ID: 1185057389

View in Genome Browser
Species Human (GRCh38)
Location 22:48588059-48588081
Sequence GTGCATAATGGGGGCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057373_1185057389 26 Left 1185057373 22:48588010-48588032 CCCGGGTTATCCTGCAGGTGCCA 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057376_1185057389 16 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057374_1185057389 25 Left 1185057374 22:48588011-48588033 CCGGGTTATCCTGCAGGTGCCAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057383_1185057389 -10 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057380_1185057389 -2 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057378_1185057389 6 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057381_1185057389 -3 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057379_1185057389 -1 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1185057382_1185057389 -4 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057389 Original CRISPR GTGCATAATGGGGGCTCCAG TGG Intronic
900341037 1:2189428-2189450 GTCCACAGTGGGGGCGCCAGGGG + Intronic
900408017 1:2500896-2500918 GGGCACAGTGGGGGCTCCAGCGG - Intronic
902661282 1:17905773-17905795 GTGGATAATGGGGTCAGCAGGGG + Intergenic
903425627 1:23252126-23252148 GTGTAAAATGGGGGCTTCACAGG + Intergenic
904607134 1:31704126-31704148 GGGCCTAGAGGGGGCTCCAGCGG + Exonic
905162038 1:36045120-36045142 GTGGTTAATGGGAGGTCCAGAGG + Intronic
905347352 1:37319934-37319956 GTGCAGAGTCAGGGCTCCAGAGG + Intergenic
906667470 1:47631881-47631903 GGGCACAATGGGTGCTCGAGAGG + Intergenic
913280512 1:117180946-117180968 TTTCCTAATGGGGGCTCCACAGG + Intronic
915648552 1:157291140-157291162 GTTCTTTATGGGGACTCCAGGGG - Intergenic
916072103 1:161176455-161176477 AGGGATCATGGGGGCTCCAGGGG + Exonic
916173253 1:162017578-162017600 CTGCATACTGGGGGCTCGACAGG + Intronic
916654318 1:166859879-166859901 GTGCATCCTGAGGGCTCCCGAGG - Intronic
917735618 1:177917306-177917328 GTTCCTACTGGAGGCTCCAGGGG - Intergenic
918704296 1:187641452-187641474 GTGCAACTTGGGGGCTCAAGCGG + Intergenic
920500388 1:206481594-206481616 GGGCACAGAGGGGGCTCCAGGGG + Intronic
921999542 1:221461977-221461999 GTGTGTAATGGGGTCTCCACAGG - Intergenic
1063163443 10:3438165-3438187 GTTCCTTCTGGGGGCTCCAGGGG + Intergenic
1063913378 10:10854885-10854907 GGGCAGAAAGTGGGCTCCAGGGG + Intergenic
1065767363 10:29042941-29042963 GTTCATAATCTGGGCTCAAGAGG - Intergenic
1066151566 10:32625744-32625766 GAGCAGAATGGGGGCTGCACAGG - Intronic
1067809994 10:49418693-49418715 GGGCAGAATGTGGGCCCCAGGGG + Intergenic
1070648842 10:78220538-78220560 GTGAATAAAGTGGGCTGCAGGGG + Intergenic
1073110062 10:101057116-101057138 GGGCATGATGGGGGCTTCTGAGG + Intergenic
1073297742 10:102451117-102451139 GTTCTTACTGGGGGCTCCTGCGG + Exonic
1078982139 11:16548410-16548432 GTGAATAATTGGAGCTCCATAGG + Intronic
