ID: 1185057395

View in Genome Browser
Species Human (GRCh38)
Location 22:48588072-48588094
Sequence GCTCCAGTGGTTTGGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 239}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057381_1185057395 10 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057388_1185057395 -4 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057378_1185057395 19 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057382_1185057395 9 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057383_1185057395 3 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057379_1185057395 12 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057380_1185057395 11 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239
1185057376_1185057395 29 Left 1185057376 22:48588020-48588042 CCTGCAGGTGCCAGGAGCCCCCT 0: 1
1: 0
2: 4
3: 50
4: 406
Right 1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057395 Original CRISPR GCTCCAGTGGTTTGGGGGGT TGG Intronic
901671759 1:10860249-10860271 TCCCCAGTGATTTGGGGGGAAGG + Intergenic
903461035 1:23521214-23521236 GAACCAGAGGTTTGGGGGTTGGG + Intronic
903905232 1:26680992-26681014 GCTCCAGAGGCTGGGGTGGTAGG + Intergenic
903933361 1:26877415-26877437 TCACCAGTGGTTTGGGCAGTTGG - Exonic
907424268 1:54369286-54369308 GCTCCACGGGATTGGGGGGACGG + Intronic
908685889 1:66719308-66719330 GCTCCCATGGTTAGGGGGCTGGG - Exonic
908944346 1:69475725-69475747 ACTCCAGTTGTTTGGGGGAACGG + Intergenic
909502310 1:76348493-76348515 TCTCCAGTGGTTTGGATGATAGG - Intronic
910368282 1:86489224-86489246 GCTCCAGTGAACTGGGGAGTGGG + Intronic
912648494 1:111417668-111417690 GATCCAGAGGTCTGGGGTGTTGG - Intronic
913031010 1:114902563-114902585 GCTCCTGCCGTTTGCGGGGTGGG - Intronic
913062395 1:115220338-115220360 GCTTCCGGGGTTGGGGGGGTGGG + Intergenic
913231532 1:116744280-116744302 CTTCCAGTGGTTGGGGGGGAGGG + Intergenic
914901076 1:151711446-151711468 GATCCAGAGATTTGGGGGGCGGG - Intronic
915448240 1:155987103-155987125 GCGCCTGTGGTTTGGGGGAGAGG - Intronic
915868185 1:159528394-159528416 GCTCCAGTGTTTCAGGTGGTGGG + Intergenic
917214368 1:172662887-172662909 GCTCGGGTGGTTTGCGGTGTAGG + Intronic
919455169 1:197812649-197812671 GCTAATGTGGTTGGGGGGGTGGG + Intergenic
920532918 1:206717517-206717539 GCAGCAGTGGTTTGGGGCTTTGG + Intronic
922110049 1:222547681-222547703 GCCCCAGGGGTTTGGGTGCTGGG - Intronic
922766075 1:228157310-228157332 GCTGCAGGGGCTTGGGGGCTAGG + Intronic
1068745734 10:60528760-60528782 GCTGCAGTGGTTGGGGAGGAGGG - Intronic
1070707229 10:78648713-78648735 GCTTCAGTGGTTGAGGGGGCGGG - Intergenic
1070824659 10:79384239-79384261 CCTCCAGTGGTCTGGGGCCTGGG + Exonic
1072538183 10:96378933-96378955 CCTCCAGTTGTTGGGGGGGCGGG - Intronic
