ID: 1185057383

View in Genome Browser
Species Human (GRCh38)
Location 22:48588046-48588068
Sequence CATTATGCACAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057383_1185057399 19 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057383_1185057394 -1 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057383_1185057391 -4 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057383_1185057389 -10 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057383_1185057392 -3 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057383_1185057393 -2 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057383_1185057395 3 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057383_1185057390 -5 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057383_1185057398 11 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057383_1185057397 10 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057383 Original CRISPR CATTATGCACAGATGGAGCT TGG (reversed) Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
910532381 1:88252509-88252531 CATTATTCAGAGATGAGGCTGGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG + Intronic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1070911957 10:80126831-80126853 CATTCTGCACAGATGAAGAGGGG - Intergenic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1071156238 10:82692612-82692634 CCTTATGCAGGGAAGGAGCTCGG - Intronic
1074001506 10:109378290-109378312 CACTATGCACAGAGAGTGCTAGG + Intergenic
1074435682 10:113432302-113432324 TCTTATGCAGAGATGGAGCCAGG - Intergenic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG + Intronic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1087448919 11:98292523-98292545 CATTATGGGGAGATGGAGTTTGG - Intergenic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1101451506 12:104783648-104783670 CATTTTGCACTCATTGAGCTTGG - Intergenic
1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG + Intergenic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG + Exonic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG + Intronic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG + Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1122094783 14:99362968-99362990 CCTTATGCACACTTGGGGCTGGG - Intergenic
1126105000 15:45141662-45141684 CATTCGGCTGAGATGGAGCTCGG + Intronic
1126872295 15:53002567-53002589 CATTCTAGACAGAGGGAGCTGGG - Intergenic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1133718872 16:8475392-8475414 TATTATGCACACAGGGAGTTGGG - Intergenic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG + Exonic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925872280 2:8281777-8281799 CATTATGCTCAGAGGAAGGTGGG - Intergenic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
930491789 2:52082920-52082942 TATAATGCACAGTTGGAGCCTGG + Intergenic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
933532612 2:83529728-83529750 CCAGATGCTCAGATGGAGCTTGG + Intergenic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
1170504037 20:17005582-17005604 CATTATGTCCAGATGGACCCAGG + Intergenic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175656157 20:60772836-60772858 CCTCATGCCCAGATAGAGCTGGG - Intergenic
1178368472 21:32007411-32007433 CATTCTGCACAGATGAAGACAGG - Intronic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184255758 22:43285893-43285915 CCTTGTGCACAGATGAACCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
960221531 3:115116261-115116283 TAATATGCCCAGATAGAGCTGGG - Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
973312654 4:48726273-48726295 CATTATGCCCAGAAGGAGAAGGG - Intronic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975192463 4:71481172-71481194 CACTATGCTCAGAAGGTGCTGGG + Intronic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985052154 4:186001641-186001663 CATCATACACAGAAGGTGCTGGG + Intergenic
990624452 5:57595856-57595878 CATTATGCACAGCAGCTGCTTGG + Intergenic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
997223151 5:132187066-132187088 CAGTAGGCACCGTTGGAGCTGGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1004978738 6:20998288-20998310 CATACTGCACACTTGGAGCTGGG - Intronic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1008878129 6:56351588-56351610 CATTATACACATGTGCAGCTTGG - Intronic
1016322080 6:142857431-142857453 CATTATGGCCGGATGGTGCTTGG - Intronic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1045002259 8:97888576-97888598 CATTATTAACAGATCTAGCTGGG - Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1051311661 9:15780655-15780677 CTTTATGCACAGTTGTAGTTTGG + Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052789678 9:32863630-32863652 CATTTTGCACTGATGAAGATAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1060723451 9:125992930-125992952 CATTATCCACAGAGAGAGCCAGG - Intergenic
1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG + Intergenic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic
1199071838 X:143485952-143485974 CACTATGCAAAGATGTATCTGGG + Intergenic