ID: 1185057388

View in Genome Browser
Species Human (GRCh38)
Location 22:48588053-48588075
Sequence GAGCCCCCATTATGCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057388_1185057399 12 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057388_1185057398 4 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057388_1185057402 25 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057402 22:48588101-48588123 GGAGAACTGGATGTTCACCAGGG 0: 1
1: 0
2: 0
3: 20
4: 164
1185057388_1185057403 26 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057403 22:48588102-48588124 GAGAACTGGATGTTCACCAGGGG 0: 1
1: 0
2: 2
3: 17
4: 141
1185057388_1185057401 24 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057401 22:48588100-48588122 GGGAGAACTGGATGTTCACCAGG 0: 1
1: 0
2: 3
3: 17
4: 240
1185057388_1185057395 -4 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057388_1185057397 3 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057388_1185057392 -10 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057388_1185057393 -9 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057388_1185057394 -8 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057388 Original CRISPR GAGCCCCCATTATGCACAGA TGG (reversed) Intronic
No off target data available for this crispr