1081711430 11:45219031-45219053 TTAAAAAATGGGGGCTCCAGTGG - Intronic
1091043892 11:132308500-132308522 GTACATAATGAGGGACCCAGAGG - Intronic
1091843475 12:3637002-3637024 GTGCAGGATGAGGGCTCGAGGGG + Intronic
1092253298 12:6913338-6913360 GTGCATGGTAGGGGCTGCAGGGG + Intronic
1095980608 12:47972402-47972424 GTGAAGAATGGGGGCCACAGTGG + Intergenic
1096527737 12:52222211-52222233 GTGCAGATAGGGGGCGCCAGAGG + Intergenic
1096939098 12:55321429-55321451 GTTCATCATGGGGGCTACTGAGG - Exonic
1098918926 12:76285221-76285243 GTGGAAACTGGGGGCTTCAGTGG + Intergenic
1102759401 12:115372503-115372525 GTGCATCATGGGTCATCCAGAGG + Intergenic
1105964909 13:25374760-25374782 CTGCATAGTGTGGGCTCCTGGGG + Intronic
1109475426 13:62875021-62875043 CTACATAATGTGGACTCCAGAGG + Intergenic
1109838071 13:67885280-67885302 GTGAATTCTGGGGGCTACAGAGG + Intergenic
1113595466 13:111528705-111528727 GTGGATAATGGGCTGTCCAGAGG - Intergenic
1114437969 14:22723817-22723839 GTGGATGATGGGGGTTCCACAGG - Intergenic
1119763352 14:77170502-77170524 ATGCATAATGGGAGTGCCAGAGG - Intronic
1121717132 14:96084308-96084330 GGGCATGACGGGGGCTGCAGGGG - Intronic
1121955642 14:98210283-98210305 GTGGAAGAAGGGGGCTCCAGGGG + Intergenic
1123508630 15:20972321-20972343 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1123565851 15:21546070-21546092 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1123602111 15:21983357-21983379 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1123706543 15:22955125-22955147 GGGCATGCTGGGGGCTCCATGGG + Intronic
1128542070 15:68543246-68543268 GAGCAAACTGAGGGCTCCAGAGG - Intergenic
1129112073 15:73343022-73343044 GTTAATAATGTGGGCTCTAGAGG + Intronic
1130102525 15:80904740-80904762 GTTCCTCATGGAGGCTCCAGAGG - Intronic
1131715075 15:95100572-95100594 ATGCATATTGGGGTCTCCAAAGG + Intergenic
1202974220 15_KI270727v1_random:273163-273185 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1132526269 16:416809-416831 GTGCAGAACGGGGGCTCTGGAGG + Intergenic
1132801692 16:1757827-1757849 CTGCATCATGGGGGCTGCGGGGG + Intronic
1134374999 16:13663915-13663937 GTGCATAATAGGTGCTCAATAGG + Intergenic
1135966193 16:27037193-27037215 GTGCAAAATGGGAGATGCAGGGG - Intergenic
1141570971 16:84933508-84933530 GTGCCTGCTGGGGGCTCCAGGGG - Intergenic
1141645267 16:85364114-85364136 GTTCCTTCTGGGGGCTCCAGGGG + Intergenic
1141782856 16:86175915-86175937 CTGCATAGTGGGTGCTGCAGTGG - Intergenic
1143011632 17:3869344-3869366 CAGCAGAATGGCGGCTCCAGTGG + Intronic
1143567686 17:7734461-7734483 GTGGATCATGGAGGCTGCAGGGG - Exonic
1146096646 17:29936531-29936553 GTGCTAACTGGGGGCACCAGAGG - Intronic
1146126825 17:30237211-30237233 GGGGATAATGGGGGTTGCAGGGG + Intergenic
1147216055 17:38899516-38899538 GTGCATAGAGTGGGCTGCAGTGG + Intronic
1147263909 17:39224051-39224073 GTGCAGGATGGGGGCTCCCTGGG + Intronic
