ID: 1185057382

View in Genome Browser
Species Human (GRCh38)
Location 22:48588040-48588062
Sequence GCACAGATGGAGCTTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 255}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057382_1185057392 3 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057382_1185057399 25 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057382_1185057394 5 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057382_1185057390 1 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057382_1185057389 -4 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057382_1185057391 2 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057382_1185057397 16 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057382_1185057398 17 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057382_1185057395 9 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057382_1185057393 4 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057382 Original CRISPR GCACAGATGGAGCTTGGCCA AGG (reversed) Intronic
900181846 1:1314585-1314607 AGACAGAAGGAGCCTGGCCAGGG + Intronic
900797912 1:4720487-4720509 GCTCAGATGGACCCAGGCCATGG + Intronic
900833803 1:4984838-4984860 TCACAGATGCAGCTTGGGCGAGG - Intergenic
901737915 1:11323968-11323990 GCACAGCTGGGGCTGGGTCAGGG + Intergenic
901882666 1:12203319-12203341 GCCCAGAGGGAGCCTGGCCCTGG - Intronic
902170308 1:14604804-14604826 GCTCAGATGGAGCTTGGAACAGG + Intronic
902873604 1:19328353-19328375 AGACAGATGGAGCTTGGCTAGGG + Intronic
904314361 1:29650710-29650732 GCACAGATGGACACAGGCCAGGG - Intergenic
904485458 1:30822061-30822083 GGCCAGAAGGAGCTGGGCCAAGG - Intergenic
905296323 1:36956576-36956598 GCAAGGATTCAGCTTGGCCATGG - Intronic
908415448 1:63908964-63908986 CCACAGGTGAACCTTGGCCAAGG + Intronic
908792609 1:67798003-67798025 GCAAAAATGGAGTTTGGGCAAGG - Intronic
910448603 1:87325028-87325050 GTAGAGATGGAGTTTTGCCATGG + Intergenic
910657766 1:89634900-89634922 GCAAAGATGGATATTTGCCATGG + Intronic
911071092 1:93832389-93832411 GCACAGATGGAACATGGCTTAGG - Intronic
912528104 1:110299797-110299819 GCAGTGAAGGAGCTTAGCCATGG + Intergenic
913373333 1:118124967-118124989 GCTAAGATGGGGATTGGCCATGG - Intronic
916627426 1:166573212-166573234 ACAAGGATGAAGCTTGGCCAGGG + Intergenic
919464568 1:197913338-197913360 GCGCAGCTGGAGCGTGGCCTCGG + Intronic
919834299 1:201563199-201563221 GCACAGGGGGAGCGTGACCAGGG - Intergenic
922280173 1:224115351-224115373 GCACAGATTTAGCTTCTCCATGG - Intronic
922999180 1:229992032-229992054 GCACAGGTGGTGCCTGGCCCTGG + Intergenic
923859710 1:237881268-237881290 GCACAGGTGCAGCTTGACAAAGG - Intronic
924000737 1:239549057-239549079 GCACAGAGAGAGCTTGTGCAGGG + Intronic
1062851406 10:745570-745592 GCACACATGGAGCTTGAAAAAGG + Intergenic
1062981218 10:1724593-1724615 GCACAGTGGGACCCTGGCCATGG - Intronic