1073288027 10:102400068-102400090 GGTGCAGTGGTCTGGGGGTTGGG - Exonic
1074025413 10:109628592-109628614 GCTCCAGTGGATATGTGGGTTGG + Intergenic
1076202846 10:128572015-128572037 GCTCCGTTGGTTTGGGGGTATGG - Intergenic
1076698044 10:132256604-132256626 TCTCCAGCGGTTTGGGGAGCTGG - Intronic
1077410990 11:2403802-2403824 GCTCCTGGGGTGTGGGGTGTGGG + Exonic
1077552736 11:3208546-3208568 GCTCCACTGGTTTGGTCTGTAGG + Intergenic
1078130790 11:8612596-8612618 GCTCCAGTTGTTTCTGGAGTTGG - Exonic
1078705151 11:13736578-13736600 GCTGAAGTGGTTAGGAGGGTGGG + Intergenic
1078745369 11:14108866-14108888 GCTCCTGGGGGTTGGGTGGTAGG - Intronic
1082774424 11:57234649-57234671 GTTGCAGTGGATTGGGGGGTGGG + Exonic
1088906527 11:114159254-114159276 GCTCCAGAGGCTTTGGGAGTTGG + Intronic
1089507315 11:118972191-118972213 TCGGGAGTGGTTTGGGGGGTGGG + Intronic
1091750524 12:3019027-3019049 GGTCCAGTGGTCTGTGTGGTAGG - Intronic
1092103724 12:5905841-5905863 GGTCCAGTGTTTTGGGGATTTGG - Intronic
1092232019 12:6781191-6781213 GCTTCAGTGGGTGGGTGGGTGGG + Intergenic
1096101203 12:48971454-48971476 CCTCCAGTGGTTTGGGTGCGGGG + Exonic
1096137327 12:49213267-49213289 GCTCCAGTTCTTGAGGGGGTGGG + Intronic
1097902653 12:64888862-64888884 AGTGCAGTGGTTTGGGGGTTGGG - Intergenic
1098581577 12:72105261-72105283 GCTCAAGTGGTTGGGGAGGTGGG + Intronic
1100635056 12:96427346-96427368 GCTCCAGGGGGTTGGGGGGCAGG + Intergenic
1101571678 12:105959311-105959333 TCCCCAGAGGTTGGGGGGGTGGG + Intergenic
1102466624 12:113134279-113134301 GCTGCAGTGTTTTGGGGGTTGGG + Intronic
1104691586 12:130830155-130830177 GGTCTTGTGGTGTGGGGGGTAGG - Intronic
1105211439 13:18259361-18259383 GCACCAGTGGTGTTGGGGGCAGG + Intergenic
1106178096 13:27348316-27348338 CCTTCAGTGGTTTGGGGTGGGGG + Intergenic
1108203725 13:48067185-48067207 GCAACAGTGGTTGGGGGGGGAGG - Intronic
1108810259 13:54214228-54214250 GCTCCTGTAGTTTGGTGAGTAGG - Intergenic
1111962465 13:94826191-94826213 ACTCTGGGGGTTTGGGGGGTGGG - Intergenic
1114417871 14:22556412-22556434 CCTCCAGGTGTTTGGGGGCTGGG + Intergenic
1115253363 14:31372932-31372954 GGTCCAGGGGTGTGGGAGGTGGG - Intronic
1115328188 14:32165803-32165825 GCTGCTGAGGTTTGGGGGATAGG - Intergenic
1115646450 14:35371577-35371599 GCCCAGGTGGTTTGGGGGATGGG + Intergenic
1121024350 14:90603657-90603679 ATTCCAGTGGTTTGTAGGGTTGG + Intronic
1122338138 14:101007235-101007257 GCAGCAATGGGTTGGGGGGTGGG - Intergenic
1123932340 15:25177922-25177944 ACTCCAGCGGGTTGGGGGGCAGG + Intergenic
1126311577 15:47323134-47323156 GCTCCCGTAGTTTGGGGAGTAGG + Intronic
1127999174 15:64175002-64175024 ACTCTAGTGGGGTGGGGGGTGGG - Intronic
1129307539 15:74678079-74678101 GTGCCAGTGGTTAGTGGGGTGGG + Intronic
1129609660 15:77043114-77043136 GCTCCTGTGGCTTGGCGGGGGGG + Exonic
1129704711 15:77787555-77787577 GCTTCAGGGCTGTGGGGGGTGGG + Intronic
