ID: 1185057392

View in Genome Browser
Species Human (GRCh38)
Location 22:48588066-48588088
Sequence ATGGGGGCTCCAGTGGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057379_1185057392 6 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057381_1185057392 4 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057383_1185057392 -3 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057376_1185057392 23 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057388_1185057392 -10 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057378_1185057392 13 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057382_1185057392 3 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
1185057380_1185057392 5 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057392 Original CRISPR ATGGGGGCTCCAGTGGTTTG GGG Intronic
900464889 1:2820761-2820783 ATGGGGGGTCCAGGGCATTGGGG + Intergenic
900897946 1:5496865-5496887 CTGGGGGCTCCAGTTGTTCTTGG + Intergenic
902295522 1:15464255-15464277 ATGAGGGCTCCAGGGGTCTCAGG - Intronic
902985040 1:20149870-20149892 AGGGTGGCTTCAGTGGTTTTCGG - Exonic
908155193 1:61345923-61345945 ATGGTGGCAGCAGTGGTTAGTGG + Intronic
912753009 1:112301001-112301023 ATGGGGGCTGCGGAGGTCTGAGG + Intergenic
913052686 1:115131046-115131068 CTGGTGGTGCCAGTGGTTTGGGG + Intergenic
914718237 1:150268788-150268810 ATGGGGGCTGCGGTGTTTTTCGG - Exonic
915058080 1:153155288-153155310 CTGGAGGTTCAAGTGGTTTGTGG - Intergenic
916072105 1:161176462-161176484 ATGGGGGCTCCAGGGGGTCCCGG + Exonic
919257496 1:195142641-195142663 ATGTGGGCTGAAGTGCTTTGGGG - Intergenic
920908033 1:210189687-210189709 ATTGGGGCTCCAGGGGCTTTAGG - Intergenic
921287590 1:213622837-213622859 AGGGAGGCCCTAGTGGTTTGTGG - Intergenic
923401916 1:233624040-233624062 TTGGAGGCTCCAGTTGTTTACGG + Intronic
923899213 1:238306797-238306819 ATGGGGGCTAAAGTGGTTCCTGG + Intergenic
924322375 1:242862915-242862937 TTTGGGGATCCAGTGGTCTGGGG + Intergenic
1063389028 10:5636655-5636677 ATGGGGATACCAGTGGCTTGGGG - Intergenic
1070469360 10:76763497-76763519 ATCTGGGCTCCAGTGATTTAAGG - Intergenic
1070555113 10:77521477-77521499 ATTATGGCTTCAGTGGTTTGGGG + Intronic
1072621017 10:97079268-97079290 ATGGGGGGTGCAGGGATTTGTGG + Intronic
1073829192 10:107362340-107362362 TTTAGGGCTCAAGTGGTTTGGGG + Intergenic
1075312281 10:121424550-121424572 GTGGCGGCTCCTTTGGTTTGGGG + Intergenic
1078191413 11:9094653-9094675 ATGGTGGGGCCAGTGGTATGGGG + Intronic
1078748083 11:14134466-14134488 ATGGTGGCTGCAGTGGGATGTGG - Intronic
1081711427 11:45219024-45219046 ATGGGGGCTCCAGTGGGGACAGG - Intronic
1095811915 12:46381099-46381121 ATGTTGGCTGCAGTGGTTTTAGG + Intergenic
1096726890 12:53571482-53571504 ATGCTGGTTACAGTGGTTTGTGG - Intronic
1099183443 12:79493011-79493033 TTTAGGGGTCCAGTGGTTTGGGG - Intergenic
1104296750 12:127522721-127522743 ATGGGGGCTCCGTGGCTTTGTGG + Intergenic
1106283418 13:28297551-28297573 ATGGGGGCTGGAGTGACTTGCGG + Intergenic
1111338000 13:86847133-86847155 AAGGGGACCCCAGTGGGTTGCGG - Intergenic