1063129989 10:3169964-3169986 ACACAGCAGGAGCTGGGCCAGGG + Intronic
1063848741 10:10161161-10161183 ACACAGGTGGGGCTTGGGCATGG - Intergenic
1063968245 10:11363372-11363394 GCACAGGTAGAGCGTGACCAGGG + Intergenic
1064184249 10:13147070-13147092 GTAGAGATGGAGTTTCGCCATGG + Intergenic
1064464482 10:15565771-15565793 GCAGAGATGGGGTTTTGCCATGG + Intronic
1067227032 10:44383144-44383166 CTACAGAGAGAGCTTGGCCAGGG - Intronic
1069213472 10:65790809-65790831 GCAAAGAGAGAGCTTGGGCAAGG - Intergenic
1069829317 10:71272766-71272788 GCTCAGATGGTGCCAGGCCAAGG + Intronic
1071505203 10:86227832-86227854 GCACAGATGAGGCATGGCCTAGG - Intronic
1072190365 10:93072934-93072956 GTACAGATGGAGCCGGGCCTCGG + Intergenic
1072238575 10:93474173-93474195 GCACAGATGGAGCTCATCCCAGG - Intronic
1072708009 10:97696053-97696075 GCATAGATGGAGGCTGCCCAGGG + Intergenic
1073201072 10:101736318-101736340 GTAGAGATGGAGTTTTGCCACGG - Intergenic
1076533392 10:131160337-131160359 GCACAGAGGAAGGATGGCCAAGG - Intronic
1076578275 10:131487587-131487609 GGACTGAGGGAGTTTGGCCAAGG - Intergenic
1076767446 10:132644324-132644346 GCACAGACGGAGCCTGTGCACGG + Intronic
1076801975 10:132835129-132835151 CCCCACATGGAGCTTGGCCTGGG + Intronic
1077076268 11:703594-703616 ACACAGGTGGGGCCTGGCCACGG - Intronic
1077483669 11:2828475-2828497 GGACAGATGGAGACTGGCCTAGG + Intronic
1077553671 11:3215628-3215650 GCCCAGATGGAGCTTCGCTCCGG - Intergenic
1078299479 11:10112401-10112423 GCAAAGAGGGAGCTTGTGCAAGG - Intronic
1079012042 11:16836544-16836566 ACAGAGATGGAGCTTTTCCAAGG + Intronic
1079311714 11:19372452-19372474 CTTCAGATGGAGCTTGGCCTGGG + Intronic
1081787182 11:45755921-45755943 GCAGAGCTGGAGCTTGACCAAGG - Intergenic
1084454166 11:69257827-69257849 GCCCAGACAAAGCTTGGCCAAGG - Intergenic
1085588353 11:77732670-77732692 GCAAAGAAGGAGCTTGTGCAGGG - Intronic
1085627305 11:78083305-78083327 GCACAGATGGAACATGGCTTGGG - Intergenic
1085837937 11:79976231-79976253 ACACAGATGGAGATGGGTCAAGG + Intergenic
1086451149 11:86918222-86918244 GCAGAGATGAAGCTTGGGCAGGG + Intronic
1088988067 11:114927385-114927407 GCACTGAGGTAGCATGGCCATGG + Intergenic
1093337211 12:17920882-17920904 GCACAGATGCTGCCTGGCCAAGG + Intergenic
1094699920 12:32859637-32859659 GCACAGATGGGGTTTCACCATGG + Intronic
1095574701 12:43722994-43723016 GCAAGGATGGAGTTTAGCCATGG - Intergenic
1096115777 12:49054290-49054312 TCACAGGTGGGGCTGGGCCAGGG - Exonic
1101308558 12:103555310-103555332 GCAGAGAGGGAGCTTGTGCAGGG + Intergenic
1101462085 12:104906375-104906397 GTGTAGATGGAGCTTGGACATGG + Intronic
1101639946 12:106580737-106580759 GCGTAGATGGAGCCTGGCCAGGG - Intronic
1102028153 12:109725157-109725179 GCTGGGAAGGAGCTTGGCCAAGG + Intronic
1106041158 13:26095147-26095169 CTACAGATGTAGCCTGGCCAGGG + Intergenic
1106485377 13:30167678-30167700 GCAAAGAGAGAGCTTGGGCAGGG - Intergenic
