ID: 1185057394

View in Genome Browser
Species Human (GRCh38)
Location 22:48588068-48588090
Sequence GGGGGCTCCAGTGGTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 235}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057380_1185057394 7 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057388_1185057394 -8 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057378_1185057394 15 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057381_1185057394 6 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057379_1185057394 8 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057376_1185057394 25 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057382_1185057394 5 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1185057383_1185057394 -1 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057394 Original CRISPR GGGGGCTCCAGTGGTTTGGG GGG Intronic
900375439 1:2352347-2352369 GGGGTCCCCAGTGGCTGGGGAGG + Intronic
900552992 1:3265792-3265814 GGGGGCTCCTAGGGTCTGGGCGG - Intronic
901232004 1:7646587-7646609 GGAGGCTCTGGTGGGTTGGGAGG + Intronic
904479162 1:30783249-30783271 GGGGGCTCCTGGGCTTTGGCAGG + Intergenic
905091437 1:35434046-35434068 TGGGGCTCCAGTGTTAAGGGGGG + Exonic
905782554 1:40725295-40725317 GGGGTCTCTGGTGGTTTGGTGGG - Intronic
907980646 1:59477377-59477399 GAGGGCTGCAGTGGTCAGGGTGG + Intronic
908060446 1:60342493-60342515 CGGGGCTCCTTTGGCTTGGGAGG + Intergenic
910717995 1:90253288-90253310 GGGGGCTGGAGTGGTAGGGGAGG + Intergenic
912404700 1:109426874-109426896 GAGGGCTCCAGGACTTTGGGCGG + Intergenic
913496676 1:119433882-119433904 GCAGGGTCCAGTGGTTGGGGTGG + Intergenic
915456507 1:156044118-156044140 AGGGGCTCCAGGGGTTAGGGAGG + Exonic
915519132 1:156431054-156431076 GGGGGTGCCAGTGGAATGGGGGG + Intergenic
917291428 1:173476257-173476279 GGGGGCTGCTTTGGTTTGGGTGG - Intergenic
918553824 1:185775553-185775575 GCTGGCTCCTATGGTTTGGGAGG + Intronic
919938749 1:202272054-202272076 GGGGGCTCCTGTGATGTGGAAGG - Intronic
920062720 1:203238879-203238901 GGGGGCTGTAGTGGGTGGGGAGG + Intronic
922446266 1:225700382-225700404 CGGGGCTCCAGTGAATTGGATGG - Intergenic
922467725 1:225855796-225855818 TGGGGCTGCAGTGGGATGGGTGG - Intronic
922870961 1:228901640-228901662 GGGGTCTGCAGTGATGTGGGTGG + Intergenic
922898090 1:229115981-229116003 AGGGGCTCCAGTAGATGGGGAGG - Intergenic
924881098 1:248164222-248164244 GGGGGCTCCAGTCCTCAGGGGGG + Intergenic
924881138 1:248164364-248164386 GGGGGCTCCAGTCCTCAGGGCGG + Intergenic
924881259 1:248164791-248164813 GGGGGCTCCAGTCCTCAGGGCGG + Intergenic
924881283 1:248164877-248164899 GGGGGCTCCAGTCCTCAGGGCGG + Intergenic
924881300 1:248164929-248164951 GGGGGCTCCAGTCCTCAGGGTGG + Intergenic
