ID: 1185057397

View in Genome Browser
Species Human (GRCh38)
Location 22:48588079-48588101
Sequence TGGTTTGGGGGGTTGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057388_1185057397 3 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057378_1185057397 26 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057379_1185057397 19 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057380_1185057397 18 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057381_1185057397 17 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057382_1185057397 16 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232
1185057383_1185057397 10 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG 0: 1
1: 0
2: 1
3: 25
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057397 Original CRISPR TGGTTTGGGGGGTTGGTCCA TGG Intronic
900560128 1:3300734-3300756 GGGTTCGGGGGGATGGTACAAGG - Intronic
902085305 1:13855752-13855774 TGGTTTTGTGGGCTGGTCCCAGG + Intergenic
902547882 1:17201630-17201652 TGGTTTCTTGGGTTGTTCCAGGG + Intergenic
902941349 1:19802017-19802039 TGGTTTGGGGGATGGGTGGAGGG + Intergenic
903339379 1:22644220-22644242 TGGTTTGGGGGTTTGGGTCTGGG + Intronic
903950782 1:26994653-26994675 GCGTGTGGGGGGCTGGTCCAGGG + Intronic
904056399 1:27673376-27673398 TGGCTTGGCTGGTTGGTCAAAGG - Intergenic
905961779 1:42048925-42048947 TGGGTTGGGGGTTTGGTCAATGG - Intergenic
906282287 1:44562643-44562665 GGGGTTGGGGGGTTGGTGCCTGG + Intronic
907289405 1:53403212-53403234 TGGTATGGGGGGTTGTTACGAGG - Intergenic
912070328 1:105801211-105801233 TGGTTTTGGGGCTGGGCCCAGGG - Intergenic
913114623 1:115684840-115684862 TGGTGTGGGTGGCTGGACCAGGG + Intronic
914747957 1:150513185-150513207 TGGGGTGGGGAGGTGGTCCAAGG - Intronic
916650509 1:166830614-166830636 TGGTTTCGTGGGTGGGCCCAGGG + Intergenic
919482571 1:198108023-198108045 TGGTTTCAGGGGATGGTCCTAGG + Intergenic
922357242 1:224788094-224788116 AAGTTTGGGGGGATAGTCCAGGG + Intergenic
922751410 1:228071776-228071798 TAGTTTGGGGGGATAGTGCAGGG + Intergenic
923419440 1:233798063-233798085 TGGTTTGGGGGTATGTTCCAAGG + Intergenic
923557597 1:235012966-235012988 TGGGTTGCTGGGTTGGTCGATGG - Intergenic
1063873617 10:10447168-10447190 TGGTGTGGGGGGTTGGGGGAGGG + Intergenic
1065703632 10:28449205-28449227 TGGTTTGGGGTGTGGATCAAGGG - Intergenic
1067532029 10:47081018-47081040 TGGTCTGTGGGGTTTGTCCTGGG - Intergenic
1070341755 10:75504401-75504423 GGGTTTGGGGGGATGGGGCAGGG + Intronic
1071824135 10:89307572-89307594 CAGATTGGGGGGTAGGTCCACGG + Exonic
1073121686 10:101125823-101125845 GGGTTGGGGGGGTTGTTCCAAGG - Intronic
1077132281 11:979027-979049 AGGGTTGGGGGGCTGGGCCAAGG + Intronic
1077338112 11:2014387-2014409 TGGCTGGGTTGGTTGGTCCAGGG - Intergenic