1106657111 13:31758202-31758224 ACACGGAGAGAGCTTGGCCATGG + Intronic
1108203657 13:48066724-48066746 GCACAGAGGGAACCTGCCCAGGG + Intronic
1108931940 13:55835953-55835975 GCAAAGAGGGAGCTTGTGCAGGG - Intergenic
1112422873 13:99268853-99268875 GTGGAGATGGAGATTGGCCATGG + Intronic
1113499372 13:110761089-110761111 GCAGAGATGGAGCAAGGGCAAGG - Intergenic
1113577105 13:111402616-111402638 GTCCAGATGGAGCGTGCCCAGGG + Intergenic
1113736226 13:112680526-112680548 GAAGAGATGGACCTGGGCCAGGG + Intronic
1117404413 14:55387850-55387872 GTAGAGATGGAGTTTGACCATGG + Intronic
1118762836 14:68890935-68890957 GGACAGATGTAGCTTGGCCTGGG - Intronic
1118917817 14:70122599-70122621 GCATGGATGGCGCTTAGCCAAGG + Intronic
1119407933 14:74410404-74410426 GCACAGATGGAGGTGTGCGATGG + Intronic
1121841763 14:97140325-97140347 GCAGTGACGGGGCTTGGCCAAGG + Intergenic
1122757979 14:103997644-103997666 GCACAGAGGGAGGGTGGCCCCGG + Intronic
1125336395 15:38630685-38630707 GCACTGTTGGCCCTTGGCCAGGG - Intergenic
1126000793 15:44207711-44207733 GCCCAGATGGAGCTTGCTCCTGG + Intergenic
1127285353 15:57528071-57528093 GTACAGATGGAGCTTCACCATGG - Intronic
1128553421 15:68613765-68613787 ACACAGTAGGAGCTTTGCCAAGG - Intronic
1129742213 15:77994749-77994771 CCACACCTGCAGCTTGGCCATGG + Intronic
1129843269 15:78756731-78756753 CCACACCTGCAGCTTGGCCATGG - Intergenic
1131191217 15:90318386-90318408 GTAGAGATGGAGTTTCGCCATGG - Intergenic
1131222536 15:90597090-90597112 GCACAGCTGCAGCTGGGCCCTGG + Intronic
1132192044 15:99873345-99873367 CCACAGAAGGAGCTTGCCCTTGG - Intergenic
1133781629 16:8943436-8943458 GCACAGATGCAGTTAGGGCAAGG + Intronic
1135740245 16:24969147-24969169 GCAGAAAGGGAGCCTGGCCAAGG - Intronic
1137000671 16:35227523-35227545 TCACAGATGGATTCTGGCCAGGG + Intergenic
1137570106 16:49559667-49559689 CAAAAGATGGAGCTTGGCGAAGG - Intronic
1137587061 16:49670000-49670022 GGACAGATGGGGCTTGCCCTTGG - Intronic
1138416859 16:56876565-56876587 CCACAGAGGGCACTTGGCCAAGG + Intronic
1140607232 16:76553529-76553551 TCACAGACGTAGCTTGTCCATGG + Intronic
1141192582 16:81835131-81835153 GCAGACAAGGAGCTTGTCCAAGG - Intronic
1141624987 16:85256535-85256557 GCCCAGTGGGAGCTTCGCCAAGG - Intergenic
1141676153 16:85518459-85518481 GCGCAGAAGTAACTTGGCCAAGG + Intergenic
1142486482 17:250825-250847 GCAGTGATGGAGCTTGGTAAAGG - Intronic
1143978634 17:10848616-10848638 CCACAGAAGGAACTTGGCCAAGG + Intergenic
1144779609 17:17801212-17801234 ATCCAGATGGAGCCTGGCCATGG + Intronic
1145242074 17:21245895-21245917 CCACAGCTGGGCCTTGGCCAGGG - Intronic
1147326402 17:39671767-39671789 GCACACAGGCAGCCTGGCCATGG + Exonic
1148090128 17:45018503-45018525 TCCCTGATGGAGCTTGACCAGGG + Intergenic
1148772007 17:50072726-50072748 GCAGGGATGGAGCAAGGCCAGGG + Intronic
1151666612 17:75549012-75549034 GCACAGCTGGAGCTTATCCGGGG + Intronic
1152779109 17:82218588-82218610 GTGCAGGTGGAGCTTGGTCAGGG + Intergenic