1113936754 13:113998935-113998957 ATGGTGGCTGCTGTGGTTTTGGG + Intronic
1116058847 14:39896515-39896537 TCTAGGGCTCCAGTGGTTTGGGG + Intergenic
1119893987 14:78204312-78204334 ATGGGTTCTTCAGTGGTGTGAGG + Intergenic
1121922558 14:97896528-97896550 ATGCGGGCTCCACAGGTTGGAGG - Intergenic
1122291228 14:100681464-100681486 ATGGGGTCTTCAGTGGTAGGAGG + Intergenic
1123115101 14:105891011-105891033 CTGGGGGCTCCGGTGGTTTGCGG - Intergenic
1125076893 15:35630098-35630120 ATGGTGGCTCCATGGGTTAGTGG + Intergenic
1129142995 15:73618766-73618788 ATGGAGGCTGCAGTGGGCTGTGG + Intronic
1129417211 15:75392074-75392096 ATGGAGGCTCTAGTTGCTTGTGG - Intronic
1129997684 15:80020947-80020969 ATGGTGGCTATAGTGGGTTGAGG + Intergenic
1130998330 15:88917964-88917986 ATGAGGGAGCCTGTGGTTTGGGG - Intergenic
1133380711 16:5328030-5328052 ATGGGGGCTGCATTTGTTTTAGG - Intergenic
1135850265 16:25957134-25957156 ATGATGACTCCAGTGCTTTGCGG + Intronic
1136520880 16:30795020-30795042 CTGAGGGCTCCAGTGGCCTGGGG - Intergenic
1138399483 16:56733864-56733886 ATGGGGGATCTAGCTGTTTGAGG - Intronic
1138429689 16:56960832-56960854 GAGGGGGCTCCAGAGGTCTGTGG + Intergenic
1142262844 16:89050758-89050780 AGGGGGGCTCCGGGGATTTGGGG - Intergenic
1142525124 17:534848-534870 ATGGGGGCTGCAGTGAGCTGTGG + Intronic
1142708586 17:1710921-1710943 ATGGGGTCTCCTGGGGGTTGTGG - Intergenic
1146736614 17:35243661-35243683 ATGGGGGATACAGGGCTTTGTGG - Intronic
1146972219 17:37082510-37082532 ATGGGGTTTCCTGTGGTTGGTGG - Intergenic
1148737496 17:49873085-49873107 ATGGGGCCTCCAGGGGTGTCAGG + Intergenic
1149943677 17:60898833-60898855 GTGGTGGCTGCAGTGGTCTGGGG + Intronic
1152161773 17:78673279-78673301 ATGGGCGTTTCTGTGGTTTGAGG + Intergenic
1156141125 18:34112682-34112704 ATGGTGGTTCCAGTGGCTGGAGG + Intronic
1160299829 18:77669460-77669482 TTGGTGGCTCCTGTGGTTTCAGG + Intergenic
1161713641 19:5863733-5863755 ATGGGGGCTCCAGGGGCGTCAGG + Intergenic
1162805749 19:13137213-13137235 ATGGGGGCTGTGGCGGTTTGGGG + Intronic
1164522529 19:28990055-28990077 ATTGCTGCTGCAGTGGTTTGAGG + Intergenic
1164812901 19:31171998-31172020 ATGGAGGGTCCCGTGGTTGGGGG + Intergenic
1165396849 19:35569213-35569235 ATGGGGACCCCAGGGGTCTGTGG - Intergenic
1166198957 19:41223805-41223827 ATGGGGGCTGCACAGGTGTGAGG + Intronic
1167262607 19:48467565-48467587 ATGGGGGCTGAAGTGGTGTCTGG - Intronic
1167526159 19:49985070-49985092 ATGGAAGCTGCAGTGTTTTGGGG + Intronic
1167647880 19:50715602-50715624 TAGGGGGCTCCAGTGGTAGGGGG + Intronic
925846113 2:8034974-8034996 CTGGGGGCCCCAGAGGCTTGTGG - Intergenic
927496319 2:23554048-23554070 ATGGGGGCTCCATGGGGCTGGGG + Intronic
928631351 2:33195872-33195894 ATGGGGGTTCCTGAGGGTTGGGG - Intronic
931392905 2:61860012-61860034 ATGGGAGATCCTGTGCTTTGTGG - Intergenic
932065117 2:68548877-68548899 ATGGGGTAGCAAGTGGTTTGGGG - Intronic
932880085 2:75493199-75493221 AGGCGGCCTCCAGTGGTTTCCGG + Exonic
935128046 2:100241198-100241220 AAGGGGGCTCAAGGTGTTTGTGG + Intergenic
935476327 2:103528061-103528083 ATGGGGGCTCCAGAAGCTTCTGG + Intergenic