1077525829 11:3064020-3064042 TGGTTTTGTGGGCTGGTCCCAGG - Intergenic
1079880604 11:25922129-25922151 TGGTTTTGTGGGTTGGGCCCGGG - Intergenic
1079925700 11:26489126-26489148 TGGTTTCGTGGGCTGGCCCAGGG + Intronic
1080522697 11:33081547-33081569 TGGTGGGAGGTGTTGGTCCAGGG + Intronic
1081588872 11:44407237-44407259 TGCTATGGTGGGATGGTCCAGGG - Intergenic
1081872720 11:46390854-46390876 TGGTTTGGGGTGTAGGTCTTCGG + Intergenic
1084203290 11:67576499-67576521 TGTTTTGGGGAGTGGTTCCAGGG - Intergenic
1085528208 11:77176140-77176162 TGGTGTGGGGGGTGGGGCCTGGG + Intronic
1086176732 11:83900437-83900459 TGGTTTTGTGGGCTGGTCCCAGG + Intronic
1086231688 11:84577893-84577915 TGGTTTGGGGGCCAGGCCCAGGG + Intronic
1089543538 11:119205908-119205930 GGGGTTGGGGAGTAGGTCCAAGG - Intergenic
1090003330 11:122980185-122980207 GGGTTTGAGGGGTTTTTCCATGG + Intronic
1090448961 11:126789353-126789375 TGCTTTGTGGGAATGGTCCAGGG - Intronic
1202821096 11_KI270721v1_random:69569-69591 TGGCTGGGTTGGTTGGTCCAGGG - Intergenic
1091668449 12:2435882-2435904 TCGTTTGGGATGTTGGTACATGG - Intronic
1094865081 12:34522551-34522573 TGGTTGGGGTGGTTGGGCCTTGG + Intergenic
1095929885 12:47614600-47614622 TGGTTTGTGGGGATGGGCCCAGG - Intergenic
1097174352 12:57134127-57134149 GGGTTTGGGGGGGTGGGGCAGGG + Intronic
1098163924 12:67673692-67673714 TGGTTTCGTGGGCTGGTCCCAGG - Intergenic
1100337195 12:93642286-93642308 TGGGGTGGGGGGGTGGTCCATGG + Intergenic
1101117857 12:101549461-101549483 TGGTTTTGTGGGTTGGGCCCAGG - Intergenic
1101850084 12:108394643-108394665 AGGTTTGTGGGGGTGGGCCAGGG - Intergenic
1106133525 13:26958325-26958347 TGGTCAGGGGGGTTGCTCCATGG + Intergenic
1106133567 13:26958443-26958465 TGGGCAGGGGGGTTGCTCCATGG + Intergenic
1106178097 13:27348323-27348345 TGGTTTGGGGTGGGGGTCAATGG + Intergenic
1107173568 13:37373797-37373819 GGATTTGGGAGGTTGGTCAAAGG - Intergenic
1107723158 13:43270637-43270659 TGGTTTGGGGGGATTTTGCAGGG + Intronic
1109044181 13:57387056-57387078 CGGTCTGGGGGGTGGGTCCCAGG - Intergenic
1110410980 13:75203746-75203768 TGGTTTGGGGGAAGGGTCAAAGG - Intergenic
1112259351 13:97864010-97864032 TGGTTTTGTGGGCTGGTCCCAGG - Intergenic
1113037077 13:106062184-106062206 GTGTTTGAGGGGTTTGTCCAAGG + Intergenic
1113530507 13:111020979-111021001 TGGTTTGGGGATTTTTTCCATGG - Intergenic
1114242916 14:20885496-20885518 TGGAATGGGGGCATGGTCCAGGG - Intergenic
1114249843 14:20949433-20949455 TGGAATGGGGGCATGGTCCAGGG - Intergenic
1114948373 14:27715753-27715775 TGGTTTTGTGGGTTGGGCCCAGG + Intergenic
1115112398 14:29839894-29839916 TGGTTTTGTGGGCTGGTCCAAGG - Intronic
1115886900 14:37982122-37982144 TGGTTTGGTTAGTTGGTACATGG + Intronic
1116129593 14:40838036-40838058 AGGTTTGGGAGTTTGGTTCAAGG + Intergenic