1063356913 10:5409829-5409851 GGGGATTCCAGTGGTGGGGGTGG - Intergenic
1064147271 10:12835649-12835671 GGGGACTCCATGAGTTTGGGGGG - Intergenic
1065945013 10:30598216-30598238 GAGTGCTATAGTGGTTTGGGAGG + Intergenic
1066816974 10:39430835-39430857 GGGGACTGCTGTGGTGTGGGGGG + Intergenic
1068745736 10:60528764-60528786 GGTTGCTGCAGTGGTTGGGGAGG - Intronic
1070589528 10:77791950-77791972 GGGGGCTGCTTTGCTTTGGGAGG - Exonic
1070770147 10:79077471-79077493 GGGGGGTTCTGTGGTCTGGGTGG + Intronic
1074084092 10:110194398-110194420 GGGTGCTCCAGTGAGTGGGGAGG + Intergenic
1074601407 10:114917508-114917530 CTGGGCACCAGTGCTTTGGGTGG + Intergenic
1074687731 10:115975349-115975371 GGTGTCTCCAGGGCTTTGGGGGG - Intergenic
1077093343 11:789290-789312 GGGGGCCCCAGAGGCTGGGGAGG - Intronic
1077141989 11:1028820-1028842 GCGGGCTGCAGTGGGTGGGGAGG - Intronic
1077806216 11:5593886-5593908 GTGGGATCCAGAGGTTTGGTGGG - Intronic
1078010840 11:7572065-7572087 GAGGGCTCCACTGTTTAGGGTGG + Intronic
1078191415 11:9094655-9094677 GGTGGGGCCAGTGGTATGGGGGG + Intronic
1080790199 11:35515606-35515628 GGGGGCCTCAGTGTTTGGGGTGG + Intronic
1080883176 11:36341577-36341599 GGGAGCTCCAGAGCTGTGGGTGG - Intronic
1081606847 11:44532496-44532518 GGGGGCTCCCATGCCTTGGGCGG - Intergenic
1083901218 11:65644393-65644415 GGGGGGTGCAGGGGGTTGGGAGG + Intronic
1084664800 11:70570598-70570620 GCGGCCTCCAGTGGTGTGTGTGG + Intronic
1086524810 11:87712559-87712581 ATTGGCTGCAGTGGTTTGGGAGG + Intergenic
1088759147 11:112912927-112912949 GGGGTCTCCAGTAGTCTAGGAGG + Intergenic
1089317252 11:117600542-117600564 AGGGGATCCTGTGGTGTGGGCGG - Intronic
1089602286 11:119623465-119623487 GGGGGCTCTGGAGGTCTGGGAGG + Intronic
1091498390 12:991548-991570 GTGGGCGCCGGTGGTCTGGGTGG - Intronic
1096649550 12:53055274-53055296 GGGGGCTTCTGGGGTTGGGGTGG - Intronic
1098456530 12:70680882-70680904 GGCTGGTCCACTGGTTTGGGTGG + Intronic
1100473815 12:94917295-94917317 GGGGGCACCAGCAGTTTGGGTGG + Intronic
1103779722 12:123390127-123390149 CGGGGCTGCAGTGATTTGAGAGG + Intronic
1104616785 12:130277051-130277073 GGCCCCTCCAGTGTTTTGGGTGG - Intergenic
1106095992 13:26644397-26644419 TGAGGCTACAGTGGATTGGGTGG - Intronic
1108203727 13:48067189-48067211 GGGAGCAACAGTGGTTGGGGGGG - Intronic
1109301135 13:60591357-60591379 GAGGGCTCCGGTGGGGTGGGTGG - Intergenic
1116545513 14:46161289-46161311 GGGGACTGCTGTGGGTTGGGGGG - Intergenic
1118784889 14:69037735-69037757 GTGAGCTCCAGTGGTTGGAGTGG + Intergenic
1122234392 14:100323629-100323651 GGGGGCTGCACTGGCCTGGGAGG + Intronic
1123520752 15:21070474-21070496 GGGGCCTGTAGTGGTGTGGGGGG + Intergenic
1124165265 15:27320394-27320416 TAGGGCTCCAGAGGTGTGGGTGG + Intronic