1153026845 18:680204-680226 GCACAGGCGGGGCTTGCCCAAGG - Intronic
1154027842 18:10724816-10724838 TCACAGATGCACCTGGGCCACGG + Intronic
1155251584 18:23958152-23958174 GCAGAACTGGAGCTGGGCCACGG + Intergenic
1156494283 18:37515800-37515822 GGACAGATGGAGCTTCGCAGAGG + Intronic
1159266447 18:66086819-66086841 GCACAGATGAAGCGTGAGCATGG + Intergenic
1159328063 18:66949567-66949589 GACCAGACGGAGTTTGGCCAGGG - Intergenic
1160305067 18:77725191-77725213 GCAAAGAGGGAGCTTGTGCAGGG - Intergenic
1160612676 18:80100751-80100773 GTAAAGATGGAACATGGCCAGGG + Intergenic
1160824727 19:1074339-1074361 GCAGAGATGGAGTTTGCCAAGGG + Exonic
1160847484 19:1173055-1173077 GCACGGATGGTGCTGGGGCAGGG - Intronic
1161555448 19:4939660-4939682 GCACAGGTGGCTCTTGGCTATGG - Intronic
1162523448 19:11194821-11194843 GAACAGCTGGAGCCTGTCCAGGG - Intronic
1163407301 19:17130875-17130897 GCACAGATGGGACTGGGACAAGG - Intronic
1163505900 19:17705927-17705949 GTAGAGATGGAGTTTTGCCATGG - Intergenic
1163674348 19:18647932-18647954 GGACAGATGGACCCTGCCCATGG + Intronic
1164720983 19:30431347-30431369 TAACAGATGGAGGCTGGCCAGGG - Intronic
1166459042 19:42969760-42969782 TCACAGATGGATCTTGTACATGG - Intronic
1166475985 19:43125036-43125058 TCACAGATGGATCTTGTACATGG - Intronic
1166863814 19:45824319-45824341 GCAGAGGTGGAGCCTGGCCCTGG - Intronic
1167124462 19:47539704-47539726 ACACATAGGGAGCATGGCCATGG - Exonic
1167670711 19:50851694-50851716 GCTCAGATTGTGCTTGCCCAGGG - Intergenic
925022138 2:579576-579598 GCTCACAAGGAGCTTGGCCTGGG + Intergenic
926690043 2:15726742-15726764 GCACAGATGAAGGGTGGCCATGG + Intronic
927684785 2:25162785-25162807 GCAGAGATGGAGCTGGGGTAGGG - Intronic
928877698 2:36060127-36060149 CCAGAGATGGTGCTTGGCCCTGG - Intergenic
928970049 2:37018655-37018677 GGTCACATGAAGCTTGGCCATGG + Intronic
929484678 2:42342855-42342877 GCCCAGATGCTGCTTGCCCAGGG - Intronic
929637486 2:43539239-43539261 GCACAGATCTAGCTTTGCCAGGG + Intronic
930002231 2:46869216-46869238 GCACACAGGGAGCTTGGCCTAGG - Intergenic
930143829 2:47981033-47981055 GTAGAGATGGGGCTTTGCCATGG + Intergenic
930172882 2:48269115-48269137 GCACAGATTCTGCTTGGCCCAGG - Intergenic
932635132 2:73381346-73381368 GTAGAGATGGAGTTTCGCCATGG - Intergenic
933095884 2:78180010-78180032 GCAAAGAGAGAGATTGGCCAGGG + Intergenic
933373094 2:81442181-81442203 GCACATATTGTGCTTTGCCAAGG + Intergenic
934768924 2:96895724-96895746 GCACAGAAGCAGGGTGGCCATGG + Intronic
936432443 2:112476353-112476375 TTACAGATGGAGCTGGGTCAAGG - Intergenic
936953156 2:117998517-117998539 GCAAAAATGGAGATTGGCCTAGG - Intronic
937035953 2:118782070-118782092 GCACAGATGAATTTTGGGCAAGG - Intergenic
937299453 2:120830280-120830302 GGGCAGAGGGAGCTAGGCCAAGG - Intronic
937303713 2:120858422-120858444 GCATAGATGAAGCTTGGCTCTGG + Intronic
938122101 2:128641282-128641304 AAACAGATGGAGGTTTGCCAAGG + Intergenic