1116364314 14:44040773-44040795 TGGTTTTGGGGTCAGGTCCAGGG + Intergenic
1117818281 14:59620793-59620815 TGGGTGGTGGGGCTGGTCCAGGG + Intronic
1118458225 14:65964125-65964147 TGGGATGGGTGATTGGTCCAGGG + Intronic
1118877873 14:69799673-69799695 TGTTATGGGGGTTTGGTGCACGG + Intergenic
1119508851 14:75195767-75195789 AGGTTTAGGGAGTTGGTTCAAGG - Intergenic
1122086918 14:99314100-99314122 TGGGTTGGGGGGTTGGTGGCGGG - Intergenic
1122332071 14:100926669-100926691 TGGATTGGGAGGTTGGTTCATGG + Intergenic
1123676599 15:22715274-22715296 TGATCTGGGCGGCTGGTCCAGGG - Intergenic
1124328817 15:28789534-28789556 TGATCTGGGCGGCTGGTCCAGGG - Intergenic
1126027123 15:44457595-44457617 TGGTTGGGGGGGGTGGTGCGGGG + Intronic
1129275779 15:74444331-74444353 TGGTATTGGGGGTTGGTCCAAGG + Intergenic
1131577055 15:93602765-93602787 TTATTTGGTGGGTAGGTCCAGGG + Intergenic
1131675131 15:94663519-94663541 TAGTATGGGGGGTTGGGGCAGGG - Intergenic
1132515271 16:363152-363174 TGGTTAGGGAGGATGGTCCAAGG + Intergenic
1134024105 16:10941648-10941670 TGATCTGGGCGGCTGGTCCAGGG + Exonic
1134291061 16:12902963-12902985 GGGTTTGGGGAGAGGGTCCATGG + Intronic
1134618636 16:15670882-15670904 TGGATTGGGGGTTTGGGGCAGGG + Intronic
1135511714 16:23090453-23090475 TGATTTGGGGGGTTGGTCGGGGG - Intronic
1136075060 16:27811597-27811619 TGGATGGAGGGGTTGGTTCAAGG - Intronic
1139839601 16:69867847-69867869 TGGTGAGGGGGCTTGGGCCAAGG + Intronic
1140053151 16:71501035-71501057 TGTTTTGCGGGGTGGGTCCTAGG - Intronic
1140121839 16:72090450-72090472 AGATTTGGGGGCTTGGTTCAGGG + Intronic
1140634005 16:76889154-76889176 GGGGTTGGGGGGGTGGGCCAGGG + Intergenic
1141100934 16:81197018-81197040 TGGTTGGGGAGGGTGGCCCATGG + Intergenic
1142890738 17:2940914-2940936 TTGTTTGTGGGGTTGGACCAAGG + Intronic
1144016798 17:11203932-11203954 TGGTTGGGGTGCTTGGTCCTTGG + Intergenic
1144242407 17:13326128-13326150 TGCTTTTGGGGGTTGGGCAATGG - Intergenic
1144596874 17:16577285-16577307 TGGCTTGGATGGTTGGTCAAGGG + Intergenic
1144647650 17:16986591-16986613 TGATTTGGGGGGATGGGCCAGGG + Intergenic
1146024501 17:29307990-29308012 TGGTTTGGGGGATTAGGACACGG + Intergenic
1146476758 17:33169033-33169055 TGGTTTCAGGGGATGGGCCAGGG + Intronic
1147325177 17:39666573-39666595 TGGTTGGGGGGGCTGGCCCATGG + Intergenic
1147664071 17:42134654-42134676 TGATTTGGATGGTGGGTCCATGG - Intronic
1148089201 17:45012813-45012835 TGGGCTGGGGGCTTGGTCCTGGG + Intergenic
1149052740 17:52325821-52325843 TGGTTTGGTGGGCTGGGCCCAGG - Intergenic
1149444268 17:56701384-56701406 TGGTTTGGGTGGGTGCTCCTAGG + Intergenic
1150272183 17:63873648-63873670 TGGTTCGGGGAGTTGGGCCTTGG + Exonic
1150273539 17:63881835-63881857 TGGTTCGGGGAGTTGGGCCTTGG + Exonic
1150275732 17:63896545-63896567 TGGTTCGGGGAGTTGGGCCTTGG + Exonic