1125524365 15:40365739-40365761 GGAGGTGCCAGGGGTTTGGGGGG + Intronic
1128184582 15:65633833-65633855 GGGGCCCCCAGTGTGTTGGGAGG + Intronic
1128642745 15:69351792-69351814 TAGGGATCCAGTGGTGTGGGTGG + Intronic
1128842120 15:70858876-70858898 GGTGGGGCCAGTGGTATGGGAGG + Intronic
1129704709 15:77787551-77787573 GGGGGCTTCAGGGCTGTGGGGGG + Intronic
1129704796 15:77788020-77788042 TGGGGCTCCAGGGGTCTGTGTGG - Intronic
1130567817 15:85012537-85012559 GGGGGCTGTTGTGGGTTGGGGGG + Intronic
1130613360 15:85380915-85380937 GGGGGCTGCGGGGGTTTCGGGGG + Intronic
1132639476 16:971086-971108 GGGGCCTCCCGGGGTGTGGGTGG - Intronic
1132946164 16:2532437-2532459 GGGGTCTACAGGGGTGTGGGGGG - Intergenic
1133547820 16:6825190-6825212 GGGGGCTGACGTGTTTTGGGAGG + Intronic
1134773003 16:16827132-16827154 GGATGCTTCAGTGGTTTGTGAGG - Intergenic
1135156793 16:20059533-20059555 GGGAGCTCCATTAGGTTGGGTGG - Intronic
1136367040 16:29813677-29813699 GGGGGCCCCATTGGCTGGGGGGG - Exonic
1137074903 16:35949674-35949696 GGGGGCTGCTGTGGGGTGGGGGG + Intergenic
1137982458 16:53081404-53081426 CACTGCTCCAGTGGTTTGGGTGG - Intronic
1138505727 16:57477331-57477353 GAGGGCTGCTGTGGTTTAGGTGG - Intronic
1138579596 16:57932112-57932134 GGGAGCTCCCGTGGTTTCTGTGG - Intronic
1138711508 16:58975726-58975748 GTGGTTTCCAGGGGTTTGGGTGG + Intergenic
1140303394 16:73779971-73779993 TTGGGATCCAGTGCTTTGGGAGG - Intergenic
1141398005 16:83721761-83721783 AGGGGCTCAAGTGGTTTAGCAGG + Intronic
1141833510 16:86523132-86523154 AGGGGCTGCAGTGGGTTGGGAGG + Intergenic
1142636691 17:1261935-1261957 GGAGGCTGCAGAGGTTCGGGTGG + Intergenic
1143406734 17:6682702-6682724 AGGGGGTCCCGTGGATTGGGAGG - Intergenic
1144176523 17:12712934-12712956 GGGGGCTCCATTGCTTTTGTTGG + Intronic
1145973138 17:28968637-28968659 GACTGCTCCAGTAGTTTGGGTGG + Intronic
1146001532 17:29133407-29133429 GGGGGCTGCAGTGGGTTAGGAGG - Intronic
1146904464 17:36609102-36609124 GGGGGCCCCCGTGGGGTGGGAGG - Intergenic
1147044818 17:37744491-37744513 CGGGGCTCCAGGGGTTCGGGTGG + Intronic
1147315900 17:39620112-39620134 GGGAGCTCCAGGGGCTGGGGTGG + Intergenic
1147518128 17:41141625-41141647 TGGGTGTCCAGAGGTTTGGGAGG - Intergenic
1147571098 17:41571697-41571719 GGTGGTTCCAGAGGTTTTGGTGG - Exonic
1151310823 17:73291546-73291568 GGGGGCAGCTATGGTTTGGGAGG + Intronic
1154308248 18:13246206-13246228 GCAGCCTCCAGAGGTTTGGGTGG + Intronic
1156199187 18:34810536-34810558 GGGGGCTGCAGGAGGTTGGGGGG + Intronic
1156351888 18:36309096-36309118 GGGGGCTCTCGTGGGTGGGGTGG + Intronic
1156481551 18:37439681-37439703 GGGAGCTCCAGGGATATGGGGGG - Intronic
1158580711 18:58679925-58679947 GGTGGCTCCAGCTCTTTGGGAGG + Intronic
1159028428 18:63207596-63207618 GGGAGCACCAGAGGTCTGGGTGG + Intronic
