ID: 1185057390

View in Genome Browser
Species Human (GRCh38)
Location 22:48588064-48588086
Sequence TAATGGGGGCTCCAGTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 87}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057378_1185057390 11 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057383_1185057390 -5 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057381_1185057390 2 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057376_1185057390 21 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057374_1185057390 30 Left 1185057374 22:48588011-48588033 CCGGGTTATCCTGCAGGTGCCAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057380_1185057390 3 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057379_1185057390 4 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87
1185057382_1185057390 1 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057390 Original CRISPR TAATGGGGGCTCCAGTGGTT TGG Intronic
911749757 1:101482615-101482637 TAAAGGGGGCTGGAGGGGTTTGG - Intergenic
912313467 1:108645966-108645988 ACATGGGGGCTCCAGTGATTAGG + Intergenic
923885190 1:238146612-238146634 TAATGTGGGCTCCAGTAGGTTGG + Intergenic
1068087638 10:52394315-52394337 TAATGAGAGATACAGTGGTTGGG + Intergenic
1069859898 10:71463907-71463929 TAATGGGGACTCCAGGGATTGGG - Intronic
1077507095 11:2934813-2934835 TTATGGAGCCTCCAGAGGTTGGG + Intergenic
1085063941 11:73474628-73474650 TAATAGGTGTTACAGTGGTTTGG - Intronic
1089634804 11:119805207-119805229 TAATCGGGGCTTGAGTGATTAGG + Intergenic
1090343818 11:126050782-126050804 GAATGGAGGCTCCAGGGGATTGG - Intronic
1093785340 12:23185912-23185934 TAATTGGGCCTTCAATGGTTCGG + Intergenic
1093788726 12:23221880-23221902 TAATGGGGAGTCCAGTGGTAGGG + Intergenic
1098465250 12:70779605-70779627 AAATGTGGGCTCCATTGGTGCGG + Intronic
1108144219 13:47459839-47459861 TAATGTGGCCTCCTGTGGTGTGG + Intergenic
1115975793 14:38995585-38995607 TAATGTGGGCTCGAGTGCTAGGG - Intergenic
1118601619 14:67474463-67474485 AAATGGGGTCCCCAGTGGATAGG - Intronic
1119151017 14:72359362-72359384 TAATAGGGGTGCCAGGGGTTGGG + Intronic
1121058221 14:90878663-90878685 AAACTGGGGCTCCAGTGGTCAGG + Intronic
1125742918 15:41979744-41979766 TGGTGAGGACTCCAGTGGTTGGG - Intergenic
1134608738 16:15591230-15591252 CAATTGGGGCTACAGTGGTGGGG - Intronic
1138978865 16:62242145-62242167 TTATGGAGGCTCATGTGGTTTGG + Intergenic
1147552304 17:41452345-41452367 TACTGTGGGCTCCATTGGTCAGG + Intergenic
1148843414 17:50513982-50514004 TAATGGGGTCAGCAGAGGTTTGG - Intronic
1150264021 17:63820227-63820249 TGATGGGGCCTCCAGAGATTGGG - Intronic
1153508289 18:5826278-5826300 TAATAGGGCCTTCAGAGGTTTGG - Intergenic
1154189362 18:12215835-12215857 GATTAGAGGCTCCAGTGGTTGGG + Intergenic
1160760562 19:782124-782146 TGATGGGGGCTGCAGGGGCTGGG + Intergenic
1162949304 19:14061328-14061350 TAGAGGGGGCTTCAGAGGTTTGG - Intergenic
1164812899 19:31171996-31172018 TAATGGAGGGTCCCGTGGTTGGG + Intergenic
927496317 2:23554046-23554068 TAATGGGGGCTCCATGGGGCTGG + Intronic
936381692 2:111992277-111992299 TCATGGAGGCTCCATTGGATAGG - Intronic
937632740 2:124121768-124121790 CAATGTGGGCTGCAGTGGTAGGG - Intronic
941559061 2:167022050-167022072 TAATGATGGCTACAGTAGTTTGG + Intronic
941629876 2:167872221-167872243 TACGGGGGGCTCCAGGGGTCAGG - Exonic
941646733 2:168048662-168048684 TATTGGAGGCTTGAGTGGTTCGG - Intronic
943226862 2:185188662-185188684 TACTGGGGGCTACAGTGCTCTGG - Intergenic
944969680 2:204977897-204977919 TGATGAGGGCTCCAGATGTTGGG + Intronic
947626350 2:231621514-231621536 TAATGGAGGCTCCAGGTGCTTGG - Intergenic
948625758 2:239266921-239266943 TTAGGGGACCTCCAGTGGTTAGG - Intronic
1168913449 20:1467886-1467908 AAATGTGGGCTACAGTGGTAGGG - Intronic
1171149244 20:22812286-22812308 TGCTAGGGGCTCCAGTGGTCAGG - Intergenic
1173813036 20:45968016-45968038 TCATGGGGGCTCCTGGGGATGGG + Exonic
1174294982 20:49539540-49539562 CCATGGGGGCCCCAGTGGGTGGG - Intronic
1174353840 20:49985671-49985693 TAATGGTGGGCCCAGTGGGTGGG + Intronic
