ID: 1185057393

View in Genome Browser
Species Human (GRCh38)
Location 22:48588067-48588089
Sequence TGGGGGCTCCAGTGGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 217}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057388_1185057393 -9 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057379_1185057393 7 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057380_1185057393 6 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057381_1185057393 5 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057382_1185057393 4 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057383_1185057393 -2 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057378_1185057393 14 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217
1185057376_1185057393 24 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG 0: 1
1: 1
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057393 Original CRISPR TGGGGGCTCCAGTGGTTTGG GGG Intronic
900255578 1:1696731-1696753 TGGGCCCTTCACTGGTTTGGAGG + Intronic
900264254 1:1749433-1749455 TGGGCCCTTCACTGGTTTGGAGG + Intergenic
902206068 1:14868989-14869011 TGGGGGCCCCGGTGGTATTGTGG + Intronic
902627978 1:17687993-17688015 TGGAGGGTCCAGTGGGCTGGGGG - Intronic
903165009 1:21514177-21514199 TGAGGGCTCTGGAGGTTTGGGGG + Intronic
903193395 1:21668900-21668922 TGGGGGCGCCTGGGGTTTAGAGG - Intronic
905130902 1:35756419-35756441 TGGTTGCTCCAATGGGTTGGGGG - Intronic
905296214 1:36956050-36956072 TGGGGGCTTCAGTGGCTCAGTGG + Intronic
905502694 1:38452204-38452226 AGGGGGATCCAGTGGTTTAGAGG + Intergenic
905775531 1:40665330-40665352 AGGGGGCTGCAGAGGTCTGGAGG - Intronic
905782555 1:40725296-40725318 AGGGGTCTCTGGTGGTTTGGTGG - Intronic
906703356 1:47876058-47876080 TGGGACCTCCAGTGGGCTGGAGG - Intronic
906808701 1:48804679-48804701 TAGGGGCTCTAGGGGTCTGGAGG + Intronic
906902788 1:49854626-49854648 TTGGGGCTCCAGGGATGTGGAGG - Intronic
909491625 1:76232797-76232819 GCGGGGCCCCAGTGGTTTGCAGG + Intronic
911838065 1:102646383-102646405 AGAGGGCAGCAGTGGTTTGGGGG - Intergenic
912546821 1:110457055-110457077 TGGGGGCTTCAGTGGTTAACTGG - Exonic
915058079 1:153155287-153155309 TGGAGGTTCAAGTGGTTTGTGGG - Intergenic
915078874 1:153337660-153337682 TGGGGGCCGCAGTGGTGTGCTGG - Intronic
915448241 1:155987108-155987130 TTTGGGCGCCTGTGGTTTGGGGG - Intronic
915564897 1:156707737-156707759 TGGGGGCTCAAGAGGGCTGGTGG - Intergenic
915580347 1:156809434-156809456 TGGGGGCAGCTGAGGTTTGGCGG + Exonic
918503891 1:185229902-185229924 TGGTGGTTGCAGGGGTTTGGCGG + Intronic
921160153 1:212466750-212466772 AGATGGCTCCAGGGGTTTGGAGG + Intergenic
924441761 1:244091997-244092019 TGGGGACTCCAATGGTTGGCTGG - Intergenic
1062843477 10:688646-688668 TGGGAACTTCAGTGGTTTTGGGG + Intronic
1063139705 10:3245315-3245337 TTGGGGCTCCAGGGTTTGGGAGG - Intergenic
1063838326 10:10042130-10042152 TGGGGACTCCAAGAGTTTGGAGG + Intergenic
1064329858 10:14383413-14383435 CCGGGGCTCCAGTGGGGTGGGGG - Intronic