1129799739 15:78405340-78405362 GCTGCAGTGGTGGTGGGGGTTGG - Intergenic
1130589803 15:85204556-85204578 GCTGCAGGGGGGTGGGGGGTGGG + Intergenic
1131047548 15:89325770-89325792 GCCCCAGGGCTTTGGAGGGTGGG - Intronic
1131899012 15:97067568-97067590 GCTCCAGTGGAATGCTGGGTGGG + Intergenic
1132710890 16:1266751-1266773 GCTCCAGAGGCTTGGAGGGAGGG - Intergenic
1132999482 16:2841780-2841802 GCACCAGAGGTTGGGGGGGCGGG + Intergenic
1133956315 16:10446934-10446956 CCTCCAGTGGTTGGGGGGCAGGG - Intronic
1136520876 16:30795014-30795036 GCTCCAGTGGCCTGGGGTGGGGG - Intergenic
1138303734 16:55955787-55955809 ATTCCAGTGGGTTTGGGGGTGGG + Intronic
1139488402 16:67272058-67272080 GCTCCATTGCTCTGGGGGCTGGG + Exonic
1140195045 16:72848644-72848666 GTTCCAGTGGCATAGGGGGTGGG - Intronic
1140238628 16:73181454-73181476 GATACAGTGGTTTGGGGTGATGG - Intergenic
1141187037 16:81795497-81795519 GATCCAGTGGGATTGGGGGTGGG + Intronic
1141375121 16:83523486-83523508 GCTCCAGTGGATTCCAGGGTGGG - Intronic
1142177392 16:88651401-88651423 TCTCCAGAGCCTTGGGGGGTGGG + Intergenic
1142230716 16:88899066-88899088 GCTGCTGTGGGGTGGGGGGTGGG - Intronic
1142509942 17:386738-386760 GCTCCTGGGGGCTGGGGGGTGGG - Intergenic
1143876841 17:9998067-9998089 TCCCCAGAGGTTTGTGGGGTAGG + Intronic
1144661638 17:17074362-17074384 CCTCCCGTGGTCTGGGGAGTGGG + Intronic
1145081858 17:19900843-19900865 GCTTCAGTGGTATGAGGGGTGGG + Intergenic
1145921768 17:28614995-28615017 GCTCCAGGGACTTGTGGGGTGGG - Exonic
1145973140 17:28968641-28968663 GCTCCAGTAGTTTGGGTGGAGGG + Intronic
1146989753 17:37258741-37258763 CCTCCAGTGGTTTGCAGGGATGG - Intronic
1147158034 17:38554560-38554582 GCTTCAGCGGTTTGGAGGGCAGG - Intronic
1148476034 17:47929292-47929314 CCTCCAGGGGTTGGGGAGGTGGG - Intergenic
1149194954 17:54108489-54108511 GCAACAGTGTTTTGGGAGGTAGG - Intergenic
1149517555 17:57292117-57292139 GGTCCAGTGGATTGGGGGCTAGG + Intronic
1149596482 17:57867494-57867516 CCTCCAGAGCTTTGAGGGGTGGG - Intronic
1149943679 17:60898839-60898861 GCTGCAGTGGTCTGGGGGTTCGG + Intronic
1152251199 17:79213514-79213536 GCCCCACTGGTTGGCGGGGTGGG - Intronic
1154170328 18:12046692-12046714 GTTCCAGTGGAGTGGGGAGTTGG - Intergenic
1154305569 18:13228240-13228262 CCTCCAGTGGTCTGGCCGGTGGG + Intronic
1155541004 18:26868150-26868172 ATACCAGTGGTGTGGGGGGTGGG - Intergenic
1155936869 18:31763591-31763613 GTCCCAGTGGTTTGGGTGGTGGG - Intergenic
1156664496 18:39389695-39389717 CCTCCCTTGGCTTGGGGGGTGGG - Intergenic
1157752407 18:50191380-50191402 GCTTCATTGGTGTGAGGGGTTGG - Intronic
1158188238 18:54796147-54796169 CCTCCAGGGGTTTGAGGAGTGGG - Intronic
1158573555 18:58616895-58616917 GTTCCGGGGGCTTGGGGGGTGGG + Intronic
1160554797 18:79718071-79718093 GCTCCAGTCTGTTGGGGGGATGG + Intronic
