ID: 1185057399

View in Genome Browser
Species Human (GRCh38)
Location 22:48588088-48588110
Sequence GGGTTGGTCCATGGGAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057382_1185057399 25 Left 1185057382 22:48588040-48588062 CCTTGGCCAAGCTCCATCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057381_1185057399 26 Left 1185057381 22:48588039-48588061 CCCTTGGCCAAGCTCCATCTGTG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057396_1185057399 -10 Left 1185057396 22:48588075-48588097 CCAGTGGTTTGGGGGGTTGGTCC 0: 1
1: 0
2: 0
3: 3
4: 154
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057383_1185057399 19 Left 1185057383 22:48588046-48588068 CCAAGCTCCATCTGTGCATAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057379_1185057399 28 Left 1185057379 22:48588037-48588059 CCCCCTTGGCCAAGCTCCATCTG 0: 1
1: 0
2: 0
3: 24
4: 268
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057380_1185057399 27 Left 1185057380 22:48588038-48588060 CCCCTTGGCCAAGCTCCATCTGT 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185057388_1185057399 12 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057399 Original CRISPR GGGTTGGTCCATGGGAGAAC TGG Intronic
903243823 1:22001544-22001566 GCCTTGGACCATGGGAGACCTGG + Intergenic
903646455 1:24898970-24898992 GGGGTTGTCCATGGCTGAACTGG - Intergenic
904563815 1:31415247-31415269 GGGCTGGTCCAGGGAAGAATTGG + Intronic
904591325 1:31617198-31617220 GGGCTGGGAGATGGGAGAACAGG + Intergenic
907074771 1:51568221-51568243 GGTTTGGTCAATGGGAGCCCTGG - Intergenic
909394428 1:75153819-75153841 GGCTTGGTTCATGGGAGATAGGG + Intronic
910171939 1:84387076-84387098 GGGGTGGACCCTGGGAGAAGTGG - Intronic
911352200 1:96766784-96766806 GGCTTGGTCTTTGGGAGAAGAGG + Intronic
911360336 1:96868027-96868049 GGGATGGAACTTGGGAGAACTGG - Intergenic
915362967 1:155296823-155296845 GGGTGGGTTCAAGGGAGAATGGG - Intronic
916001491 1:160620618-160620640 GGGTTGGTTAATGGAAGAAGGGG - Intronic
916757358 1:167785621-167785643 GGGTATGTTCATGGGAGAAGGGG - Intronic
917133194 1:171763236-171763258 GGGTTTGTCCATGTTGGAACTGG + Intergenic
917509916 1:175661490-175661512 GGGTTGGGCCTTGAGAGAAAAGG + Intronic
918205222 1:182302441-182302463 GGGTTTATCCTTGGTAGAACAGG + Intergenic
921597300 1:217068420-217068442 GGGTTGGTGCAGGAGAGGACTGG - Intronic
921622056 1:217336167-217336189 GGGTGGGGCCATGGAAGTACAGG + Intergenic
1067234865 10:44439033-44439055 GGGTTGGCCTATGAGAGACCTGG + Intergenic
1070800201 10:79240755-79240777 GAGTGGGTACCTGGGAGAACAGG + Intronic
1071362203 10:84859617-84859639 GGGTTGCTACATGGGAATACTGG + Intergenic
1080001340 11:27353885-27353907 GGCTTCGTCCATGGCAGAACTGG - Intronic
1082182051 11:49131746-49131768 GGGTTTTTTCATGGGAGAACGGG - Intergenic
1082204564 11:49417070-49417092 AGGTTGGTACATGGTAGAAAAGG + Intergenic
1083151013 11:60791781-60791803 GGGCTAGTCCCTGGGAGCACAGG - Intronic
1085456621 11:76669111-76669133 GGGTTGGCCAGTGGCAGAACTGG - Intronic
1086650527 11:89283436-89283458 AGGTTGGTACATGGTAGAAAAGG - Intronic
1086683453 11:89703193-89703215 GGATTCTTTCATGGGAGAACGGG + Intergenic
1088016709 11:105069907-105069929 GGGTAGGTCCAAGGGATCACAGG + Intronic
1088158126 11:106834207-106834229 GGGTTGGGGTATGGGAGAAATGG - Intronic
1088902148 11:114126471-114126493 GGGTTGGTCCTGGGTAGAGCTGG + Intronic
