ID: 1185057391

View in Genome Browser
Species Human (GRCh38)
Location 22:48588065-48588087
Sequence AATGGGGGCTCCAGTGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057379_1185057391 5 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057378_1185057391 12 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057383_1185057391 -4 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057380_1185057391 4 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057376_1185057391 22 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057381_1185057391 3 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data
1185057382_1185057391 2 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057391 22:48588065-48588087 AATGGGGGCTCCAGTGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057391 Original CRISPR AATGGGGGCTCCAGTGGTTT GGG Intronic
No off target data available for this crispr