1066816973 10:39430834-39430856 TGGGGACTGCTGTGGTGTGGGGG + Intergenic
1069869272 10:71523375-71523397 TGAGGGATCTGGTGGTTTGGGGG - Intronic
1072410128 10:95194259-95194281 GGGGGGCTTCAGATGTTTGGAGG - Exonic
1073227457 10:101934969-101934991 TGGGGGCTGCTGTGTTTTAGAGG - Intronic
1073987147 10:109222706-109222728 TGGGGGCTGCAGCCATTTGGTGG - Intergenic
1074051453 10:109884484-109884506 TGGGAGCGCCAGAGGTTTGTCGG - Intronic
1075337977 10:121622382-121622404 TGAGGGCACCTGTGGTTGGGAGG + Intergenic
1075563113 10:123482823-123482845 TGGGGTCTCCAGTGGGCGGGTGG + Intergenic
1075979504 10:126724615-126724637 CAGGGACTCCAGAGGTTTGGGGG + Intergenic
1076131836 10:128018813-128018835 TGGGGACTGGAGTGGCTTGGAGG - Intronic
1076323779 10:129604664-129604686 TGGGGGCTGCAGTGGTTCACTGG + Intronic
1077019019 11:409319-409341 TGTGGGCACCAGTGGGTTTGGGG + Intronic
1077806217 11:5593887-5593909 TGTGGGATCCAGAGGTTTGGTGG - Intronic
1078191414 11:9094654-9094676 TGGTGGGGCCAGTGGTATGGGGG + Intronic
1079837491 11:25351631-25351653 TGGAGGCTCCAGTGGGTGAGTGG + Intergenic
1083482665 11:62959693-62959715 TGGGGGCAGCAGGGGTTGGGTGG + Intronic
1083901424 11:65645346-65645368 CTGGGGCTAAAGTGGTTTGGGGG + Intronic
1084978062 11:72814187-72814209 TGGGGGCTCCTGTGGCTGCGAGG - Intergenic
1088998815 11:115031204-115031226 TAGGGGCTCCATTGATGTGGTGG - Intergenic
1089701204 11:120245151-120245173 TGGGGGATCCAGAGATTTAGAGG - Intronic
1090078113 11:123592071-123592093 TTGGGGCTTCAGGGGGTTGGAGG + Intronic
1091775517 12:3182308-3182330 GGGGGGCTTCAGGGTTTTGGAGG + Intronic
1092023905 12:5224884-5224906 TGTGGGCCCCAGTGATTTGGAGG - Intergenic
1092229963 12:6770753-6770775 TGGGGGATGCAGAGGTTAGGTGG - Exonic
1092237463 12:6819072-6819094 TGGGGGCTAAAGGGGTGTGGTGG + Intronic
1096635140 12:52953347-52953369 TGAGGGCACCATAGGTTTGGAGG - Intergenic
1098967763 12:76810835-76810857 TGGTGGCTGCAGTTGTCTGGCGG + Intronic
1102183497 12:110930871-110930893 TGAGTGCTCCAGTGGACTGGGGG + Intergenic
1103680513 12:122690153-122690175 TGGGGCCTCCTGTGGTTTTGTGG + Intergenic
1104913480 12:132251723-132251745 TTGGGGTTCCAGAGCTTTGGAGG + Intronic
1106564899 13:30875624-30875646 TGGTGGCTCCAGTTATTTGGTGG + Intergenic
1108203728 13:48067190-48067212 TGGGAGCAACAGTGGTTGGGGGG - Intronic
1111373769 13:87352278-87352300 TTAGGGTTGCAGTGGTTTGGAGG + Intergenic
1111858288 13:93668661-93668683 TGGGGGCTCCAGGGGTTGCTTGG - Intronic
1113400326 13:109986486-109986508 CAGGGGCTCCAGTCTTTTGGGGG - Intergenic
1113466941 13:110519676-110519698 TGTGGCCTCCAGGTGTTTGGAGG - Intergenic
1113936755 13:113998936-113998958 TGGTGGCTGCTGTGGTTTTGGGG + Intronic
1114192642 14:20452012-20452034 TGGTGGCTCCAGTGATGAGGCGG + Exonic
1116545514 14:46161290-46161312 TGGGGACTGCTGTGGGTTGGGGG - Intergenic
1117444249 14:55788502-55788524 TGAGAGCTCCAGAGTTTTGGAGG - Intergenic
1118726610 14:68633406-68633428 TGGGGGAGCCAGCCGTTTGGGGG - Intronic
1119439823 14:74620597-74620619 TGAGGGCTACAGGGATTTGGTGG - Intergenic