938262463 2:129905628-129905650 GCAGAGATGGACTTTGGCCTCGG - Intergenic
941660677 2:168192602-168192624 GCACACAGGCAGCTTGCCCAAGG - Intronic
942457462 2:176147963-176147985 GCACAGGTGCAGCTCCGCCAAGG + Intergenic
943849405 2:192698243-192698265 GCATAGATAGAGCTTGTGCACGG + Intergenic
944951368 2:204753566-204753588 ACACAGCTGGAACTAGGCCATGG - Intronic
947538755 2:230959554-230959576 GCAGAGAAGCAGCTTGCCCAAGG + Intronic
948881221 2:240858151-240858173 TCAAATATGGAGCTTTGCCATGG - Intergenic
1169651598 20:7874372-7874394 GCAAAGAGGGAGATTGGGCAGGG - Intergenic
1170884591 20:20329232-20329254 GCACAGATGGAGCTGGATAAGGG - Intronic
1170939782 20:20839375-20839397 GCACAGATAGAGCTTGGGATGGG + Intergenic
1171944295 20:31362673-31362695 GTAGAGATGGAGGTTGCCCAGGG - Intergenic
1172311388 20:33921016-33921038 GTATAGATGGGGCTTTGCCATGG + Intergenic
1172435464 20:34926036-34926058 GTACAGATGGAGCATGGGCTGGG + Intronic
1174051954 20:47773092-47773114 GCCCCGCTGGAGCTTGGCCTGGG + Intronic
1176150979 20:63590522-63590544 GCCCAGCTGGCGCTTGGCCCGGG - Exonic
1177079598 21:16621907-16621929 GCAAAGAGAGAGCTTGTCCAGGG + Intergenic
1180078470 21:45475281-45475303 GCTCAGATGGTGCCTGGGCAGGG + Intronic
1180255443 21:46624337-46624359 GGACAGAGCGAGCTCGGCCAGGG - Intergenic
1182158274 22:28096686-28096708 GCAGAGATGGAGCAGGGCTAAGG - Intronic
1183284553 22:36953756-36953778 GCACAGGTGGATGCTGGCCATGG + Intergenic
1183473327 22:38021290-38021312 GTAGAGAGGGAACTTGGCCATGG + Intronic
1183922609 22:41181470-41181492 GCACAGATGTAGCTGCTCCATGG - Intergenic
1184828838 22:46971292-46971314 GCACAGATGCAGCTGGGCTGTGG - Intronic
1184976872 22:48068528-48068550 GCACACACTGAGCTTGGCCGGGG - Intergenic
1185057382 22:48588040-48588062 GCACAGATGGAGCTTGGCCAAGG - Intronic
950099276 3:10347191-10347213 GCACAGATTGGGGGTGGCCAGGG - Intronic
950196211 3:11011026-11011048 GGACAGAGGGAGATTGTCCAAGG + Intronic
950306173 3:11916562-11916584 TCAGAGCTGGAGCCTGGCCAAGG - Intergenic
950482272 3:13251622-13251644 TCAGAGCTGGAGCCTGGCCAAGG + Intergenic
950646781 3:14382085-14382107 GCACAGAGGGAGCAAGGACAAGG + Intergenic
950941375 3:16896375-16896397 GCACAAAAGGAGCTGGGCCTGGG + Intronic
951817258 3:26768102-26768124 GCACAGATGGTGTGTGGGCATGG - Intergenic
953868707 3:46607493-46607515 GTAGAGATGGAGTTTTGCCATGG + Intronic
956462431 3:69485369-69485391 GCACAGCTGGAGCTGCACCAGGG + Intronic
956729952 3:72187370-72187392 CCACAGATGGACTTTGTCCAGGG - Intergenic
957923013 3:86771922-86771944 GCACTGTTGCAGCCTGGCCAGGG + Intergenic
958042742 3:88245632-88245654 GCAAAGAGGGAGCTTGTTCAGGG - Intergenic
958465258 3:94449418-94449440 TCAAAGATGGAGCTTGAGCAGGG + Intergenic
961645841 3:128392407-128392429 GCACAGACGGGGCCTGCCCAGGG + Intronic
963606981 3:147420469-147420491 GCACAGATGGAACTGGCCCTGGG - Intronic
965761250 3:172079348-172079370 CCAAAGATGGAGTTTGGCCTTGG + Intronic