1160846319 19:1167712-1167734 GCTCCAGGGGGTGGGGGGGACGG + Intronic
1161805604 19:6441481-6441503 GCTCCTGTGGTTGGGGTGTTGGG + Exonic
1161805635 19:6441611-6441633 GATCCAGTGATTTGGGGGATGGG + Exonic
1163511113 19:17735599-17735621 GCTGCAGAGGTGTGGAGGGTGGG - Intergenic
1164485903 19:28655359-28655381 GCTCCACTGGTTTTGGGGGTGGG - Intergenic
1165705412 19:37972864-37972886 GCTCCACTAATTTGGGGGGAAGG - Intronic
1166408596 19:42541257-42541279 GTTCCAGTGGTGTGGGGGTGAGG + Intronic
1166559082 19:43720044-43720066 GCTGCAGTTGCCTGGGGGGTGGG + Intergenic
1166833646 19:45653624-45653646 GCTCAAGAGGATTGGCGGGTGGG - Intergenic
1166884551 19:45952509-45952531 GCTCCTGTGGATTAGGGGGAGGG + Intronic
926185463 2:10687232-10687254 GCTCCAGTGGAGTGGTGGGGAGG - Intronic
927038108 2:19202088-19202110 GATCCAGGTGTTTGGGGAGTTGG + Intergenic
927498413 2:23565656-23565678 ACTCCAGTGGATGGTGGGGTGGG + Intronic
928094637 2:28396273-28396295 GCTCCAGTGACTTTGGGGGTGGG + Intronic
929392948 2:41493030-41493052 GCTCTGGTGCTTTGGGGGGAAGG + Intergenic
929949974 2:46401320-46401342 GCCCCAGAGGTTGGGGGGATTGG + Intergenic
931265192 2:60654141-60654163 GCTCCACAGGTTTTTGGGGTGGG + Intergenic
931810026 2:65845612-65845634 GCTCCAGTAGTTCGGGCAGTTGG + Intergenic
933530175 2:83499073-83499095 TATCCAGTGGTTTGAGGAGTGGG + Intergenic
933979306 2:87537738-87537760 CCTCCTGGGGCTTGGGGGGTGGG - Intergenic
934477661 2:94603974-94603996 GCTCCTGTGTGTTGAGGGGTGGG + Intronic
934715121 2:96538582-96538604 GCTCCAGCAGTTTGGGGAGGGGG - Intronic
936314520 2:111413053-111413075 CCTCCTGGGGCTTGGGGGGTGGG + Intergenic
937279063 2:120704974-120704996 GCTCCAGTGTTGTGGGGGAAGGG + Intergenic
937282639 2:120730861-120730883 GCTTCTGTGGTTGGCGGGGTGGG + Intergenic
937991068 2:127662622-127662644 GCTCTTGTGGGGTGGGGGGTGGG + Intronic
942301771 2:174569847-174569869 GCTTCAGTGTTATGGGGAGTGGG - Intronic
943100670 2:183482064-183482086 GCGGCAGTGGGGTGGGGGGTAGG + Intergenic
943869477 2:192975646-192975668 GACCCAGTGGCTTAGGGGGTAGG - Intergenic
946066971 2:216996371-216996393 TCTCCAGTGTTTTGGGGTTTGGG - Intergenic
946162033 2:217841289-217841311 GCTCCCCTGGGGTGGGGGGTGGG - Intronic
946305412 2:218854234-218854256 GGTCCAGTGGATTTGGGGATGGG - Intergenic
946403753 2:219482385-219482407 GCTCCAGATGTCTGGGGTGTTGG + Intronic
947162215 2:227226097-227226119 TCTGCTGTGGTTTGGGGGGTGGG + Intronic
947432592 2:230044018-230044040 ACTTCGGTGTTTTGGGGGGTGGG - Intronic
947436864 2:230080371-230080393 GATCCAGAGGTCTGTGGGGTTGG + Intergenic
948914066 2:241021443-241021465 GCTGCAGTGGATGGGGGGCTGGG - Intronic
1169145938 20:3252366-3252388 GCACCATTGATTTTGGGGGTCGG - Exonic
1169226676 20:3861342-3861364 GCTCCAGTGGGTCTGGGGGACGG - Exonic
1169282148 20:4277143-4277165 GGACCAGTGGTATGAGGGGTTGG - Intergenic