1122790244 14:104181367-104181389 AGGGGGCTCTTGTGGTTCGGGGG - Intergenic
1123520751 15:21070473-21070495 TGGGGCCTGTAGTGGTGTGGGGG + Intergenic
1123758818 15:23417062-23417084 TGGGGCCTCAGGTTGTTTGGGGG + Intergenic
1125502893 15:40250521-40250543 TGGGAGCTACAGTGGGTTTGGGG - Intronic
1126394848 15:48203811-48203833 TGGGGGGTGGGGTGGTTTGGGGG + Intronic
1128377150 15:67085235-67085257 TAGGGGCTCCTCTGGTGTGGAGG + Intronic
1128741967 15:70090051-70090073 TGGGGGTTTCAGTGCTTTTGGGG - Intronic
1129321188 15:74775880-74775902 TGGTGGCTTGAGTGGTGTGGTGG - Intergenic
1130567816 15:85012536-85012558 TGGGGGCTGTTGTGGGTTGGGGG + Intronic
1132143112 15:99410745-99410767 TTGTAGCTCCAGTGGCTTGGAGG + Intergenic
1132361532 15:101220261-101220283 TTGAGGCTCCAGTGGGTTAGAGG - Intronic
1134608737 16:15591227-15591249 TTGGGGCTACAGTGGTGGGGAGG - Intronic
1136267428 16:29129916-29129938 TGGGACCTCCAGCGGCTTGGAGG + Intergenic
1136564333 16:31061107-31061129 CAGGGGCTCCAGGGGTGTGGGGG + Exonic
1137074902 16:35949673-35949695 TGGGGGCTGCTGTGGGGTGGGGG + Intergenic
1137612745 16:49829794-49829816 TGGGGGCTCCAGTGGAGAGGAGG + Intronic
1137716021 16:50598765-50598787 TGGTGGGGCCAGTGGTGTGGTGG + Intronic
1138429690 16:56960833-56960855 AGGGGGCTCCAGAGGTCTGTGGG + Intergenic
1139641889 16:68297517-68297539 TGGGGGCTTCAGAGGGTGGGGGG + Exonic
1139846614 16:69925680-69925702 TGGATGCTACAGTGGTTCGGTGG - Intronic
1140567097 16:76056185-76056207 TTGGGGCTCCTGTGGTGGGGGGG + Intergenic
1140810000 16:78567783-78567805 TGGAGGCTCTGCTGGTTTGGTGG - Intronic
1141149476 16:81553928-81553950 TGGTGGCTCCAGTGCCTAGGAGG - Intronic
1141832389 16:86516978-86517000 TTGGGGCTCGAGGGGGTTGGTGG + Intergenic
1142547359 17:714384-714406 TGGGGGTTCTGGTGGTTTTGGGG - Intronic
1143009382 17:3857521-3857543 GAGGGGCTCCAGTGGTGGGGAGG + Intergenic
1143016468 17:3893342-3893364 TGGGGGCGCAAAGGGTTTGGCGG - Intronic
1144944973 17:18965190-18965212 TGGGGGCAGCAGAGGTTTTGGGG + Intronic
1148398601 17:47332563-47332585 TGGGGGGTGGAGAGGTTTGGGGG - Intronic
1149943678 17:60898834-60898856 TGGTGGCTGCAGTGGTCTGGGGG + Intronic
1150264020 17:63820224-63820246 TGGGGCCTCCAGAGATTGGGTGG - Intronic
1150491459 17:65577174-65577196 TAAGGGCTTCAATGGTTTGGAGG + Intronic
1151487592 17:74411052-74411074 TGGGGGCTCCAGGTGTTTCTTGG - Intergenic
1151493405 17:74445679-74445701 TGGGAGCTACAGAGATTTGGTGG + Intronic
1156481552 18:37439682-37439704 TGGGAGCTCCAGGGATATGGGGG - Intronic
1156493218 18:37508682-37508704 TGTGAGCTCAAGTGGTCTGGTGG + Intronic
1157022058 18:43795502-43795524 TTGGGGGTCCAGTGGTTTTTAGG + Intergenic
1159205615 18:65247607-65247629 TGGGTGCTCAAGTGTTTTAGAGG - Intergenic
1160868795 19:1267751-1267773 CTGGGGCTCCAGTGGGTGGGTGG + Intronic
1161108508 19:2456047-2456069 TGGGGTCTCCAGGGGGTTTGCGG - Intronic
1161144299 19:2668434-2668456 TGGGGGAACCAGTGGCTGGGCGG + Intronic
1161805633 19:6441606-6441628 TGCAGGATCCAGTGATTTGGGGG + Exonic
