ID: 1185057398

View in Genome Browser
Species Human (GRCh38)
Location 22:48588080-48588102
Sequence GGTTTGGGGGGTTGGTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057378_1185057398 27 Left 1185057378 22:48588030-48588052 CCAGGAGCCCCCTTGGCCAAGCT 0: 1
1: 0
2: 1
3: 31
4: 209
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057388_1185057398 4 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057383_1185057398 11 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057380_1185057398 19 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057379_1185057398 20 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057381_1185057398 18 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
1185057382_1185057398 17 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057398 Original CRISPR GGTTTGGGGGGTTGGTCCAT GGG Intronic
902763748 1:18601117-18601139 GGTTTGGGGAGATGATCCAGAGG - Intergenic
916495746 1:165345081-165345103 GGTTTGGGGGGATAGTCCCCAGG + Intronic
917819811 1:178751136-178751158 GGTTTGGGGGGGAGGGACATAGG - Intronic
923224939 1:231930570-231930592 GGTTTGGAGGGCTGCTCCAGAGG - Intronic
1065620720 10:27578227-27578249 GGTCTGGGAGGTAGGTCCATTGG + Intergenic
1065729874 10:28700851-28700873 CCTTTGCGGGGTTGGTCCAAAGG + Intergenic
1071824136 10:89307573-89307595 AGATTGGGGGGTAGGTCCACGGG + Exonic
1074781327 10:116804367-116804389 GATTTGAGGGGTTGGGCCTTCGG + Intergenic
1077132282 11:979028-979050 GGGTTGGGGGGCTGGGCCAAGGG + Intronic
1078084398 11:8225012-8225034 GGTTAGGGGGGTTGGTGGAGAGG + Intronic
1083692216 11:64416465-64416487 GGTTTGGTGGGTTGTTCCACCGG - Intergenic
1084568809 11:69947144-69947166 GGTTTGGGAGGTGGGGCCTTTGG - Intergenic
1084665421 11:70573741-70573763 GGGTTGGGGGCTTGGGGCATCGG - Intronic
1086305885 11:85481793-85481815 GGCCTGGGGGCTGGGTCCATAGG - Intronic
1090598185 11:128342121-128342143 AGTTTGATGGGTTGGTCGATAGG - Intergenic
1099086353 12:78251523-78251545 GGGTTGGGGGGTAGGTTCAAAGG - Intergenic
1100337196 12:93642287-93642309 GGGGTGGGGGGGTGGTCCATGGG + Intergenic
1101850083 12:108394642-108394664 GGTTTGTGGGGGTGGGCCAGGGG - Intergenic
1106133526 13:26958326-26958348 GGTCAGGGGGGTTGCTCCATGGG + Intergenic
1106133547 13:26958385-26958407 GGGCAGGGGGGTTGCTCCATAGG + Intergenic
1106133568 13:26958444-26958466 GGGCAGGGGGGTTGCTCCATGGG + Intergenic
1106178098 13:27348324-27348346 GGTTTGGGGTGGGGGTCAATGGG + Intergenic
1107609006 13:42093862-42093884 GGAGTGGGGAGTTGTTCCATGGG + Intronic
1110070657 13:71172712-71172734 GGTTCTGGGGATTAGTCCATTGG + Intergenic
1111576073 13:90155211-90155233 GGTTTGGGGGGTGGCTCCTGAGG + Intergenic
1113222534 13:108121240-108121262 AGTTTGGGGGGTTGTCCTATAGG - Intergenic
1115112397 14:29839893-29839915 GGTTTTGTGGGCTGGTCCAAGGG - Intronic
1119508850 14:75195766-75195788 GGTTTAGGGAGTTGGTTCAAGGG - Intergenic
1122332072 14:100926670-100926692 GGATTGGGAGGTTGGTTCATGGG + Intergenic
1124011219 15:25840187-25840209 GGTTTGGGGGTTTGTTACACAGG + Intronic
1124438855 15:29672764-29672786 GGTTGGGGGGGTTGGAAAATGGG + Intergenic
1128096615 15:64961052-64961074 GGTTTGGGCAGTGGGGCCATGGG + Intergenic
1128375166 15:67068966-67068988 TGTGTGGGGGGTTGGTCACTGGG + Intronic