968446221 4:653671-653693 GCTCAGATGAAACCTGGCCACGG + Intronic
969565595 4:7975517-7975539 TCACTGATGGGGCATGGCCAAGG - Intronic
972631363 4:40844603-40844625 GCACAGAGGGACCTGAGCCAAGG - Intronic
973137944 4:46730280-46730302 GCAGAAATGGAGGTTGGGCACGG + Intergenic
974160987 4:58138946-58138968 GGACAGATGGAGCTTGTCTAAGG - Intergenic
976883516 4:89959921-89959943 GAACAGATACATCTTGGCCAAGG + Intergenic
977070429 4:92377747-92377769 GCACAGAGAGAGCTTGTGCAAGG + Intronic
977180905 4:93872529-93872551 GCACAGAAGGAGGTGAGCCACGG - Intergenic
977594327 4:98862192-98862214 GCTCATGTGGAGCTTGGGCAAGG + Intergenic
978907091 4:114018325-114018347 GCACAGATGGTTCTGGGCCATGG + Intergenic
979448531 4:120840939-120840961 GCACAGCTGGAGGTGAGCCATGG - Intronic
981288875 4:143050999-143051021 GCACAGATGGGGTGTTGCCATGG - Intergenic
981964586 4:150584049-150584071 GCAGACCTGGAGGTTGGCCAGGG + Exonic
984244954 4:177263960-177263982 GGCCAGATGGAGTTTTGCCAGGG - Intergenic
985707763 5:1411300-1411322 GGACAGAGGGAGCGTGGCGATGG + Exonic
986174694 5:5341769-5341791 TCACAGAGGGAGCTCAGCCAGGG - Intergenic
986197854 5:5554430-5554452 GCAAAGAGGGAGCTTGTGCAGGG + Intergenic
986267155 5:6200704-6200726 GCAAAGAGGGAGCTTGTGCAGGG - Intergenic
986287150 5:6367718-6367740 ATTCAGATGGAGCTTGGACAAGG + Intergenic
989472491 5:41836564-41836586 CCACAGATGGGGGTTGGGCAGGG + Intronic
994324893 5:98436893-98436915 GCACAGATGGAACTTGGCTTAGG - Intergenic
995241806 5:109893481-109893503 GCAAAGAGGGAGCTTGTGCAGGG + Intergenic
997126053 5:131228021-131228043 GTAGAGATGGAGTTTCGCCAAGG - Intergenic
999442230 5:151611405-151611427 GCATCTCTGGAGCTTGGCCAGGG - Intergenic
1001330760 5:170760759-170760781 GCACAGATGGACCTAGGAGAAGG - Intergenic
1001949282 5:175804931-175804953 GTATAGAAAGAGCTTGGCCAGGG - Intronic
1002130167 5:177076359-177076381 GCACAGATGGACCTAGGAGAAGG - Intronic
1002439262 5:179255916-179255938 GCACAGATGCTGCTGGGCCTAGG + Intronic
1003946875 6:11084145-11084167 GGAGTGATGCAGCTTGGCCAAGG + Intergenic
1004147056 6:13077700-13077722 GAACAGGGGGAGCCTGGCCAGGG + Intronic
1004575238 6:16888283-16888305 GCACAGATGGGACTTGGCTTAGG - Intergenic
1005214959 6:23515139-23515161 GCACAGATGGACCTAGGAGAAGG - Intergenic
1006743767 6:36326954-36326976 GGACAGGTGGAGCTTGGCAGAGG + Intronic
1007658829 6:43469638-43469660 GGAAAGAGGGAGCTGGGCCAGGG + Intergenic
1009184880 6:60563478-60563500 GCAGAGATGGAGGTTGTGCATGG + Intergenic
1009563564 6:65279003-65279025 GTAGAGATGGAGTTTAGCCATGG - Intronic
1011383804 6:86771919-86771941 GCACAGATGCAGGCTGGGCACGG + Intergenic
1017339314 6:153302194-153302216 GATGAGATGGAGTTTGGCCAGGG - Intergenic
1019811897 7:3171048-3171070 GGACAGAAGGAGCAAGGCCAGGG + Intronic
1020026493 7:4903578-4903600 GCCCAGACAGAGCTTGGCTAGGG - Intergenic
1023494079 7:40776039-40776061 GCTCAGCAGGAACTTGGCCAAGG - Intronic