1160306855 18:77747975-77747997 GAGGGCTCCAGTGGTGTGGAAGG + Intergenic
1160476390 18:79192890-79192912 GGGGGCTCCAATGGTAGAGGTGG - Intronic
1160920216 19:1516128-1516150 GGGGGGTCCAGGGGTCTGTGGGG - Intergenic
1161069469 19:2253065-2253087 GGGGGCTCTAGGGGTGAGGGAGG - Intronic
1161202620 19:3024457-3024479 GGGGGTGCCAGGGGTTGGGGAGG - Intronic
1161334154 19:3703104-3703126 GGGGGTGCCAGGGGCTTGGGGGG + Intergenic
1162424044 19:10583376-10583398 GGTGGCTCCCATGCTTTGGGAGG + Intronic
1162643391 19:12031008-12031030 GGGGGTTGCAGTGGTGTGGCTGG + Intronic
1163667265 19:18609134-18609156 CAGGGCTCCAGTGGCTGGGGCGG - Intronic
1164485905 19:28655363-28655385 AGTGGCTCCACTGGTTTTGGGGG - Intergenic
1165120454 19:33555464-33555486 GGGGCATGCAGTGCTTTGGGTGG - Intergenic
1165317628 19:35066210-35066232 GGGGGCTCCCGAGGTCTGAGAGG - Intronic
1166133780 19:40763146-40763168 GGGGGCTGCTGTAGGTTGGGTGG + Intronic
1166643045 19:44511079-44511101 GGGGGCATCAGAGGTTTGGGTGG + Exonic
927145452 2:20162526-20162548 GGTCGGGCCAGTGGTTTGGGAGG + Intergenic
928019805 2:27695251-27695273 TGAGGTTCCAGTGCTTTGGGAGG - Intergenic
931288196 2:60850089-60850111 GGAGGCCCCTGTGGTGTGGGAGG - Intergenic
932880087 2:75493201-75493223 GCGGCCTCCAGTGGTTTCCGGGG + Exonic
935064816 2:99638438-99638460 GGGGACTCCGGTGGTGGGGGTGG + Intronic
935149891 2:100424547-100424569 GGTGGCTCCAGTGGCTGTGGTGG + Intergenic
935717997 2:105955361-105955383 GGGGCCTCCTGTGCTGTGGGTGG - Intergenic
937488642 2:122342203-122342225 TGGGGCTCCACTAGATTGGGTGG - Intergenic
939110633 2:138002818-138002840 AGTGGCTCTAATGGTTTGGGTGG + Intronic
940738260 2:157478538-157478560 GTGGGCTCCTGTAGTCTGGGAGG - Intronic
941895183 2:170621766-170621788 GGTGGCCCCAGTACTTTGGGAGG - Intronic
943864838 2:192916376-192916398 GGGGACTGCTGTGGGTTGGGGGG + Intergenic
946025711 2:216670624-216670646 GGGGGATACAGTTGTGTGGGGGG + Intergenic
947162213 2:227226093-227226115 GAGGTCTGCTGTGGTTTGGGGGG + Intronic
947262560 2:228240314-228240336 AGGGGCTGTGGTGGTTTGGGTGG - Intergenic
947525514 2:230874651-230874673 GGGGGCTCCTGTGGGCTGTGCGG - Intronic
947695537 2:232184405-232184427 GGGAGGTCCAGTACTTTGGGTGG + Intronic
948942532 2:241203516-241203538 GGGGGCCCAGGTGGTCTGGGGGG - Intronic
1169226677 20:3861346-3861368 GGTGGCTCCAGTGGGTCTGGGGG - Exonic
1172632485 20:36388400-36388422 GGGGGCTCCAGGAGCTGGGGAGG - Intronic
1173189463 20:40865027-40865049 GGGGGCTCCAGCCATCTGGGTGG - Intergenic
1174194285 20:48762007-48762029 GGGCGCAGCAGTGGGTTGGGTGG - Intronic
1174294978 20:49539536-49539558 GGGGGCCCCAGTGGGTGGGGGGG - Intronic
1175656588 20:60776261-60776283 GGGGGCTGCATTAGTTTTGGTGG + Intergenic
