81442204 CACATATTGTGCTTTGCCAAGGG + Intergenic
936953155 2:117998516-117998538 CAAAAATGGAGATTGGCCTAGGG - Intronic
937035952 2:118782069-118782091 CACAGATGAATTTTGGGCAAGGG - Intergenic
937154300 2:119707835-119707857 TGGAGATGGGGCTTGGCCAACGG + Intergenic
940156287 2:150660315-150660337 CACAGATGGAGCTAGAGCAGTGG + Intergenic
944951367 2:204753565-204753587 CACAGCTGGAACTAGGCCATGGG - Intronic
945923835 2:215783281-215783303 CCCAGAGGTAGCATGGCCAAGGG - Intergenic
946683150 2:222239196-222239218 CACAGATGGAGCGTGGAAATCGG - Intronic
947461039 2:230305618-230305640 CCAAGATGGAGCTGGGCCAGTGG + Intronic
948635569 2:239333189-239333211 CACAGATTGTACTTGGCCCATGG - Intronic
1169507447 20:6227169-6227191 CACACATGGAGACTGGCCATTGG - Intergenic
1171032973 20:21693373-21693395 CTCAGACGGACCTTGACCAATGG - Intergenic
1172458583 20:35097060-35097082 CAAAGAAAGTGCTTGGCCAATGG - Intergenic
1176660805 21:9633749-9633771 CACAGATCGGGCCTGGCCCATGG - Intergenic
1178140840 21:29681548-29681570 CACAGATGAGGCTTGAGCAAAGG - Intronic
1178460132 21:32795528-32795550 CACCCATGGAGCTTAGCAAATGG - Intronic
1179027832 21:37694497-37694519 CACACATGTAGCTTGATCAATGG - Intronic
1181116443 22:20635033-20635055 CAAGGTTGGAGCTTGGCCCAGGG + Intergenic
1184516768 22:44966955-44966977 CACACAGGGGACTTGGCCAATGG - Intronic
1184603673 22:45559287-45559309 GACAGATGGATCTTGGTGAACGG - Intronic
1185019899 22:48367940-48367962 TACAGCTGGAGCCTGGCCCAAGG - Intergenic
1185057381 22:48588039-48588061 CACAGATGGAGCTTGGCCAAGGG - Intronic
950354912 3:12399091-12399113 CACAGATGGGGCTGGGGGAAAGG - Intronic
950447772 3:13048044-13048066 CACAGACCGAACTTGGTCAAAGG - Intronic
950482273 3:13251623-13251645 CAGAGCTGGAGCCTGGCCAAGGG + Intergenic
950859441 3:16134723-16134745 CACAGAATGAGCTTGGCTACAGG + Intergenic
951205915 3:19925861-19925883 AACAGAGGGATCTTGACCAAGGG - Intronic
952759788 3:36903744-36903766 CACAGCTGGAAGATGGCCAAAGG + Intronic
953743275 3:45554951-45554973 CACAGATTGAGCTTGACAGATGG + Intergenic
954355267 3:50079711-50079733 CTCAGATGTAGTTTGGCCCATGG + Intronic
955559947 3:60178210-60178232 AAAAGATGGGGCTTGGCCATAGG - Intronic
956729951 3:72187369-72187391 CACAGATGGACTTTGTCCAGGGG - Intergenic
962457332 3:135576829-135576851 TACAGAGGGAGCTTGACTAATGG - Intergenic
962748912 3:138418368-138418390 CACAGATGGAGCTTATTAAAAGG + Intergenic
963548773 3:146695223-146695245 GAAAGATGGATCTTGGACAATGG - Intergenic
969565594 4:7975516-7975538 CACTGATGGGGCATGGCCAAGGG - Intronic
970993275 4:22237162-22237184 CACAAAGGGAGAATGGCCAAAGG + Intergenic
972262763 4:37427143-37427165 TACAGATGGAGTTTGGTCATTGG - Intronic
972631362 4:40844602-40844624 CACAGAGGGACCTGAGCCAAGGG - Intronic
973084798 4:46044575-46044597 AACAGATGGAAATAGGCCAATGG + Intronic
973100567 4:46263455-46263477 CACACATGGTGCTGGGACAATGG - Intronic
973643369 4:52925756-52925778 CACAGACTGTGCTTGGCTAAAGG - Intronic
976883517 4:89959922-89959944 AACAGATACATCTTGGCCAAGGG + Intergenic
977204585 4:94154706-94154728 GACAGATGGATCTTGGAAAATGG + Intergenic
978525820 4:109664004-109664026 CACAGATGCAGTTTCACCAAGGG + Intronic
983027279 4:162754405-162754427 GACAGATGGATCTTGGAGAATGG + Intergenic
985414558 4:189722667-189722689 CACAGATCGGGCCTGGCCCATGG + Intergenic
985590378 5:761460-761482 CACAGCAGAAGCTGGGCCAATGG + Intronic