1162805750 19:13137214-13137236 TGGGGGCTGTGGCGGTTTGGGGG + Intronic
1163303586 19:16463154-16463176 TGGGGTCTCACGTGGCTTGGAGG + Intronic
1164812902 19:31171999-31172021 TGGAGGGTCCCGTGGTTGGGGGG + Intergenic
1165120724 19:33556797-33556819 GGGGAGGTGCAGTGGTTTGGAGG - Intergenic
1167101710 19:47407694-47407716 AGGGGGCTCCTGTGGCGTGGGGG + Intronic
925279082 2:2670146-2670168 CAGGGGCTCCAGGGGTTGGGGGG - Intergenic
927496320 2:23554049-23554071 TGGGGGCTCCATGGGGCTGGGGG + Intronic
928089579 2:28366045-28366067 TGGGGCCTCCTGTGGATAGGGGG + Intergenic
929912466 2:46101814-46101836 TTGGGACTCTAGTGTTTTGGTGG + Intronic
934459819 2:94207977-94207999 TGGAGGCTCCCCTGCTTTGGGGG - Intergenic
936519403 2:113202185-113202207 TGGGGCCTCCAGAGCTTTGCAGG + Exonic
936618016 2:114068232-114068254 AGTGGTCTCCAGTGGTCTGGGGG + Intergenic
937096326 2:119237571-119237593 TGGTGGCTGCTGTGGTTTGGAGG - Intronic
938051572 2:128177467-128177489 TGGGGGCTCTAGCTGTTGGGAGG - Intronic
939373968 2:141339937-141339959 TGGAGACTCCAGTGGTGGGGAGG - Intronic
940174536 2:150863910-150863932 TGGTGGCTCTACAGGTTTGGGGG - Intergenic
943864837 2:192916375-192916397 TGGGGACTGCTGTGGGTTGGGGG + Intergenic
946025710 2:216670623-216670645 TGGGGGATACAGTTGTGTGGGGG + Intergenic
946687374 2:222283979-222284001 TGGGGGCTCCTGTGTTATTGGGG - Intronic
1170772624 20:19347201-19347223 TTGGGGCTCCAGGGGTAGGGAGG + Intronic
1172916641 20:38448243-38448265 TGGGGCCTCCAGGGGATTGGGGG + Intergenic
1173163456 20:40669767-40669789 TGGGGGCTGGACTGGGTTGGGGG + Intergenic
1173452788 20:43180065-43180087 TCGGGCCCCCAGTGGATTGGAGG - Intronic
1174294979 20:49539537-49539559 TGGGGGCCCCAGTGGGTGGGGGG - Intronic
1179630913 21:42678188-42678210 TGGGGGCGTGAGGGGTTTGGCGG + Intronic
1179970780 21:44836016-44836038 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1179970793 21:44836041-44836063 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1179970856 21:44836169-44836191 TGGGGGCTGCAGGGGTAGGGTGG - Intergenic
1179970865 21:44836189-44836211 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1179970890 21:44836235-44836257 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1179970938 21:44836336-44836358 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1179970957 21:44836373-44836395 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1179970979 21:44836414-44836436 TGGGGGCTGCAGGGGTGGGGTGG - Intergenic
1182465559 22:30514090-30514112 TCTGGGCGCCAGTGCTTTGGGGG + Intergenic
1182704899 22:32270967-32270989 AGGGGGCCACAGTGGCTTGGAGG + Intergenic
1183513050 22:38247039-38247061 TGGTGGCTGCAGAGGTTTGAAGG - Intronic
1185040568 22:48501728-48501750 TGGAGGCCCCAGGGGTGTGGCGG + Intronic
1185052846 22:48562851-48562873 TGGGGCCCCGTGTGGTTTGGGGG - Intronic
1185057393 22:48588067-48588089 TGGGGGCTCCAGTGGTTTGGGGG + Intronic
1185066835 22:48636694-48636716 TGGGGGCTCCTGGGGTTCGGAGG - Intronic
1185092809 22:48785401-48785423 TGGGGGCTGCGGTGGTTTGAAGG + Intronic