1129275780 15:74444332-74444354 GGTATTGGGGGTTGGTCCAAGGG + Intergenic
1131350121 15:91692161-91692183 GGTTGGGGTGGAGGGTCCATGGG + Intergenic
1135565520 16:23508715-23508737 GGTTTGGGAGTCTGGTTCATTGG - Intronic
1138472585 16:57249971-57249993 GGTTTGAGGGCTTCCTCCATAGG - Intronic
1139462342 16:67132631-67132653 GGATTGTGGGGTTGGTACTTGGG + Intronic
1140634006 16:76889155-76889177 GGGTTGGGGGGGTGGGCCAGGGG + Intergenic
1142116433 16:88358460-88358482 GATCTGGGTGGTTGGTACATGGG - Intergenic
1144647651 17:16986592-16986614 GATTTGGGGGGATGGGCCAGGGG + Intergenic
1147325178 17:39666574-39666596 GGTTGGGGGGGCTGGCCCATGGG + Intergenic
1150272184 17:63873649-63873671 GGTTCGGGGAGTTGGGCCTTGGG + Exonic
1150273540 17:63881836-63881858 GGTTCGGGGAGTTGGGCCTTGGG + Exonic
1150275733 17:63896546-63896568 GGTTCGGGGAGTTGGGCCTTGGG + Exonic
1150279148 17:63918811-63918833 GGTTCGGGGAGTTGGGCCTTGGG + Exonic
1151374578 17:73677920-73677942 GATTTGGGTGGTTGTTGCATGGG + Intergenic
1155473407 18:26213904-26213926 GGTTTGAGGGGCAGGTCCAGTGG + Intergenic
1157761696 18:50270068-50270090 GGGTTGGGTGGTTGGTTCCTGGG + Intronic
1158837650 18:61348102-61348124 TTTTTGGGGGGGTGGTCCACTGG + Intronic
1159958537 18:74537607-74537629 GGTTTGGGGAGCTGGACCACAGG + Intronic
1162204757 19:9047366-9047388 GGCTTGGGGGTTTGATCCAGGGG - Intergenic
1163125747 19:15243337-15243359 ACTTGGGGGGGTTGGGCCATGGG + Exonic
1164425150 19:28134721-28134743 GATTCGGGTGGTTGGTACATGGG + Intergenic
1165201506 19:34148724-34148746 GGTTTTGGGGGCTGGGACATGGG - Intergenic
1166090193 19:40503581-40503603 GGGATGGGGGGTTGGTCTTTAGG + Intronic
925157424 2:1658483-1658505 GGTCTGCGGGGCTGGTCCCTGGG - Intronic
928348405 2:30521793-30521815 AGTTTAGGGGGTTGGTCCAGCGG - Intronic
931474845 2:62577061-62577083 GGTTTTGGGGGCAGGTGCATGGG + Intergenic
931808222 2:65828673-65828695 TGTTTGGTTGGTTGGTCAATTGG - Intergenic
937081686 2:119144851-119144873 TGTTTGAGGGTTTGGACCATGGG + Intergenic
937219121 2:120331525-120331547 GGCTTGAGGGCTTGGTCCCTAGG - Intergenic
937800011 2:126072296-126072318 GGTTTTGGGGGTGGGTCCTGAGG - Intergenic
940844516 2:158625170-158625192 GTATTGAGGGGTTGGTCCGTTGG - Exonic
946235788 2:218323607-218323629 GATTTGGGGGGCTGGACAATTGG + Intronic
946730592 2:222705623-222705645 GGTTTGTGGTGTTTTTCCATGGG + Intronic
1169055806 20:2619774-2619796 GGTTTGGAGGGCTGGGCCCTGGG + Intronic
1169443534 20:5652794-5652816 GATTTGGGGGGATGGGACATGGG - Intergenic
1169578057 20:6987919-6987941 TGTTTGTGGGGTTTGTACATAGG - Intergenic
1172891244 20:38267005-38267027 GGTGGGGGGGGTTGGTTAATAGG + Intronic
1173793341 20:45841931-45841953 GCTCTCGGGGGCTGGTCCATGGG - Exonic
1175366733 20:58461133-58461155 GGTGCGGGGGCCTGGTCCATGGG - Exonic
1175485746 20:59344841-59344863 GATTTGGGGGCTTGGTCCTAGGG + Intergenic
1175517739 20:59579536-59579558 AGTTTGGGGAGGTGGCCCATGGG + Intronic
1176997833 21:15577773-15577795 GGTTTTGGGGGTGGTTCCAGAGG - Intergenic
1177204340 21:17994486-17994508 GGCTTGGTGGGTTAGTCCTTGGG + Intronic
1185057398 22:48588080-48588102 GGTTTGGGGGGTTGGTCCATGGG + Intronic
954705801 3:52479921-52479943 GTTTGGGGGGCTTGGGCCATGGG + Intronic
955093850 3:55777399-55777421 GGTCTGAGGGGTAGGTCCTTGGG - Intronic
967134020 3:186497771-186497793 GGTTTGGAGGCTTAGTCCATGGG - Intergenic