1150279147 17:63918810-63918832 TGGTTCGGGGAGTTGGGCCTTGG + Exonic
1150594786 17:66594305-66594327 TGGTTGGGTGGGGTGGTCTAAGG + Intronic
1150893946 17:69187364-69187386 AGGTTTAGGGGGTGGGTCCTGGG - Intronic
1151374577 17:73677919-73677941 TGATTTGGGTGGTTGTTGCATGG + Intergenic
1152777964 17:82213902-82213924 CAGTGTGGGGGGTGGGTCCAGGG - Intergenic
1156892316 18:42204661-42204683 TGGTTTTGTGGGCTGGGCCAAGG + Intergenic
1160082000 18:75736842-75736864 TGGTTTGGTGGGCTGGGCCCAGG + Intergenic
1160981116 19:1817053-1817075 AAGTATGGGGTGTTGGTCCAGGG + Intronic
1162204758 19:9047367-9047389 GGGCTTGGGGGTTTGATCCAGGG - Intergenic
1163633018 19:18426652-18426674 TGGTTGGGAGGGTGAGTCCAGGG + Intronic
1164425149 19:28134720-28134742 TGATTCGGGTGGTTGGTACATGG + Intergenic
1166046623 19:40234101-40234123 AGGTTTGGGGAGTGGGTCCGTGG - Intronic
1166895223 19:46018436-46018458 TGGTGTGGGGGGTGGGGCCAGGG + Exonic
1167779858 19:51592131-51592153 TGGTTTTGGGGGTGGGGGCAGGG - Exonic
925262081 2:2537687-2537709 TGTTATGAGGGGTTGCTCCATGG - Intergenic
925443213 2:3906208-3906230 TGGTTCTGGAGGTTGGTACAGGG - Intergenic
927396159 2:22654332-22654354 TGGTTTTGGAGGCTGGTCCCAGG + Intergenic
927409306 2:22806367-22806389 TGGTTTTGTGGGCTGGGCCAAGG - Intergenic
930939567 2:56997828-56997850 TGCTTTGGGGGCTTTGTCCTAGG + Intergenic
934569509 2:95359921-95359943 TGGTTTTAGGGGATGGGCCAAGG - Intronic
934859316 2:97750366-97750388 TTATTTGGGGGGTGGGTCTATGG + Intergenic
937518773 2:122685668-122685690 TGGTTTGTGGGTTGGGCCCAGGG - Intergenic
939547399 2:143570275-143570297 TGGTTTGGGGGGAGGTTCCAGGG - Intronic
941052793 2:160753786-160753808 TGGGATGGGGAGTTGGTCCATGG + Intergenic
943108069 2:183571935-183571957 TGGTTTTGTGGGCTGGCCCAGGG + Intergenic
944307481 2:198194612-198194634 TGGTTTGTGGGCTGGGCCCAGGG - Intronic
945293476 2:208147660-208147682 TGGCTTGGCTGGCTGGTCCAGGG - Intergenic
945709448 2:213277964-213277986 TGGTTTTGAGGGCTGGTCCCAGG + Intergenic
946172812 2:217905565-217905587 TGGTTTTGGTGGTTGGCACAGGG - Intronic
947328054 2:228999526-228999548 TGGTTTGGTGGGCTGGGCCCAGG + Intronic
1169497995 20:6133216-6133238 TGGGTTGGTGGGTTGGTGCTGGG - Intergenic
1169676379 20:8159384-8159406 TGGTTTTGTGGGTTGGAACAAGG - Intronic
1170264565 20:14451069-14451091 TTTTTTGGGGGGCTGGTCCCAGG + Intronic
1170922818 20:20694981-20695003 TGTTTTGGGGGGTACTTCCAGGG + Intronic
1171934289 20:31258936-31258958 TGTGTTGGGGGGTGGGTGCAGGG - Intronic
1172109180 20:32535636-32535658 TTGTTTGAGGGGCTGGTCCCAGG - Intronic
1173572737 20:44088019-44088041 TGGGTTGATGGGTTGGCCCAAGG - Intergenic
1175485745 20:59344840-59344862 TGATTTGGGGGCTTGGTCCTAGG + Intergenic
1177504333 21:22000932-22000954 TGGTTTTGTGGGCTGGTCCCAGG - Intergenic