950503221 3:13377360-13377382 TGGGGGCTCCTGTTGCTTTGGGG + Intronic
954331207 3:49891308-49891330 TGGGGGCACAGGTGGGTTGGTGG + Intronic
957301487 3:78397437-78397459 TGGAGGATTGAGTGGTTTGGTGG + Intergenic
959014799 3:101121535-101121557 AGGGGGCTGCTGTAGTTTGGTGG + Intergenic
961781876 3:129325222-129325244 TGGGGGCTCCTGTTGCTTTGGGG + Intergenic
962095617 3:132289595-132289617 TGGGGGCTCCAGTGCAATAGAGG - Intergenic
962962261 3:140321655-140321677 TGAGGGCTCCAGGGTTTTGGTGG - Intronic
963941313 3:151098509-151098531 TGGTGGCTCCAGGTGTTTGTGGG + Intronic
966082586 3:176022009-176022031 TGGGGACTGTTGTGGTTTGGGGG + Intergenic
968428630 4:539729-539751 TGGGGCCCTCAGTGGTTTGTAGG - Intronic
968445767 4:651334-651356 TGGGGGCCCCAGGGGTTGGTGGG + Intronic
973797959 4:54448236-54448258 TGTGGGCTCAGGTGGTTTTGGGG + Intergenic
978766925 4:112413999-112414021 TGGAGGCTCCAGATGTTTTGGGG - Intronic
978969528 4:114786316-114786338 TGATGGCTCCAGTTTTTTGGGGG - Intergenic
982871289 4:160582022-160582044 TGGGGACTGCTGTGGGTTGGGGG - Intergenic
982893389 4:160884258-160884280 TGGGGCCTGCAGTGGGGTGGGGG + Intergenic
982895165 4:160911442-160911464 TGGGGTCTGCAGTGGGGTGGTGG + Intergenic
986743509 5:10724779-10724801 TGAGGGCTCCAGTGACTTGGAGG + Intronic
993241848 5:85398821-85398843 TGTGGGCTCCCCTGGTTTTGAGG + Intergenic
994818457 5:104615705-104615727 TGGGGCCTTCAGTGGTCTGCTGG - Intergenic
995357416 5:111254866-111254888 TGGGGACTTTTGTGGTTTGGAGG + Intronic
998098466 5:139412100-139412122 TGGGGGCTTTAGTGGCTTGTAGG - Exonic
998168020 5:139855573-139855595 AGAGGGCTCCAGTGGGGTGGGGG + Intronic
998951850 5:147400724-147400746 TGAGGGCACCAATGGTGTGGAGG - Exonic
999374591 5:151078023-151078045 TGGGGGCACCAGATGGTTGGAGG - Intronic
999460357 5:151752372-151752394 TGGGTTCCCCAGTGGGTTGGAGG + Intronic
1001257281 5:170193520-170193542 AGGGCCCTCCAGTGGTTGGGAGG - Intergenic
1001425514 5:171619585-171619607 CGAGGGCCCCAGTGGGTTGGGGG + Intergenic
1001600689 5:172926370-172926392 AGGGGGCTCCAGCGGATTTGTGG - Intronic
1002180985 5:177431067-177431089 TGGGGGCTCCAGTGAGCAGGAGG + Intronic
1002817517 6:693813-693835 AGGGGGCTGCAGGGGTTTGAGGG + Intergenic
1003381672 6:5629954-5629976 TAGGGGCAGCAGTGCTTTGGTGG + Intronic
1004471889 6:15936947-15936969 TTGGTGCACCAGTGGTTTGTGGG + Intergenic
1005221417 6:23592976-23592998 TGGTGGCACGAGTGGTGTGGTGG - Intergenic
1005315327 6:24598194-24598216 TGGCGGGACCAGTGGTATGGAGG + Intronic
1006864918 6:37201658-37201680 TGGGTGATGCAGAGGTTTGGGGG - Intergenic
1007429906 6:41770779-41770801 TGGGGGCTCGAGGGGTTCTGGGG + Exonic
1007806857 6:44456846-44456868 TGGGGGCTCCAGGGGTGTGGAGG + Intergenic
1009938350 6:70259951-70259973 TGGAGGCTCCAGTGTCTTTGGGG + Intronic
1009996835 6:70905267-70905289 TGGTGGCTCCTGTGGTTAGGGGG - Intronic
1009999226 6:70931172-70931194 TGGGGCCTGTAGTGGGTTGGGGG + Intronic
1016335330 6:142998775-142998797 TGGGGCCTGTAGTGGTGTGGGGG - Intergenic
1016870837 6:148814815-148814837 TGGGGGCTTCACTGGTATAGAGG + Intronic