936665705 2:114593118-114593140 AGGCTGCCTCCAGTGGTTTGGGG - Intronic
936973306 2:118195284-118195306 AAGGGGTCCCCAGTTGTTTGTGG - Intergenic
937824987 2:126358908-126358930 ATGGGCGCTGCAGTGTTTTAAGG - Intergenic
943427974 2:187759769-187759791 CTGTGGGCTACAGTGCTTTGAGG - Intergenic
944756841 2:202771965-202771987 ATAGGGGAGCCAGTGGTTTTTGG + Intergenic
1169355740 20:4903576-4903598 ATGGAGGCAACAGGGGTTTGGGG + Intronic
1169592902 20:7164447-7164469 AAGGGGGCTCCTGTGGTTTTGGG - Intergenic
1172636678 20:36414707-36414729 ATGGGGGCTCCAGGGGGCAGAGG + Intronic
1172916640 20:38448242-38448264 CTGGGGCCTCCAGGGGATTGGGG + Intergenic
1173163455 20:40669766-40669788 ATGGGGGCTGGACTGGGTTGGGG + Intergenic
1174294980 20:49539538-49539560 ATGGGGGCCCCAGTGGGTGGGGG - Intronic
1175381619 20:58567898-58567920 ATGGGGCTTCCAGTGATGTGAGG - Intergenic
1175705759 20:61175308-61175330 ATGGGTGCTCCACCAGTTTGGGG + Intergenic
1178097937 21:29235514-29235536 GTGGGGGCTCCAGGGATGTGGGG + Intronic
1178761299 21:35405274-35405296 ATGGGGGCTGGAGTGGTTGAGGG - Intronic
1182441654 22:30368114-30368136 AGAGGGACTCCAGTGGTTTCAGG + Intronic
1182465558 22:30514089-30514111 ATCTGGGCGCCAGTGCTTTGGGG + Intergenic
1184342690 22:43894634-43894656 AAGGGGCCTCCAGTGCTCTGTGG - Intergenic
1185057392 22:48588066-48588088 ATGGGGGCTCCAGTGGTTTGGGG + Intronic
950503220 3:13377359-13377381 ATGGGGGCTCCTGTTGCTTTGGG + Intronic
952039870 3:29249143-29249165 ATGTGACCTCCAGTGTTTTGAGG + Intergenic
952945433 3:38475586-38475608 ATGGCCGCTCCAGTGGTGGGGGG + Intronic
953029193 3:39166458-39166480 ATGGGTGCACCACTGGTGTGTGG - Intergenic
955124179 3:56093966-56093988 TTGTGGGCTCTAGTGGTTTATGG + Intronic
956862726 3:73340369-73340391 TTGGGGGCTCCAGCTGATTGTGG + Intergenic
959361702 3:105402463-105402485 ATGGGGAGTCTCGTGGTTTGGGG + Intronic
961781875 3:129325221-129325243 ATGGGGGCTCCTGTTGCTTTGGG + Intergenic
963921971 3:150914426-150914448 CTGGGGGCTGCAGTGGTTGTGGG + Intronic
963941312 3:151098508-151098530 GTGGTGGCTCCAGGTGTTTGTGG + Intronic
966004769 3:174996661-174996683 TTGGGGGTTCAAGTGGTTTTTGG + Intronic
967929023 3:194677078-194677100 AGGGAGGCTCCAGGGGTATGTGG + Intergenic
968445766 4:651333-651355 GTGGGGGCCCCAGGGGTTGGTGG + Intronic
969104657 4:4796442-4796464 ATGGTGGCACCAGTGAGTTGAGG - Intergenic
971048405 4:22831668-22831690 ATGGCTGTTCCAGTAGTTTGAGG - Intergenic
971956546 4:33427437-33427459 ATGTGGGCTCCAGTTAATTGAGG + Intergenic
976629685 4:87223585-87223607 ATGGGGTGGCCAGGGGTTTGGGG + Intronic
976833907 4:89348321-89348343 ATGATGCCTCCAATGGTTTGAGG + Intergenic
978899135 4:113927243-113927265 GTGTGGGCTCCAGTGGAGTGGGG - Intronic
982244856 4:153341541-153341563 GTTTGTGCTCCAGTGGTTTGTGG - Intergenic
990990220 5:61676481-61676503 CTGAGGGCTCCAGAGGGTTGGGG - Intronic
991924881 5:71695337-71695359 GTGAGGGCTCCAGTTGTCTGTGG + Intergenic
993915769 5:93741525-93741547 AAGGGGGCAGAAGTGGTTTGAGG + Exonic
995444517 5:112227922-112227944 ATGGGGGGTCCAGAGCTGTGTGG + Intronic
1001338926 5:170825857-170825879 ATGGTGGCTCTCTTGGTTTGTGG - Intergenic