988267601 5:28972263-28972285 GACAGATGGATCTTGGAGAATGG - Intergenic
990615974 5:57508754-57508776 CAGAGGTGGAGCTTGGACACTGG + Intergenic
992371762 5:76151174-76151196 CAGAGATGGAGCTGGGTAAATGG + Intronic
992376057 5:76188852-76188874 CTCTGATGGAGTCTGGCCAAGGG + Intronic
992653881 5:78889038-78889060 CACAGATGGCACCTGGCCGATGG + Intronic
994984527 5:106916628-106916650 GACAGATGGATCTTGGAGAAGGG - Intergenic
997415268 5:133723386-133723408 CACAGCGGGAGCTTGGCCTTTGG + Intergenic
998167584 5:139852950-139852972 CAGAACCGGAGCTTGGCCAATGG - Exonic
998819968 5:146049286-146049308 CACAGATGGCCCCTGGCCTAGGG - Intronic
999210558 5:149884835-149884857 GACCCATGGAGCTTGGCCAGTGG + Exonic
999690286 5:154140539-154140561 CAGAGATGGAGCTAGGATAATGG - Intronic
1001330822 5:170761177-170761199 TACAGATGGAGCCTGGTCATTGG + Intergenic
1004173022 6:13313568-13313590 CACACAGGGAGCCTGGACAAGGG + Intronic
1005565611 6:27090538-27090560 CATAGATGGAGCTGGGACATAGG - Intergenic
1006258374 6:32848928-32848950 CACAGATGGTGCTGGGCCAGAGG + Intronic
1006674410 6:35751935-35751957 CACACATGGAGCTGGTCGAAAGG - Intergenic
1007164802 6:39821708-39821730 CATAGCTGGAGCCTGGCCCAAGG + Intronic
1007397883 6:41587656-41587678 TACAGATGGTGCTTGGCCGCTGG + Intronic
1007474957 6:42113375-42113397 CACAGGAGGAGCCTGGACAATGG - Intronic
1013330399 6:109094881-109094903 CACCGATGGGGCTGGGCGAAGGG - Intergenic
1021769606 7:23985168-23985190 CACAGATGGGGCTTCTCCCATGG + Intergenic
1024958365 7:54949978-54950000 GACAGATGGATCTTGGAGAATGG - Intergenic
1027420811 7:78016017-78016039 CTCAGATGGGGACTGGCCAAAGG - Intergenic
1029593891 7:101526459-101526481 CACAGAGGGAGCTGGGCCTCTGG + Intronic
1031010770 7:116524529-116524551 CAGAGATGGAACTTGGGCGATGG + Intergenic
1033610592 7:142960568-142960590 CAAAGATGGAGCTTGCTAAAAGG + Intronic
1035773820 8:2171823-2171845 CAGAGGTGGGGCTTGGACAATGG - Intergenic
1037364701 8:18109154-18109176 GACAGATGGATCTTGGAAAATGG - Intergenic
1037644817 8:20783655-20783677 CATAGGTGGTGCTTGGCCAGTGG - Intergenic
1039330511 8:36532002-36532024 GACAGATGGATCTTGGGGAATGG + Intergenic
1041393428 8:57368137-57368159 CAAGGATGGAGCCTGGCCAAAGG + Intergenic
1044096818 8:88076958-88076980 CACATATGGAGCCGGGCCAGTGG + Intronic
1045494791 8:102699281-102699303 CACTGAGGGAGCCTGGCCAGAGG + Intergenic
1047320086 8:123770922-123770944 CTCAGATGGAGCTCGGCCTAGGG - Intronic
1049442092 8:142614254-142614276 CACAGATGGAGCTGGACCACCGG - Exonic
1050703956 9:8374224-8374246 TTCAGATAGAGTTTGGCCAAAGG - Intronic
1053222580 9:36324589-36324611 CCCCGATGGAGCATGACCAATGG - Intergenic
1059668827 9:116474578-116474600 CACAGATGGAGATGGGCATAGGG + Intronic
1060178767 9:121517227-121517249 CACCTATAGAGGTTGGCCAAAGG - Intergenic
1060696208 9:125711140-125711162 CACTGATGGTGCTGGGCCAGGGG + Intergenic
1203638373 Un_KI270750v1:135593-135615 CACAGATCGGGCCTGGCCCATGG - Intergenic
1188870538 X:35365587-35365609 CACAGTTGGAGCTTCTCCCATGG + Intergenic
1189397819 X:40639292-40639314 CACAGCTAAACCTTGGCCAAGGG + Intronic
1192926238 X:75758230-75758252 CAAAGATGGAGGTTGGCCCCTGG - Intergenic
1194914477 X:99688390-99688412 CACAGATGGAGCTTGCAGGACGG - Intergenic
1195742918 X:108083513-108083535 TACAGATGGAGCTAAGCCACAGG - Intergenic
1196708465 X:118738168-118738190 CACAGTTGGACCTTGGGAAAAGG + Intronic
1197173614 X:123461772-123461794 CAACGATGGAGCCTGACCAAGGG + Intronic