1170357516 20:15508298-15508320 GGGTGAGTGGTTTGGGGGGTTGG + Intronic
1174174585 20:48636740-48636762 GACCCAGGGTTTTGGGGGGTGGG - Intronic
1174194283 20:48762003-48762025 GCAGCAGTGGGTTGGGTGGTGGG - Intronic
1174410766 20:50333615-50333637 ACTGCAGTGGCTTTGGGGGTAGG - Intergenic
1175835625 20:61992465-61992487 GCCCCAAGGGCTTGGGGGGTGGG - Intronic
1175925787 20:62470735-62470757 GCTTCAGTGTTCTTGGGGGTGGG + Intronic
1175980835 20:62737861-62737883 GGTGCAGGGGTGTGGGGGGTGGG - Intronic
1179792655 21:43764467-43764489 GCTCCAGTGGCGTGGGGGTGGGG + Intergenic
1180764793 22:18340077-18340099 GCACCAGTGGTGTTGGGGGCAGG - Intergenic
1180814236 22:18779607-18779629 GCACCAGTGGTGTTGGGGGCAGG + Intergenic
1181200422 22:21213942-21213964 GCACCAGTGGTGTTGGGGGCAGG + Intronic
1182316281 22:29449445-29449467 GCTCCAGGGGATTGGTGGGCAGG + Intergenic
1183055814 22:35304933-35304955 GCCTCAGTGGTTGGGGTGGTGGG + Intronic
1184667787 22:45997714-45997736 GTTCCAGTGGTGGAGGGGGTGGG - Intergenic
1185057395 22:48588072-48588094 GCTCCAGTGGTTTGGGGGGTTGG + Intronic
1203226416 22_KI270731v1_random:80982-81004 GCACCAGTGGTGTTGGGGGCAGG - Intergenic
1203264334 22_KI270734v1_random:5294-5316 GCACCAGTGGTGTTGGGGGCAGG + Intergenic
950058333 3:10047147-10047169 GGGCCAGTGGTTTGGGGTTTGGG + Intronic
952149896 3:30578121-30578143 AGTTCAGTGGGTTGGGGGGTGGG - Intergenic
953562178 3:43999674-43999696 GCTCCTGCGGGTTGGGGGCTCGG + Intergenic
954595881 3:51824000-51824022 GCCCCAGTGGTTTTTAGGGTGGG - Intronic
955145523 3:56314494-56314516 ATTCCAGTGGGTGGGGGGGTGGG + Intronic
955387236 3:58489404-58489426 GATCTGTTGGTTTGGGGGGTTGG - Intergenic
955574676 3:60347663-60347685 TCACCACTGGTTTGGGGGGGGGG + Intronic
955775832 3:62432048-62432070 ACTTCAGGGTTTTGGGGGGTGGG - Intronic
956088381 3:65637899-65637921 ACTCTCATGGTTTGGGGGGTGGG - Intronic
959011277 3:101079280-101079302 TCTCAAGTGGTTGGTGGGGTTGG - Intergenic
961387604 3:126531200-126531222 GGTCCAGTAGGTTGGGGGGTGGG - Intronic
961535906 3:127570378-127570400 GCTCCAGTGCTCTGGGTGGGTGG + Intergenic
961994626 3:131228917-131228939 GCTGCACTTATTTGGGGGGTTGG + Intronic
962316036 3:134360064-134360086 GCACCTGAGGTTGGGGGGGTGGG - Intronic
963941634 3:151101691-151101713 GCCCCAGCAGGTTGGGGGGTGGG + Intronic
965609186 3:170526837-170526859 ACTCCACTGGTTTGGTGCGTAGG + Exonic
966854650 3:184185849-184185871 GCACCCGTGGTCTGGCGGGTGGG - Intronic
968131769 3:196196480-196196502 GCCCCTGGGGTTGGGGGGGTCGG - Intergenic
969539534 4:7778341-7778363 GCTCCCGTGGTTGGTGCGGTTGG - Intronic
970086784 4:12356974-12356996 GCTCATGTGATTTGGGGGATAGG - Intergenic
970209753 4:13696913-13696935 GCTCCAGAGGCTTTGTGGGTGGG + Intergenic
970423220 4:15924186-15924208 GCTCCAGTGGTGTGTGGTGGTGG + Intergenic