1023565049 7:41515848-41515870 GCAAAGAAGGAGCTTGTGCAGGG - Intergenic
1023880938 7:44321050-44321072 GAAGAGAGGCAGCTTGGCCAAGG + Intronic
1029107186 7:98187786-98187808 GTAGAGATGGAGTTTTGCCATGG + Intronic
1029155040 7:98511283-98511305 GCACATGTGGAGCTTGGTCTGGG + Intergenic
1029890032 7:103918539-103918561 GCCTTGATGGAGTTTGGCCATGG - Intronic
1031836387 7:126685598-126685620 GCACTGTTGCAGTTTGGCCAGGG + Intronic
1034440832 7:151085405-151085427 GAAAAGATCCAGCTTGGCCAGGG + Intergenic
1035353248 7:158261290-158261312 GGCCACATGGAGCTTGGACAGGG + Intronic
1036786833 8:11693280-11693302 GTAGAGATGGAGTTTCGCCATGG - Intronic
1037090001 8:14902207-14902229 GCAGAGAAGGAGCTTGACAAGGG - Intronic
1039043891 8:33433048-33433070 GTAGAGATGGAGTTTTGCCATGG - Intronic
1039514177 8:38117872-38117894 GTAGAGATGGGGCTTTGCCATGG - Intronic
1039727224 8:40231716-40231738 GCATACTTGGAGCTTGGTCAGGG - Intergenic
1040412266 8:47166729-47166751 GTAGAGATGGAGTTTTGCCATGG - Intergenic
1040597948 8:48858427-48858449 GCACACATGAAGCCTTGCCAGGG + Intergenic
1040891456 8:52321244-52321266 GCACAGAGGAAGCTGGGCCTAGG + Intronic
1041007498 8:53509446-53509468 GAACAAATGCAGCTTGTCCAAGG + Intergenic
1043731472 8:83688959-83688981 GCATGGATGGAGCTTGCCCCTGG - Intergenic
1043993009 8:86779648-86779670 GCACAGAGAGAGCTTGTGCAAGG - Intergenic
1044803091 8:95977104-95977126 GAAAAGATGGGACTTGGCCATGG + Intergenic
1047320087 8:123770923-123770945 TCTCAGATGGAGCTCGGCCTAGG - Intronic
1049232304 8:141490743-141490765 GGACAGTGGGGGCTTGGCCAGGG - Intergenic
1049473815 8:142787819-142787841 GCACAGATGGAGGTCAGCCCTGG + Intergenic
1050243392 9:3661122-3661144 TCACAGTTGGAGCTCAGCCATGG + Intergenic
1054878367 9:70120230-70120252 GCAGAGATGGAGCCTGGCACTGG - Intronic
1055440279 9:76330197-76330219 GCACAGGTCAAGGTTGGCCACGG + Intronic
1056081468 9:83098733-83098755 GCAAAGAGGGAGCTTGTGCAGGG + Intergenic
1056828322 9:89891883-89891905 TTACAGATGGGCCTTGGCCAGGG + Intergenic
1057090167 9:92250610-92250632 GCACAGATGGAGCTGGAGCAGGG + Intronic
1057173206 9:92976213-92976235 GCTCAGGTGGAGGCTGGCCAGGG - Exonic
1060178907 9:121518141-121518163 GCACTGATGGAGGTTATCCATGG + Intergenic
1060696207 9:125711139-125711161 ACACTGATGGTGCTGGGCCAGGG + Intergenic
1061236513 9:129346191-129346213 GCACAGGTGAAGCCTGGCCCGGG - Intergenic
1062680697 9:137778389-137778411 GCACAGATGGGGTGTGGCCTGGG - Intronic
1186152943 X:6694598-6694620 TCACAGAAGGAGCGTGGACAGGG - Intergenic
1187032723 X:15504355-15504377 GCAGGGAAGGGGCTTGGCCAGGG + Intronic
1189974019 X:46444772-46444794 GGACAGGTGGTGCTTGGCTATGG + Intergenic
1190248908 X:48707756-48707778 CCACAGATGGGGCTGGGACAGGG - Exonic
1194482630 X:94445682-94445704 ACACAGATGGATCTTGGAGAAGG + Intergenic
1197704927 X:129628036-129628058 GCAGAGATGGGGTTTTGCCATGG - Intergenic
1199984264 X:152939050-152939072 CCACAGATGGAGCAGGGCCTTGG + Intronic