1178181227 21:30163723-30163745 TGGTTTCCGGGGTCAGTCCATGG - Intergenic
1178701737 21:34839677-34839699 TAGTTTGGTAGGTTGGTCTAGGG + Intronic
1180869545 22:19138478-19138500 TCTTTTGGGGGGTTGGGGCAGGG - Intronic
1180896226 22:19335013-19335035 TGGTTTTGGTGGTTGCTCTAGGG + Intronic
1182283553 22:29231517-29231539 TGGTTGGGGGGCTGGGGCCAGGG + Intronic
1182373894 22:29832008-29832030 TGCTTTGGGGGGAAGGTGCAGGG + Intronic
1182681726 22:32084729-32084751 TGGTTTGCAGGGTTGGGACAGGG + Intronic
1183296752 22:37034223-37034245 TGGGTTGGGGGGCTGGTTCTGGG + Intergenic
1185057397 22:48588079-48588101 TGGTTTGGGGGGTTGGTCCATGG + Intronic
952787711 3:37172463-37172485 TGGATTGGGGGGTTGGGGTAAGG + Intronic
953125360 3:40087217-40087239 TGGTTTTGGAGCTTTGTCCAAGG - Intronic
954201242 3:49024614-49024636 TGGGTAGAGGGGCTGGTCCAGGG - Intronic
955034963 3:55258655-55258677 TGGGTTGGGAGGTTTGTCTAAGG - Intergenic
955093851 3:55777400-55777422 TGGTCTGAGGGGTAGGTCCTTGG - Intronic
957787427 3:84900941-84900963 TGGTTTTGTGGGCTGGACCAAGG + Intergenic
959368316 3:105491252-105491274 TGGTTTCATGGGTTGGTCCCAGG - Intronic
963421082 3:145061598-145061620 TGGTTTTGAGGGGTGGTCCTAGG - Intergenic
964737844 3:159934435-159934457 GGTTTTGTGGGCTTGGTCCAGGG - Intergenic
965373207 3:167890443-167890465 TGGTTTGGGGGGCAGGTGCCAGG - Intergenic
965499979 3:169445270-169445292 TGGTTTTGTGGGTGGGCCCAGGG + Intronic
967134021 3:186497772-186497794 TGGTTTGGAGGCTTAGTCCATGG - Intergenic
969802214 4:9577714-9577736 TGGTTTTGTGGGCTGGACCAAGG + Intergenic
970638165 4:18032958-18032980 TGTTTTGGGGGGTGGGGACAGGG - Intergenic
970678309 4:18477537-18477559 TGGTTTTGTGGGCTGGGCCAAGG - Intergenic
972873660 4:43330836-43330858 TGGTTTGGAAGGGTGGGCCATGG + Intergenic
973730453 4:53817471-53817493 TGATTTGTGGGGTTGGGCGAGGG - Intronic
973867949 4:55133085-55133107 TGGTTTGGGGGTTGGGTGGAAGG - Intergenic
977060639 4:92254073-92254095 TGGTTTTGTGGGTTGGGCCCAGG - Intergenic
977877436 4:102165768-102165790 TGGTTTCGTGGGGTGGGCCAGGG + Intergenic
978013728 4:103719446-103719468 TGGTTGGTGAGGTTGGCCCAGGG + Exonic
980850448 4:138374475-138374497 TGGTTTTGTGGGCTGGTCCAAGG - Intergenic
981633730 4:146851101-146851123 TGATTTGCTGGGTTGGTGCAAGG - Intronic
981683075 4:147422465-147422487 AGGTTGGTGGGGCTGGTCCAAGG + Intergenic
981872891 4:149507894-149507916 TGGTTTGGTGGGCTGAGCCAGGG + Intergenic
982064724 4:151644262-151644284 GGGTTTGGGGGTTGGGCCCAAGG - Intronic
983322445 4:166211882-166211904 TGGTTTTGTGGGTTGGGCCCAGG - Intergenic
983464528 4:168070257-168070279 TGGGTTGGGGGGTTGGGGGAGGG + Intergenic
986260062 5:6136457-6136479 TTATTTGGGGGGTAGTTCCATGG - Intergenic
988572532 5:32383672-32383694 TGCTTTGGGGAGTTAGTACAGGG - Intronic