1176049032 20:63106896-63106918 GGCGGCTCCAGAGGGTGGGGTGG + Intergenic
1180013307 21:45065476-45065498 GGGGTCTCCTGTGGCCTGGGTGG - Intergenic
1180225705 21:46390957-46390979 GGAGGCACCCATGGTTTGGGAGG + Intronic
1181563144 22:23717265-23717287 GGGGGCGGCAGTGGCCTGGGCGG - Intergenic
1181986688 22:26804854-26804876 GGGTCCCCCAGTGGTTGGGGGGG - Intergenic
1182112317 22:27732483-27732505 GGGGGCTCCAGTAGCATGGTTGG + Intergenic
1182465560 22:30514091-30514113 CTGGGCGCCAGTGCTTTGGGGGG + Intergenic
1183310394 22:37106582-37106604 GGCCGCCCCAGGGGTTTGGGTGG - Intronic
1184988540 22:48152705-48152727 GGGGGCTCCAGGTGGCTGGGAGG - Intergenic
1185057394 22:48588068-48588090 GGGGGCTCCAGTGGTTTGGGGGG + Intronic
950503222 3:13377361-13377383 GGGGGCTCCTGTTGCTTTGGGGG + Intronic
951089512 3:18555981-18556003 GGAGGCTTCATTGGTTGGGGTGG + Intergenic
953711435 3:45274385-45274407 GGGGGCTTCAGTGCTCAGGGAGG - Intergenic
956378779 3:68644387-68644409 GGTGGCAACAGTGGTGTGGGAGG + Intergenic
959014800 3:101121536-101121558 GGGGGCTGCTGTAGTTTGGTGGG + Intergenic
960121065 3:113948583-113948605 GGGGGCTCCAGGGTTCTTGGAGG - Intronic
961344072 3:126250185-126250207 GGGGGCGGCAGTGGGTGGGGTGG + Intergenic
961781877 3:129325223-129325245 GGGGGCTCCTGTTGCTTTGGGGG + Intergenic
961794773 3:129401658-129401680 GGGGCCACCAGTGGTCAGGGTGG + Exonic
961805701 3:129487857-129487879 GGGGGCTTGAGGGGCTTGGGAGG + Intronic
962286911 3:134093899-134093921 GGCTGGGCCAGTGGTTTGGGAGG - Intronic
962962260 3:140321654-140321676 GAGGGCTCCAGGGTTTTGGTGGG - Intronic
963732435 3:148986661-148986683 AGGGGCTCCAGGGGTTAGGGAGG + Intergenic
964105444 3:153034735-153034757 GGGGTCCCCAGTGGTCTAGGTGG - Intergenic
966082587 3:176022010-176022032 GGGGACTGTTGTGGTTTGGGGGG + Intergenic
968047163 3:195630927-195630949 GGAGGCTCCAGTGGCTTTGGTGG - Intergenic
968307484 3:197659117-197659139 GGAGGCTCCAGTGGCTTTGGTGG + Intergenic
968515527 4:1013976-1013998 AGGGGCCTCTGTGGTTTGGGTGG + Intronic
969464904 4:7350566-7350588 GGGGGACCCAGTGGATTGGCAGG + Intronic
969467890 4:7368475-7368497 GGGGGACCCAGTGGATTGGCAGG - Intronic
969516174 4:7649338-7649360 GGGGGGTCCAATGGTATCGGGGG + Intronic
971169992 4:24224143-24224165 GGGGGCTGCAGTGGGTTGGGAGG + Intergenic
971231068 4:24800431-24800453 GGGGGCTCCGAGGGTTGGGGCGG - Exonic
973797960 4:54448237-54448259 GTGGGCTCAGGTGGTTTTGGGGG + Intergenic
975402325 4:73952409-73952431 AGGGGCTGCAGTGGATGGGGAGG + Intergenic
981038152 4:140193705-140193727 GAAGCTTCCAGTGGTTTGGGTGG + Intergenic
981337067 4:143580423-143580445 GGAGGCACCAGTGGTAGGGGTGG - Intronic
982871288 4:160582021-160582043 GGGGACTGCTGTGGGTTGGGGGG - Intergenic
982893390 4:160884259-160884281 GGGGCCTGCAGTGGGGTGGGGGG + Intergenic