1002817516 6:693812-693834 CAGGGGGCTGCAGGGGTTTGAGG + Intergenic
1003825376 6:9946075-9946097 TTGGGGGATCCAGTGGGTAGAGG + Intronic
1004360632 6:14967771-14967793 ATGTGGGCTCCAGTAGCCTGAGG + Intergenic
1004471888 6:15936946-15936968 TTTGGTGCACCAGTGGTTTGTGG + Intergenic
1005994218 6:30921853-30921875 ATGGTGGCAGCAGTGGTCTGAGG + Intronic
1009996836 6:70905268-70905290 TTGGTGGCTCCTGTGGTTAGGGG - Intronic
1010557792 6:77306365-77306387 ATGCAGGCTACAGTGCTTTGGGG - Intergenic
1010818570 6:80387980-80388002 CTAGGGGGTCCAGTGGTGTGGGG + Intergenic
1016388158 6:143548979-143549001 GTGGGGGCACCTGTGGCTTGAGG + Intronic
1018736678 6:166691739-166691761 GTGGAGGCTCCTTTGGTTTGAGG + Intronic
1018849914 6:167579479-167579501 ATGGGGGCTGGAGAGATTTGGGG - Intergenic
1019125768 6:169839330-169839352 ATGGGGGCAGCAGGGGTGTGAGG - Intergenic
1020132928 7:5569823-5569845 ATGGGGGATGCAGAGGTTTCTGG - Intergenic
1022111964 7:27237334-27237356 ATGGTGGCTCCAAGGGTGTGGGG + Intergenic
1022870455 7:34472274-34472296 ATGGGGGCACCAGGGATATGGGG + Intergenic
1030401651 7:109059175-109059197 ATGGGGGCCACTGTGGTTGGGGG + Intergenic
1033469836 7:141635743-141635765 ATGGCTGCTCCAGTGATTTTAGG + Intronic
1034450346 7:151133981-151134003 GTGGGGGCTGCAGTGCTTGGTGG + Intronic
1036715021 8:11113981-11114003 ATGCGGGCTGAAGTGGTTTCAGG + Intronic
1037998696 8:23371824-23371846 AATGGAGCTCAAGTGGTTTGAGG + Intronic
1039075802 8:33689601-33689623 ATGGGGGCTTCAGTGGGCGGGGG - Intergenic
1043478743 8:80631331-80631353 AAGGGGGCTCCAGTGGAGTGAGG + Exonic
1045250866 8:100482672-100482694 ATGGCTCCTCCAGTGGTTTCTGG - Intergenic
1048954223 8:139521465-139521487 ATGGGGCCACGAGTGGTTGGTGG + Intergenic
1049690652 8:143957532-143957554 CTGGGGTCCCCAGTGGTGTGGGG - Intronic
1051742215 9:20263055-20263077 GTGCAGGCTCCAGTGGATTGAGG - Intergenic
1051882085 9:21850237-21850259 CTAGGGGGTCCAGTGGTGTGGGG + Intronic
1052688211 9:31780717-31780739 ATGTGGGCTCCCATGGTTTTGGG + Intergenic
1055510331 9:76990041-76990063 TTGGGGGTACCAGTGGTTTTTGG + Intergenic
1061385508 9:130287146-130287168 GTGCGGGATCCAGTGGTGTGTGG - Intronic
1061887633 9:133600571-133600593 ATGGGGTCTGCAGTGGGATGGGG + Intergenic
1062451978 9:136619629-136619651 ACGGGGGCTCCAGTGCTTCCTGG - Intergenic
1062677594 9:137756526-137756548 ATGGAGGCTCCTGGCGTTTGAGG + Intronic
1186022073 X:5267860-5267882 ATGGGCGCTGCAGGGGTTGGGGG - Intergenic
1190648364 X:52544207-52544229 TTGGGGGTTCCAGGGGTTTCTGG - Intergenic
1192075309 X:67989242-67989264 TTAGGGGCTCAAGTGGTTTTGGG - Intergenic
1193580334 X:83256791-83256813 TTGGGGGCACAAGTGGTTTTTGG - Intergenic
1193946693 X:87745576-87745598 ATGAGGGGTCCAATGGTGTGCGG + Intergenic
1195366490 X:104131433-104131455 ATGAGGAATGCAGTGGTTTGAGG - Intronic
1195489821 X:105454554-105454576 ATGTTGGCTCCTTTGGTTTGGGG - Intronic
1197056376 X:122124797-122124819 TGGGGGGCTCAAGTGGTTTTTGG - Intergenic
1200158944 X:153994559-153994581 CTGTGGGCTGCAGAGGTTTGGGG + Intergenic
1201239183 Y:11941850-11941872 ATGGGGGTTCCAGGGGATTGAGG + Intergenic