989966839 5:50475045-50475067 TGGTTTTGTGGATTGGGCCAAGG + Intergenic
992954166 5:81890801-81890823 TGGTTTCCTGGGCTGGTCCAGGG + Intergenic
994565365 5:101439314-101439336 TGGTTGGGGGTGTTGGATCATGG + Intergenic
996690756 5:126337360-126337382 TGGTTGTGGGGGATGGTCAAGGG - Intergenic
996703926 5:126477863-126477885 TGGTTTGGAGTCTTGGTCCTTGG - Intronic
1000724511 5:164752738-164752760 TGATTTGGGGGGAGGGTTCAAGG + Intergenic
1001961829 5:175884279-175884301 GGGGGTGGGGGGGTGGTCCATGG - Intergenic
1003659269 6:8045097-8045119 TGGTTTGTGGGCTAGGTCCATGG + Intronic
1005124034 6:22425168-22425190 TGGTTTGGGTGGCTTGGCCAAGG + Intergenic
1006233439 6:32605704-32605726 TGATTTGGGTGGTGGGTTCATGG - Intergenic
1006234896 6:32621364-32621386 GGTTTTGGGGGGTTGGTCAAGGG - Intergenic
1006448647 6:34093285-34093307 TGGTCTGGGGGGTGGCCCCAGGG - Intronic
1007406557 6:41638963-41638985 GGGTTTGAGGACTTGGTCCAAGG + Intronic
1007768692 6:44176757-44176779 TGGTTGTGGGGGGTGGTTCAGGG + Intronic
1007847965 6:44776429-44776451 TGGTTGGGGGGGTGGGTTGATGG + Intergenic
1010209228 6:73349735-73349757 TGGTTTGGGGGATTGGGAAAGGG + Intergenic
1010360420 6:74986996-74987018 GGTTTTGTGGGGTAGGTCCAGGG + Intergenic
1010611836 6:77962896-77962918 TGGTTTCGTGGGTTGGGCCCAGG + Intergenic
1012732508 6:102900210-102900232 TGGTTTTGTGGGTTGGGCCAAGG - Intergenic
1014837909 6:126181538-126181560 GGGTTTTGTGGGTTGGACCAAGG + Intergenic
1014883104 6:126746774-126746796 TGGTTTTGTGGGTTGGGCCCAGG - Intergenic
1018067310 6:160133218-160133240 TGGTTTGGGGGGTCTGACCCGGG + Intronic
1018535480 6:164814373-164814395 TGGTTTTGTGGGCTGGGCCAAGG - Intergenic
1018922736 6:168186661-168186683 TGGTTTTGGGGGCTGGGCCCGGG - Intergenic
1019098699 6:169609602-169609624 TGGTTTCATGGGTTGGCCCAGGG - Intronic
1019654082 7:2179193-2179215 TGGTGTGGGGGCTGGGACCAGGG - Intronic
1021598624 7:22342299-22342321 TGGTTTGGTGGGCTGGGCCCAGG - Intronic
1021956526 7:25830512-25830534 TGGTTTGGTTGGTTGGTTGATGG + Intergenic
1022334715 7:29411567-29411589 TGGCTAGGGTGGTTGGTTCAAGG + Intronic
1024729187 7:52235685-52235707 TGGTTTTGTGGGCTGGACCAAGG + Intergenic
1027197642 7:76041911-76041933 TGTTTTGGGTGGTTGTTACAAGG + Intronic
1029272801 7:99386832-99386854 TGGGTTGGGGGGGTGGTGCAAGG + Intronic
1029709067 7:102289737-102289759 AGGTTTAGGGGGCTGGGCCAGGG + Intronic
1030806787 7:113929533-113929555 TGGTTTGGTGGGCTGGGCCCAGG + Intronic
1031676638 7:124618931-124618953 TGGTTTGGCTGGTTGGTCAGGGG + Intergenic
1033098249 7:138449286-138449308 TGGTTTGGGGGTAAGGTTCAAGG + Intergenic
1033547290 7:142413119-142413141 TGGTTTGGGGGTTTGGGGCCAGG - Intergenic
1034761095 7:153672646-153672668 TAGGTTGGGGGGTTTCTCCATGG + Intergenic