1018849913 6:167579478-167579500 TGGGGGCTGGAGAGATTTGGGGG - Intergenic
1022045207 7:26617254-26617276 TGGGGGCTCCGGCCGTTGGGTGG + Intergenic
1022111965 7:27237335-27237357 TGGTGGCTCCAAGGGTGTGGGGG + Intergenic
1022840406 7:34158845-34158867 TTCTGGCTCCAGTGGTTAGGGGG + Intergenic
1022870456 7:34472275-34472297 TGGGGGCACCAGGGATATGGGGG + Intergenic
1023055724 7:36288301-36288323 GGGGGCCTGAAGTGGTTTGGTGG - Intronic
1023727783 7:43162383-43162405 TGGGGGCTCCAGTTGTTTGGTGG + Intronic
1025736577 7:64154134-64154156 TGGGGACTGTAGTGGGTTGGGGG - Intronic
1025995414 7:66524529-66524551 TGGGGGCTCCTGTGGCCTGTTGG - Intergenic
1026298703 7:69078555-69078577 TGGAAGTTACAGTGGTTTGGAGG - Intergenic
1026791471 7:73335282-73335304 TGGGAGCTCCAGGTGCTTGGTGG + Intronic
1028709912 7:93895082-93895104 TGTGGGGTCCAGGGGTGTGGTGG - Intronic
1031547435 7:123068010-123068032 TGGGGGCGCCAGTGGTGGTGGGG + Intergenic
1033264899 7:139876537-139876559 AATGGGCTCCAGTGATTTGGGGG + Intronic
1034259674 7:149746964-149746986 AATGGGCTCCAGTGGTTTGGAGG + Intergenic
1035611474 8:968389-968411 TGGGGGCTCCATCAGTGTGGAGG + Intergenic
1035840559 8:2808393-2808415 TGGTGGCTCCAGTGCTCAGGTGG - Intergenic
1036759033 8:11494286-11494308 TGTGGGCTCCCTGGGTTTGGGGG - Exonic
1037808077 8:22069466-22069488 GGGGGGTTCCAGTGGTTCTGGGG - Exonic
1038715281 8:29985892-29985914 TGTGGTCTCCAGTAGTTTAGGGG - Intergenic
1043478744 8:80631332-80631354 AGGGGGCTCCAGTGGAGTGAGGG + Exonic
1043960998 8:86418470-86418492 TGGGGGCTGCAGTCATTTGGAGG + Intronic
1044560842 8:93610481-93610503 TGGGGCCTTCAATGGATTGGAGG + Intergenic
1050242784 9:3655976-3655998 TGGGTACTCCAGTGTGTTGGGGG + Intergenic
1050878876 9:10674963-10674985 TGGTGGCTGCAGTGTATTGGAGG - Intergenic
1051113063 9:13662143-13662165 TGGGGCCTGTAGGGGTTTGGGGG - Intergenic
1060559443 9:124530573-124530595 TGAATGGTCCAGTGGTTTGGGGG - Intronic
1060824494 9:126680138-126680160 TGGGGGCACCAGGGTTATGGGGG - Intronic
1061385507 9:130287145-130287167 TGCGGGATCCAGTGGTGTGTGGG - Intronic
1061666602 9:132163631-132163653 TGGGGGCTCCCGGGGCTAGGGGG - Intronic
1185718469 X:2362669-2362691 TGGGAGCACCTGTGGTTGGGTGG - Intronic
1186022072 X:5267859-5267881 TGGGCGCTGCAGGGGTTGGGGGG - Intergenic
1186964390 X:14772134-14772156 TGGGGGCTGGAGGGGTTGGGGGG + Intergenic
1187573720 X:20532140-20532162 TGGGGGCTCCACCGTTCTGGTGG + Intergenic
1187638649 X:21262287-21262309 TGGGGGCTGCAGTCATCTGGAGG - Intergenic
1188723441 X:33551445-33551467 TTAGGGCTGCTGTGGTTTGGTGG + Intergenic
1190648363 X:52544206-52544228 TGGGGGTTCCAGGGGTTTCTGGG - Intergenic
1191224309 X:58026087-58026109 TGGGGGCCACAGTGGTATTGAGG + Intergenic
1194130887 X:90080290-90080312 TGGGCACTCCATTGGTTTGATGG + Intergenic
1198430064 X:136556492-136556514 GGGTGGCCCCAGTGGTTTGGTGG - Exonic
1198957585 X:142149201-142149223 TGGGGCCTCCTCTGTTTTGGGGG + Intergenic
1200158945 X:153994560-153994582 TGTGGGCTGCAGAGGTTTGGGGG + Intergenic