1152046159 17:77937192-77937214 GTGGGTACTGGGGTCTCCAGGGG - Intergenic
1157428193 18:47601977-47601999 GTGCATAATGGGTCCTCCCAGGG - Intergenic
1160971537 19:1769896-1769918 GTGCCTAATGGGGACCCCAGAGG - Intronic
1161031717 19:2060832-2060854 GTCCCTCCTGGGGGCTCCAGGGG - Intergenic
1162009365 19:7802523-7802545 GTGGATTTTGGGGGCTCAAGGGG - Intergenic
1162577320 19:11506456-11506478 TTGCACAGTGGGGGCTGCAGCGG + Intronic
1162831196 19:13285728-13285750 CTGCAGAATGGAAGCTCCAGAGG - Intronic
1164229638 19:23276042-23276064 GTGCAGAATGAGAGCTGCAGTGG + Intergenic
1165471047 19:36004771-36004793 TAGCAAAATGGGTGCTCCAGTGG - Intronic
1167635978 19:50656044-50656066 GTCCATAAGGAGGGCTCCTGAGG - Exonic
1168237412 19:55071980-55072002 GTGAAGGATGGGGGCTGCAGGGG - Intergenic
926148500 2:10411564-10411586 GTGAATAAAGTGGGGTCCAGGGG - Intronic
926805589 2:16707716-16707738 ATGCATAGTGGGAGATCCAGGGG - Intergenic
927512950 2:23655909-23655931 GTGCATCTTTGGGGGTCCAGGGG - Intronic
932746157 2:74335299-74335321 GTGCCAAATGATGGCTCCAGTGG - Intronic
932858029 2:75259142-75259164 ATGCATAATGGTAGTTCCAGAGG - Intergenic
937093525 2:119222275-119222297 GAGCATATTAGGGGCACCAGAGG + Intergenic
937523572 2:122740238-122740260 TTTCATAATGTGGGCTTCAGTGG - Intergenic
938152047 2:128895425-128895447 GTGAGTGCTGGGGGCTCCAGGGG + Intergenic
938265852 2:129927771-129927793 GTGCAGAATGAGGGATGCAGTGG + Intergenic
940342557 2:152596528-152596550 GAGCATAAAAAGGGCTCCAGGGG - Intronic
947530335 2:230905068-230905090 GTGGTTAAGGAGGGCTCCAGAGG - Intergenic
1171047177 20:21821071-21821093 CTGCAAATTGGTGGCTCCAGGGG + Intergenic
1171223411 20:23421112-23421134 GGGCGTCCTGGGGGCTCCAGGGG + Intronic
1172228777 20:33323195-33323217 GTGTGGCATGGGGGCTCCAGTGG - Intergenic
1172984846 20:38976766-38976788 GTGGATACTAGGGGCTGCAGAGG - Intronic
1173810863 20:45954268-45954290 GTGCATTATGGGGTGTTCAGCGG - Intronic
1175898120 20:62348892-62348914 GTATCTAATGGGGACTCCAGGGG + Intronic
1181961851 22:26627990-26628012 GTCCAAAATTGGGGATCCAGTGG - Intronic
1184565975 22:45292373-45292395 CTGCAGAATGGGGTCTCCAGGGG + Intronic
1185057389 22:48588059-48588081 GTGCATAATGGGGGCTCCAGTGG + Intronic
1185294945 22:50048577-50048599 GAGCATCCTGGGTGCTCCAGCGG - Intronic
952835145 3:37595989-37596011 TTGCACAATGCTGGCTCCAGTGG - Intronic
954082992 3:48223463-48223485 GGGCATAAAGGAGGCTCCTGTGG + Exonic
954894144 3:53961408-53961430 GTTCCTTCTGGGGGCTCCAGAGG - Intergenic
955234943 3:57131022-57131044 GTGCACAACGGGGCCTCCCGGGG + Intronic
955931079 3:64057665-64057687 GTGGTTAATGGGGTCTCCTGGGG - Intergenic
968673005 4:1862499-1862521 GTGCAGAACGGGGGCTGCGGGGG + Intergenic
969542810 4:7804081-7804103 GAGAATATTGGGGGGTCCAGAGG - Intronic
976842032 4:89443182-89443204 GTGCCTCCTGGAGGCTCCAGGGG - Intergenic
977816540 4:101419816-101419838 GTGTATAATGTGGCCACCAGTGG - Intronic