1035371365 7:158381031-158381053 TGGTTTTGTGGGTTGGGCCCAGG - Intronic
1037817979 8:22121704-22121726 TGGATTGGGGGGGTGGTGGATGG - Intronic
1039349913 8:36752692-36752714 TGGTTTGTGGGCTTGATCAAAGG - Intergenic
1040867383 8:52062527-52062549 TGGTTTGGGGGGTATGAACATGG + Intergenic
1042780839 8:72489584-72489606 TGGCTTGGCTGGTTGGTCAAGGG + Intergenic
1044250952 8:90003192-90003214 TGATGTGGGAGGTTGTTCCAGGG + Intronic
1044750540 8:95411501-95411523 TGGGATGGGGAGTAGGTCCAAGG - Intergenic
1045058379 8:98389756-98389778 TGGCTTTGGTGGTTGGTCTAGGG - Intergenic
1045622748 8:104001467-104001489 TGGTTTGGGTGGTAGATTCAAGG - Intronic
1046713756 8:117544679-117544701 TGTTTTGGGGCGTTGGTTGATGG - Intergenic
1047952625 8:129947688-129947710 TGGTGTGGGTGGTTGGATCATGG - Intronic
1048202456 8:132386029-132386051 TGGGATGGGGGGATGGTGCAGGG + Intronic
1050066666 9:1767072-1767094 TGGAATGGGGGTTTGGTACAAGG - Intergenic
1053005994 9:34604988-34605010 TGGTTTGGGGGAGAGCTCCAAGG + Intergenic
1056845308 9:90032378-90032400 TGTTATGGTGGGTTGGACCACGG + Intergenic
1057316501 9:93972201-93972223 TGGTTTTGTGGATGGGTCCAGGG - Intergenic
1058027640 9:100159926-100159948 TAGTTTGGGGAGATGGTCCAGGG - Intronic
1059547881 9:115196976-115196998 TGGTTTGGGGGCCTGATGCACGG + Intronic
1059753648 9:117272331-117272353 TGGTTTGTGGGCTGGGCCCAGGG - Intronic
1059856273 9:118401140-118401162 AGGTTTCGGTGGTTAGTCCAGGG + Intergenic
1060251264 9:121988348-121988370 TGGTTCGGGGGGGTGGTCCCTGG - Intronic
1062016506 9:134293800-134293822 GGGTTGGGGGGGTTGGCGCAGGG - Intergenic
1062035611 9:134381260-134381282 TGGGCTGGGGGCTGGGTCCAGGG + Intronic
1062379597 9:136280836-136280858 TGCTCTGGGGTGGTGGTCCAGGG + Intergenic
1062410110 9:136419307-136419329 TGTTTTCGGGGTTTGGACCAGGG - Intronic
1186120040 X:6350867-6350889 TGGTTTGGGAGGCTGTGCCAGGG - Intergenic
1187258550 X:17663314-17663336 TGTTTTGGGAGGTTGTTACATGG - Intronic
1187643436 X:21319504-21319526 TGGTTTTGTGGGTTGGGCCCAGG - Intergenic
1190113830 X:47612734-47612756 TGGTTTGGCTGGTTGGTCAGGGG + Intronic
1190660163 X:52646587-52646609 TTGTTTGGGGGGTGGGTACCAGG + Intronic
1192334367 X:70205122-70205144 TGGCTTTGGGGGTTGATCAATGG - Exonic
1192939552 X:75898760-75898782 TGGGTTGGCAGGCTGGTCCACGG + Intergenic
1193198938 X:78665564-78665586 TGGTTTTGTGGGCTGGGCCAGGG + Intergenic
1194554254 X:95337793-95337815 TGATTTTGTGGGTTGGTCCAGGG - Intergenic
1194864889 X:99053748-99053770 TGGTTTTGTGGGCTGGTCCCAGG + Intergenic
1195196051 X:102498941-102498963 TGGTTTTGTGGGTTGGGCCCAGG + Intergenic
1197159457 X:123307380-123307402 TGGATTCTGTGGTTGGTCCAAGG + Intronic
1198483476 X:137062934-137062956 TGGTTTGGGGGTTTGATAAATGG + Intergenic
1198947082 X:142027226-142027248 TGGTTTTGTGGGTCGGGCCAAGG - Intergenic