971323953 4:25628855-25628877 GTTCCAGTGACTTGGGAGGTGGG - Intergenic
972953379 4:44358053-44358075 GCACCTGGGCTTTGGGGGGTGGG - Intronic
973643200 4:52923585-52923607 ACTGCAGGGGATTGGGGGGTAGG + Intronic
975726341 4:77295225-77295247 GCTCCACTAGGTGGGGGGGTTGG + Intronic
977563349 4:98556104-98556126 GTCCCAGTGGTTTGGGTAGTAGG - Intronic
981038154 4:140193709-140193731 CTTCCAGTGGTTTGGGTGGCGGG + Intergenic
981216228 4:142171838-142171860 GCTGCAGTGATTTTGGTGGTGGG - Intronic
981567060 4:146113118-146113140 GATCCAGTGGCTTGGGAGTTTGG - Intergenic
983320341 4:166189338-166189360 GCTCCAGTAGTTTGGCAAGTGGG + Intergenic
983960795 4:173751478-173751500 GCTTCAATGGGTTTGGGGGTGGG + Intergenic
984022898 4:174507505-174507527 GCTCCAGTGATTTGGGAAGTTGG - Intronic
985545724 5:508072-508094 GCTCCACTGGTGTGAGGGGCGGG - Intronic
985919252 5:2956841-2956863 GCTCCACTGGTTGTGGGGGCAGG + Intergenic
987312002 5:16690319-16690341 GCTGCAGTGGGGTGGGGAGTGGG + Intronic
987620074 5:20329095-20329117 GCTCCTTTGTTTTGGGGAGTTGG - Intronic
989693210 5:44170167-44170189 GCTCCCTTGGTGTGGGGGGGTGG + Intergenic
993049737 5:82912697-82912719 GCACCTGTGGTTGGTGGGGTGGG + Intergenic
993938127 5:94027653-94027675 GCTCCAGTGGTTAGGAAGCTAGG + Intronic
996834046 5:127771564-127771586 GCAGAAGTGGATTGGGGGGTAGG + Intergenic
997103442 5:130993585-130993607 GCTCAAGTGGTCTGGGGACTAGG + Intergenic
997274455 5:132573160-132573182 TCTCATGTGGTTTGGGGGGCAGG + Intronic
998481625 5:142467926-142467948 GGTCCAGGGGGTTGGGGGGATGG - Intergenic
999384664 5:151145779-151145801 GGTGCAGTGGTTTGGGGGAGAGG - Intronic
999848552 5:155512435-155512457 GCTCCATGGGTTGGGGAGGTTGG - Intergenic
1000615530 5:163421755-163421777 GCTCAAGTGGCTTGGAGGCTGGG - Intergenic
1000628663 5:163567237-163567259 GCTCCAAGGGTTGGGGAGGTGGG - Intergenic
1001546743 5:172575098-172575120 TTTCAAGGGGTTTGGGGGGTGGG - Intergenic
1002089595 5:176796700-176796722 GCTCCAGGGCTCTGGGGGTTGGG + Intergenic
1003358713 6:5402379-5402401 GCTCCTTAGTTTTGGGGGGTGGG + Intronic
1005829165 6:29656943-29656965 GCTCCATTGCTCTGGGGGGGTGG + Intergenic
1006376493 6:33674282-33674304 GCTGCAGGGGTGTGTGGGGTTGG + Intronic
1006789708 6:36691886-36691908 TCTCAAGTTGTTTGGGGAGTGGG - Intergenic
1007688175 6:43679840-43679862 GTTGCAGTGGGTTGGGGGTTGGG + Intronic
1007714907 6:43850352-43850374 GCCCCAGTTGCCTGGGGGGTGGG + Intergenic
1009281142 6:61753393-61753415 GCTCATATGGTTTGGGGGGGTGG - Intronic
1009418465 6:63440718-63440740 GCTCCAGGGTTTTGATGGGTGGG - Intergenic
1014197271 6:118574962-118574984 CCTCCAGTTGGTTGGGGGGCGGG + Intronic
1015457405 6:133442553-133442575 GTTCTAGTAGTTTGGGGGTTTGG + Intronic
1016085626 6:139910859-139910881 GATCCAGTGGTTTGGGAGTTTGG + Intergenic
1017808630 6:157967666-157967688 CCTCCAGGGGTGTGTGGGGTGGG + Intergenic