984508840 4:180654419-180654441 GTGGACGCCAGTGGCTTGGGTGG - Intergenic
985484233 5:139928-139950 GGGGCCTGCTGTGGCTTGGGTGG - Intergenic
985706048 5:1401941-1401963 GGGGGCTTCTGTGGAGTGGGAGG - Intronic
985744441 5:1638206-1638228 GGAGGCTCCAGTGGCTTTGGTGG + Intergenic
986743510 5:10724780-10724802 GAGGGCTCCAGTGACTTGGAGGG + Intronic
990070223 5:51773387-51773409 GGGGAATCCAGTGGTATGTGAGG + Intergenic
990740886 5:58911647-58911669 GGGGACTTGGGTGGTTTGGGTGG - Intergenic
994450064 5:99929975-99929997 GTGGGCAGCAGAGGTTTGGGTGG + Intergenic
995868970 5:116724481-116724503 GGGCGCTGCAGTGGATTTGGAGG + Intergenic
996048856 5:118909412-118909434 GGGGTCTGCAGTGGCTTGGCTGG - Intronic
996350303 5:122532974-122532996 GTGGTTGCCAGTGGTTTGGGTGG - Intergenic
997346961 5:133199106-133199128 GGGGACCACAGTGGTGTGGGTGG - Exonic
1000628665 5:163567241-163567263 GTGGGCTCCAAGGGTTGGGGAGG - Intergenic
1001425515 5:171619586-171619608 GAGGGCCCCAGTGGGTTGGGGGG + Intergenic
1001600688 5:172926369-172926391 GGGGGCTCCAGCGGATTTGTGGG - Intronic
1002299997 5:178252572-178252594 GGGGGCCCCTGTGGTCCGGGAGG + Exonic
1002377915 5:178801443-178801465 GGGGTCTTCAGTGGAGTGGGAGG - Intergenic
1002556504 5:180046019-180046041 GGAGGCTCCAGTGGCGTGGACGG + Intronic
1004084898 6:12437225-12437247 GGCTGCTTCAGTGTTTTGGGTGG - Intergenic
1004407073 6:15342984-15343006 GTGGTATCCAGTGTTTTGGGCGG + Intronic
1004452345 6:15758804-15758826 GGGGGCGGCACTCGTTTGGGAGG + Intergenic
1006984382 6:38167327-38167349 GGGGGGTACAGTGGCCTGGGCGG + Intergenic
1009999227 6:70931173-70931195 GGGGCCTGTAGTGGGTTGGGGGG + Intronic
1016335329 6:142998774-142998796 GGGGCCTGTAGTGGTGTGGGGGG - Intergenic
1018849912 6:167579477-167579499 GGGGGCTGGAGAGATTTGGGGGG - Intergenic
1019413756 7:918176-918198 GGTGGTTCCAGCAGTTTGGGAGG - Intronic
1021804835 7:24344511-24344533 GGTGGCTCCAGCACTTTGGGAGG + Intergenic
1022840407 7:34158846-34158868 TCTGGCTCCAGTGGTTAGGGGGG + Intergenic
1025736576 7:64154133-64154155 GGGGACTGTAGTGGGTTGGGGGG - Intronic
1026287178 7:68973596-68973618 GCCGGGTCCAGTGCTTTGGGAGG - Intergenic
1029287868 7:99478630-99478652 GAGGGCTGCAGTGGTGTGGGAGG + Intronic
1029661405 7:101964639-101964661 ACTGGCTCCAGTGATTTGGGTGG + Intronic
1030002644 7:105081466-105081488 GTGGGCTCTAGGGGTTGGGGTGG + Intronic
1030710173 7:112740134-112740156 GGGGCATGCAGTGGTTTGGCTGG + Intergenic
1033537254 7:142323717-142323739 GGGGGCTGCAGGGGTTGGAGTGG + Intergenic
1035224545 7:157426094-157426116 GGGGGTGCCAGGGGTTGGGGAGG + Intergenic
1035382019 7:158446431-158446453 GGGGGCAGCTGTGGCTTGGGTGG - Intronic
1037808076 8:22069465-22069487 GGGGGTTCCAGTGGTTCTGGGGG - Exonic
1038424927 8:27458799-27458821 GGGGGCTCCTGGGGGTGGGGAGG + Exonic