984831676 4:183981357-183981379 CTGCATATTGGGGGCTTCTGTGG + Intronic
986788707 5:11139844-11139866 GTTCCTTCTGGGGGCTCCAGGGG + Intronic
997452056 5:133991682-133991704 CTGCATGATGGGTGGTCCAGGGG - Intronic
998856958 5:146403108-146403130 GTGCCTGGTGGGGGCACCAGAGG - Intergenic
999672277 5:153968469-153968491 ATGCAGAATGGTGGCTCCTGAGG - Intergenic
1000167840 5:158672632-158672654 GTACATACTGGGGGATCAAGTGG - Intergenic
1002050126 5:176565808-176565830 AGGCATGGTGGGGGCTCCAGAGG - Intronic
1002330762 5:178438977-178438999 GTGCACACTGGGAGCTCCAGGGG - Intronic
1007284192 6:40736089-40736111 CTGCATAAGGGCTGCTCCAGTGG - Intergenic
1014303630 6:119713746-119713768 AGGCATATTGGGGGCTCCAAAGG + Intergenic
1016676762 6:146779351-146779373 GTACATAATGGGAACTCCAGAGG + Intronic
1016991185 6:149929572-149929594 GTGCAGAAGGGGAGCTGCAGTGG + Intergenic
1020917200 7:14209556-14209578 ATTTAAAATGGGGGCTCCAGAGG + Intronic
1023000093 7:35800326-35800348 GTCCGCAATGGGGGCTACAGCGG + Intergenic
1023656009 7:42421777-42421799 GTGCTTGATCTGGGCTCCAGAGG - Intergenic
1025028668 7:55537987-55538009 GAGCTGAATGGGGGCTCCTGGGG - Intronic
1026925913 7:74193452-74193474 GTGCATACTGCGGGCTCTGGGGG + Intronic
1028381846 7:90208852-90208874 GTGGAGTCTGGGGGCTCCAGGGG - Intronic
1030886872 7:114949723-114949745 GTGTATTATGAGTGCTCCAGTGG + Intronic
1032485924 7:132287568-132287590 GTGCAGGATGGAGGCTCCGGGGG - Intronic
1032489202 7:132311315-132311337 GTGCCTCCTGTGGGCTCCAGCGG + Intronic
1032519830 7:132535513-132535535 CTGCAGAGTTGGGGCTCCAGAGG + Intronic
1034401267 7:150863179-150863201 GTTCCTAATGGAGGCTCTAGGGG - Intergenic
1035168418 7:157005076-157005098 CTGCAGAATGGCGGCTCCAGAGG + Exonic
1043095303 8:75961947-75961969 TAGCATAATTGGAGCTCCAGAGG + Intergenic
1043749415 8:83916789-83916811 CTGCTGAATGGGGGCTCCACTGG - Intergenic
1049172019 8:141167359-141167381 GAGGGTCATGGGGGCTCCAGGGG - Intronic
1049694868 8:143978201-143978223 GAGCATGATGGGGGCTGCAAGGG - Intronic
1051008386 9:12378682-12378704 GTACAACATGGGGGATCCAGGGG - Intergenic
1055878008 9:80966250-80966272 GTGCAGCATGGGGCCTTCAGGGG - Intergenic
1056243358 9:84670181-84670203 GGGCACACTGGTGGCTCCAGCGG + Intronic
1057555148 9:96082254-96082276 ATGCATCCTGGGGGCTCCAGGGG + Intergenic
1060526227 9:124322722-124322744 GAGCAGGGTGGGGGCTCCAGCGG - Intronic
1060581193 9:124748440-124748462 CTGTAAAATGGGGGCTACAGTGG - Intronic
1060814777 9:126629175-126629197 GTGCAGAATGGAGGCTTCTGTGG - Intronic
1187984688 X:24797462-24797484 GTACATAACAGGGGCTCCTGGGG - Intronic
1187992207 X:24886962-24886984 GTCCCTACTGGGGGCTCCACAGG + Intronic
1192025374 X:67444635-67444657 TGCCATAATGAGGGCTCCAGTGG + Intergenic
1193390101 X:80915637-80915659 TTGCATTATGGGGGTTTCAGAGG + Intergenic
1198038302 X:132823169-132823191 GTGCATAAAGAGGACTCCATAGG - Intronic
1199921744 X:152412890-152412912 TTGCATAATGGGCGTTTCAGAGG + Intronic