1020093738 7:5356222-5356244 GTTCCAGTGGGTAGGTGGGTCGG + Intronic
1021040787 7:15859388-15859410 TTTCTAGTGGTTTGGGGGTTGGG - Intergenic
1022804481 7:33807880-33807902 ACTCCAGTGGGGCGGGGGGTGGG + Intergenic
1022817138 7:33924527-33924549 GCTCCAGTGGAGAGGGGGTTGGG - Intronic
1023702337 7:42905048-42905070 ACTCCAGTGGTTCTGGGGGCGGG - Intergenic
1026126839 7:67586760-67586782 CATCCAGTGGTGTGGGGGCTGGG + Intergenic
1030389823 7:108913589-108913611 GCTGGAATGGTTTGGGGGCTGGG - Intergenic
1032075417 7:128833617-128833639 GCTGCAGGGGTTGGGGGGGGCGG - Intronic
1032853708 7:135816658-135816680 GCCCCAGTGGTTGGGGGTTTGGG + Intergenic
1036723802 8:11201356-11201378 GCTCCGGAGGTTGGGGGGGAGGG + Exonic
1037601561 8:20400563-20400585 ACTCCAGTGGTTTGGGGTGGAGG + Intergenic
1038037559 8:23699447-23699469 GCTGAAGGGGTTTGGGAGGTGGG - Intergenic
1038245527 8:25851221-25851243 GCTCCAGGGGTTTGGTCTGTAGG + Intronic
1038715280 8:29985887-29985909 TCTCCAGTAGTTTAGGGGATAGG - Intergenic
1039647725 8:39305686-39305708 GATACACTGGTGTGGGGGGTTGG + Intergenic
1041669663 8:60479680-60479702 GCTCCCGTGGTTGTGGTGGTGGG - Intergenic
1041725427 8:61013194-61013216 CCTCCAGTGGTTATGGGGGAGGG - Intergenic
1042089236 8:65140728-65140750 GCTCCAGGCATTTAGGGGGTTGG - Intergenic
1043520105 8:81035537-81035559 GCTCCAGTGGACTGTGGGGTAGG + Intronic
1046148138 8:110189209-110189231 GCCCCAGTGGTTTTGGTGGTAGG + Intergenic
1049593722 8:143474027-143474049 GCTGCCGTGGGTTGGGGGATAGG - Intronic
1050855528 9:10349244-10349266 TCTCCAGTGGGGTGGGGGGTGGG + Intronic
1052871027 9:33506699-33506721 GCCCCAGTGACTTGGGGGGCTGG + Intergenic
1053000295 9:34574121-34574143 GGTCCAGAGGCTTGGGGGGTGGG + Intronic
1053072491 9:35109486-35109508 GCACCCGTGGTTTGGGGTTTTGG - Exonic
1055305402 9:74924065-74924087 GCTCCATGGGGGTGGGGGGTGGG + Intergenic
1057246023 9:93454400-93454422 GGTACAGTGATGTGGGGGGTTGG + Intronic
1057687488 9:97248648-97248670 GCCCCAGTGACTTGGGGGGCTGG - Intergenic
1059138336 9:111828905-111828927 GCTTCAGTGCTTTGGGTTGTGGG - Intergenic
1061506012 9:131032239-131032261 GCTGCTGTGGGGTGGGGGGTGGG + Intronic
1062253114 9:135608211-135608233 GCTCCAGGGGTTCTGGGGGCAGG + Intergenic
1186410990 X:9344182-9344204 GCTCCAGGTGTCTGGGGGGGGGG + Intergenic
1186803955 X:13120690-13120712 TCTCAAGAGGTTTGGGGGGACGG - Intergenic
1193165677 X:78277476-78277498 ACTTCAGGGGTGTGGGGGGTTGG - Intronic
1193369359 X:80675987-80676009 ACTACAGTTTTTTGGGGGGTGGG - Exonic
1195371094 X:104174020-104174042 ATTCCAGTGGTTTGGGAGGCTGG + Intronic
1197648667 X:129042344-129042366 TCCCCATTGGGTTGGGGGGTGGG + Intergenic
1198862781 X:141088719-141088741 GCTCCAGCTGTTTGCTGGGTGGG - Intergenic
1198899912 X:141498667-141498689 GCTCCAGCTGTTTGCTGGGTGGG + Intergenic