1038540355 8:28385883-28385905 GGGGGGTCCGGGGGTCTGGGAGG - Intronic
1039711791 8:40062274-40062296 GGTGGCTGCAATGGGTTGGGCGG - Intergenic
1039764781 8:40616725-40616747 GGGGCCTGCCGTGGGTTGGGGGG + Intronic
1041016807 8:53599378-53599400 GGCAGCTCCAGTTGTTTGTGTGG - Intergenic
1043353085 8:79384522-79384544 GGGGGCTCCAGTGGAGAGGAAGG + Intergenic
1043966406 8:86482602-86482624 GGAGGCTTCAGTGATGTGGGAGG - Intronic
1046148137 8:110189205-110189227 TTGGGCCCCAGTGGTTTTGGTGG + Intergenic
1049686060 8:143939778-143939800 GGGGGCTGCAGTGGTCGGGGTGG - Intronic
1051113062 9:13662142-13662164 GGGGCCTGTAGGGGTTTGGGGGG - Intergenic
1052763269 9:32614339-32614361 GTGGGCTGCAGTGGTGTTGGTGG - Intergenic
1055923691 9:81488726-81488748 GGGCGCTCCCGTAGCTTGGGAGG - Intergenic
1056076201 9:83043382-83043404 GGGGTCTGCAGTGATTGGGGGGG + Intronic
1056740026 9:89246442-89246464 GGGGCCTCCAGGGGATTGAGGGG - Intergenic
1057495000 9:95553640-95553662 GGGGGCTGTAGTGGGTTGAGTGG + Intergenic
1057788617 9:98107629-98107651 GGGGGATACAGTGGGTAGGGAGG + Intronic
1058544229 9:106043172-106043194 TGGGGATCCAGTGATGTGGGGGG - Intergenic
1060824493 9:126680137-126680159 GGGGGCACCAGGGTTATGGGGGG - Intronic
1061013963 9:127971409-127971431 GGGGGCATCAATGGTTTGGGTGG - Intronic
1061666601 9:132163630-132163652 GGGGGCTCCCGGGGCTAGGGGGG - Intronic
1061971301 9:134046914-134046936 GGGGGTTCCAGTGTTTGGGCTGG - Intronic
1062057218 9:134474930-134474952 AGGGGCTCCTGGGGTGTGGGAGG - Intergenic
1062184635 9:135211471-135211493 GGGGGCTCCTGTGGAGTGGGAGG - Intergenic
1062376228 9:136263075-136263097 GGGGGCAGCGGTGGATTGGGTGG - Intergenic
1062566812 9:137167253-137167275 GGGGGCTCCTTTGGGTAGGGTGG + Intronic
1062610655 9:137371917-137371939 GGGGCCTGCAGTGGGTAGGGAGG - Intronic
1062625382 9:137440011-137440033 GGGGGCTCTCCTGGTCTGGGGGG - Intronic
1062625489 9:137440322-137440344 GGGGGCTCTCCTGGTCTGGGGGG - Intronic
1062625536 9:137440451-137440473 GGGGGCTCTCCTGGTCTGGGGGG - Intronic
1062625570 9:137440542-137440564 GGGGGCTCTCCTGGTCTGGGGGG - Intronic
1186410986 X:9344178-9344200 GGGTGCTCCAGGTGTCTGGGGGG + Intergenic
1187261640 X:17690031-17690053 GGGGCCTCCTGGGGTTTGGAAGG + Intronic
1192153770 X:68727970-68727992 GTGGGCCCCAGTGGTGTGGATGG + Intergenic
1195343338 X:103925957-103925979 GGGGGCTCCTGTGGATTTAGTGG + Intronic
1200135833 X:153874132-153874154 GGGGGCTGGAGTGGCTGGGGAGG + Intronic
1200163899 X:154023013-154023035 CTGGGCTCCACTGCTTTGGGTGG + Intronic
1201062671 Y:10061412-10061434 AGTGACTCCAGTGGTTGGGGTGG + Intergenic
1201984272 Y:19947600-19947622 GGTGGCTGCAGTGGGTTGGGTGG + Intergenic
1202111928 Y:21429711-21429733 AGTGACTCCAGTGGTTGGGGTGG + Intergenic