1175505790 20:59483289-59483311 GAATGGGGGTTCCAGGGGCTGGG + Intergenic
1176074936 20:63244157-63244179 TCAGGGGCGCTCCAGTGCTTCGG - Intronic
1176171965 20:63700123-63700145 GAATTGGGGCTCCAGTGCTCAGG - Exonic
1178833851 21:36079391-36079413 TAAAGGAGGCTCCAGGGGTAAGG - Intergenic
1182112316 22:27732479-27732501 CAATGGGGGCTCCAGTAGCATGG + Intergenic
1183464384 22:37972358-37972380 TAATAGGGGCTAGAGTGGCTAGG + Exonic
1185057390 22:48588064-48588086 TAATGGGGGCTCCAGTGGTTTGG + Intronic
949806352 3:7959620-7959642 TAATGGAGTCTTCAGTGGTTTGG + Intergenic
952945431 3:38475584-38475606 GAATGGCCGCTCCAGTGGTGGGG + Intronic
953421248 3:42754903-42754925 AAATGGGGGCGGCAGTGGATGGG + Intronic
954151234 3:48658245-48658267 TACTGGAGGCTGCAGAGGTTGGG - Intronic
958033131 3:88137968-88137990 TAATAGTGTCTCTAGTGGTTTGG - Intronic
962529062 3:136261971-136261993 CGGTGGGGGCTCCAGTGATTGGG + Exonic
962636479 3:137337287-137337309 TAATGGGGGCTGATATGGTTTGG + Intergenic
963111336 3:141690773-141690795 TAATGGGGCCTCAGCTGGTTTGG + Intergenic
967627407 3:191702723-191702745 CAATGGGCCCTCCTGTGGTTAGG - Intergenic
967910892 3:194541757-194541779 TAATGGAGGCTTCACTGGATGGG - Intergenic
969097211 4:4742732-4742754 TACAGGGAGCTTCAGTGGTTGGG + Intergenic
969981877 4:11165560-11165582 TAATGGAGGCTTTAGGGGTTTGG + Intergenic
970386584 4:15562873-15562895 TAATAGGAGCTCAAGAGGTTTGG + Intronic
975140760 4:70915956-70915978 TAATGGGGGCTTCAGAGGGTGGG + Intronic
982329094 4:154161403-154161425 TAAATGTGGCTCCAGTGGTTTGG - Intergenic
983273713 4:165592520-165592542 TAATGGGGATTCCTGTGGTCTGG - Intergenic
983977969 4:173959765-173959787 TAATGTAGCCTCCAGTGTTTAGG + Intergenic
985731741 5:1553404-1553426 TCGTGGGGGCTCTAGTGGTGGGG - Intergenic
985731755 5:1553451-1553473 TAGTGGGGGCTCTAGTGGTGGGG - Intergenic
986765145 5:10918816-10918838 AAATGGGGGTTGCAGAGGTTGGG - Intergenic
987276495 5:16368676-16368698 TATCGGGGTCTCCAGTGGTGGGG + Intergenic
990595304 5:57307189-57307211 AAAAGGGGACTCCAGTGCTTGGG - Intergenic
997979700 5:138461219-138461241 TAATGGGTGTTCAACTGGTTAGG + Intergenic
999287491 5:150402778-150402800 TAATGGGGGCTCGAGTGAGAAGG + Intronic
1006511854 6:34525843-34525865 TAATGGGGGCTGCTGAGGTTGGG + Intronic
1007806856 6:44456843-44456865 TAGTGGGGGCTCCAGGGGTGTGG + Intergenic
1009996838 6:70905270-70905292 CATTGGTGGCTCCTGTGGTTAGG - Intronic
1011096990 6:83677150-83677172 GCATGGGGTCTCCTGTGGTTGGG - Intronic
1012341517 6:98130975-98130997 GAATGTGGGCTCAAGTGTTTTGG + Intergenic
1012845353 6:104381305-104381327 CAATGGGTGCCACAGTGGTTGGG + Intergenic
1018263154 6:161990150-161990172 CAGTGGTGGCACCAGTGGTTTGG - Intronic
1023727782 7:43162380-43162402 TTCTGGGGGCTCCAGTTGTTTGG + Intronic
1024980623 7:55154709-55154731 TACTGGTGGCTCCAGGGTTTAGG + Intronic
1026430535 7:70342705-70342727 TAAGGTGGGGTACAGTGGTTAGG - Intronic
1028716658 7:93978913-93978935 TAGTGGCAGCTCCAGTGATTGGG - Intronic
1029260875 7:99301887-99301909 TGAGGGGGGCTCACGTGGTTTGG - Intergenic
1032836671 7:135681521-135681543 TACTGGCAGCTCCTGTGGTTGGG + Exonic
1035592831 8:830461-830483 GAATGATGGCTCCAGTGGCTGGG - Intergenic
1039735263 8:40324756-40324778 TAATGGGAGGTCCAGTTGTGGGG - Intergenic
1042579556 8:70261754-70261776 TAATAGGGGCTCGGGTGGTGTGG - Intronic
1043353084 8:79384518-79384540 CAAAGGGGGCTCCAGTGGAGAGG + Intergenic
1047103641 8:121708779-121708801 AACTGGGGGCTGCAGTGATTTGG + Intergenic
1047438869 8:124858698-124858720 TAATAAGGGCTCCATTGCTTGGG - Intergenic
1047934564 8:129764299-129764321 CTTTGGGGTCTCCAGTGGTTGGG + Intronic
1054869291 9:70034676-70034698 TAATGGTGGCTCCAGAGACTAGG - Intergenic
1060581191 9:124748435-124748457 AAATGGGGGCTACAGTGGGATGG - Intronic
1185718470 X:2362672-2362694 AAATGGGAGCACCTGTGGTTGGG - Intronic
1186022075 X:5267862-5267884 TGATGGGCGCTGCAGGGGTTGGG - Intergenic
1192571593 X:72210737-72210759 AAATGGGGGTTCCAGAGGGTGGG - Intronic
1195466428 X:105183812-105183834 TAACTGGGGCTCCAGGGGTTTGG + Intronic
1197907756 X:131444329-131444351 AAATGAGAGCTTCAGTGGTTGGG + Intergenic