968463147 4:735913-735935 GATTTGGGGGGTTGCTCCAAAGG + Intronic
970314906 4:14819934-14819956 GGTTTGAAGGGTTGATCCCTTGG - Intergenic
974401230 4:61410614-61410636 GGTTGGGGTGGTGGGTCCACTGG - Intronic
976300384 4:83510343-83510365 GGGTGGAGGGGTAGGTCCATAGG + Intronic
980628351 4:135405209-135405231 GGTTTTGGGGGTTGCTCCTGAGG - Intergenic
980850447 4:138374474-138374496 GGTTTTGTGGGCTGGTCCAAGGG - Intergenic
989210625 5:38855677-38855699 GGTTGGGGGGGTTAGTGCAATGG - Intronic
989586157 5:43075203-43075225 GGGTGGAGGGGTAGGTCCATGGG + Intronic
989952963 5:50322615-50322637 GGTTTGGGAGGTTGGTTCATTGG + Intergenic
994565366 5:101439315-101439337 GGTTGGGGGTGTTGGATCATGGG + Intergenic
1001961828 5:175884278-175884300 GGGGTGGGGGGGTGGTCCATGGG - Intergenic
1006102899 6:31697004-31697026 GGTACTGGGGGTTGGTCCAGCGG + Exonic
1008751366 6:54737262-54737284 GGGTTGGGGGGTTGGGGGATGGG + Intergenic
1010061586 6:71628690-71628712 GGGGGGGGGGGTTGGTCAATGGG - Intergenic
1012410414 6:98949351-98949373 GTATTGGGGGGGTGGGCCATGGG - Intergenic
1012732507 6:102900209-102900231 GGTTTTGTGGGTTGGGCCAAGGG - Intergenic
1014160353 6:118160820-118160842 GGTTTGTGGGACTGGACCATTGG - Intronic
1015622761 6:135149593-135149615 GGTTTTGGGGGTGGGGGCATGGG - Intergenic
1018709361 6:166486647-166486669 GCATTGGGGGCTGGGTCCATCGG + Intronic
1019532736 7:1511741-1511763 GGTTTGAGGGGTGGGCCCAGAGG - Intergenic
1021746541 7:23746160-23746182 GGATTGGGGGGTGGGTGTATGGG + Intronic
1021956527 7:25830513-25830535 GGTTTGGTTGGTTGGTTGATGGG + Intergenic
1024515578 7:50251980-50252002 AGGTTGGGGGGTGTGTCCATTGG + Intergenic
1030106522 7:105992090-105992112 GGTTTGGGGAGGTGCTCCAAAGG - Intronic
1032851180 7:135796935-135796957 GGGATGAGGGGTTGGTACATAGG - Intergenic
1033236453 7:139641611-139641633 GGTTTGGGAGGGTGGTCCCGTGG + Intronic
1034235526 7:149565741-149565763 GATTTGGGAGGTGGGTACATAGG - Intergenic
1035330412 7:158093212-158093234 AGTGTGGGGGGTCGGTCCAGCGG - Intronic
1037817978 8:22121703-22121725 GGATTGGGGGGGTGGTGGATGGG - Intronic
1038269393 8:26062873-26062895 GGTTTGGAGATTTGGGCCATTGG + Intergenic
1040867384 8:52062528-52062550 GGTTTGGGGGGTATGAACATGGG + Intergenic
1047952624 8:129947687-129947709 GGTGTGGGTGGTTGGATCATGGG - Intronic
1048263077 8:132961957-132961979 GGCATGAGGGGCTGGTCCATGGG - Intronic
1048918181 8:139203921-139203943 GGGTTGGGGGGTTGGGGGATTGG - Intergenic
1052824673 9:33166568-33166590 GGTTTGCGAGGTGGGTCCCTGGG - Intronic
1056684419 9:88747682-88747704 GTTTTGGCGGGTTGGTCAGTCGG + Intergenic
1057222995 9:93267865-93267887 GGTGTGGCGGGCTGGTCCCTGGG - Exonic
1057725076 9:97562657-97562679 GGTTTGGAGTGTGGGTCCCTAGG + Intronic
1059416995 9:114168455-114168477 GGTTTGTGGGGCTAGTCCTTTGG - Exonic
1059856274 9:118401141-118401163 GGTTTCGGTGGTTAGTCCAGGGG + Intergenic
1060299855 9:122368836-122368858 GGTTGGGGGTGCTGGCCCATGGG + Intergenic
1062294826 9:135818862-135818884 AGTTCGGGGAGGTGGTCCATGGG + Intronic
1188908840 X:35820856-35820878 GGTTTGGGGGTTTGGTTTTTAGG + Intergenic
1190446709 X:50533021-50533043 TGTTTGGGGGATTGGAACATGGG + Intergenic
1192165233 X:68823799-68823821 GGCTTGGGGTGTTCCTCCATAGG + Intergenic
1192334366 X:70205121-70205143 GGCTTTGGGGGTTGATCAATGGG - Exonic