1096194495 12:49641251-49641273 GACTTAGTCCATGGGAGAAACGG - Exonic
1101003377 12:100378422-100378444 GAGTGGGTCCAGGAGAGAACAGG + Intronic
1104306559 12:127615351-127615373 GTGTTGGTCCCTGGGGGAAGAGG - Intergenic
1104775910 12:131389995-131390017 GGTTTAGTCCATGGGAGCCCTGG + Intergenic
1106133530 13:26958334-26958356 GGGTTGCTCCATGGGAGGGTGGG + Intergenic
1106821448 13:33468903-33468925 GGCTAGATCCATGGGACAACAGG + Intergenic
1109515511 13:63438872-63438894 GGGTTGATTCATGAGAGAAAAGG + Intergenic
1110144237 13:72169648-72169670 GGATTGGTCCAGGGGAAAAATGG + Intergenic
1112504215 13:99965909-99965931 GAGTTGGTCTCTGGGAGAATAGG - Intronic
1116159738 14:41253486-41253508 TGATTGGTCCATGGGAGGACAGG + Intergenic
1118378274 14:65196165-65196187 GGGTTGGCTCATGAGAGAAATGG + Intergenic
1121664365 14:95660671-95660693 GGGTTGGACCATGGGAGGGGAGG - Intergenic
1125513517 15:40305536-40305558 GGGTGGGCCCATGGGAGAGTGGG + Intronic
1133221421 16:4320681-4320703 GGAGTGGCCCAGGGGAGAACTGG - Intronic
1136607858 16:31348542-31348564 GGGTGGGTGGATGGGTGAACAGG + Intergenic
1138111760 16:54329758-54329780 GGGCTGGGCCATGGCAGAAGTGG + Intergenic
1141110155 16:81265517-81265539 GGGTTGATGGATGGGAGAATGGG - Intronic
1141192542 16:81834896-81834918 GCCTTGGTCCATTGTAGAACTGG + Intronic
1141282552 16:82642012-82642034 GAGTTGGTGAATGGAAGAACTGG - Intronic
1141808373 16:86357327-86357349 GGGATGGTCCCTGGGAACACTGG + Intergenic
1142161271 16:88558820-88558842 GCGCTGGTCCATGGGAGACGCGG - Intergenic
1148075039 17:44930774-44930796 TGGTTGTTCCCTGGGAGATCAGG + Intronic
1157195584 18:45617797-45617819 GGCTGGGTCCCTGGGAGCACTGG - Intronic
1158087200 18:53665697-53665719 AGGTTGTTCCATGGTAGAAATGG + Intergenic
1159554136 18:69927532-69927554 GGGGTGGGGGATGGGAGAACAGG - Intronic
1160033709 18:75282848-75282870 GGGGTGGGCCATGGGAGGGCTGG + Intronic
1160060896 18:75527878-75527900 TGAGTGGTGCATGGGAGAACAGG + Intergenic
1160269224 18:77368978-77369000 AGGTGGGACTATGGGAGAACAGG - Intergenic
1160551839 18:79698403-79698425 GGGTTTGTGCTTGGGAGAACTGG + Intronic
1160722614 19:604127-604149 GGGTGGGGCTATGGGAGATCTGG + Intronic
1160722657 19:604250-604272 GGGTGGGGCTATGGGAGATCTGG + Intronic
1161258692 19:3323607-3323629 GGGGTGGTCCCTGGGAGAGGGGG + Intergenic
1161301122 19:3543696-3543718 GGGTGGGTCCTTGGGAGGCCAGG + Intronic
1162932787 19:13965694-13965716 TGCTTGGTCCATTGGAGCACGGG + Exonic
1163236719 19:16034257-16034279 GGATTGGTCAATGGGGGACCAGG + Intergenic
1163987967 19:20970785-20970807 GGGTAGGACCAAGGGAGAAAAGG - Intergenic
1166373263 19:42313886-42313908 GGGATGGTCTTTGGGAGCACGGG + Intronic
1167614504 19:50524990-50525012 GGCTTGCTCCATGGCAGAGCTGG + Intronic
1167644703 19:50699629-50699651 GGGTTGGTATATCGGAGGACTGG + Intronic
1167733737 19:51278545-51278567 GTTTTGAACCATGGGAGAACGGG - Intergenic
1168419347 19:56191073-56191095 GGGGTGGTCCATGGGAAGTCTGG - Intronic
932398259 2:71462897-71462919 TGTTTGGTCCATGGGTGACCAGG + Intronic
936382243 2:111996448-111996470 GGGTTTGTCCCTGGGAGACAAGG - Intronic
938604358 2:132876928-132876950 GGGTTGACCTACGGGAGAACTGG + Intronic
939801887 2:146720801-146720823 TGATTGGTCCATGGGTGACCAGG - Intergenic
1169308403 20:4514657-4514679 GGGTTCCTCCAGGGGAGAGCTGG + Intergenic
1170683469 20:18547559-18547581 GTGTTGGTGCAGGGGAGAAAGGG - Intronic
1172649932 20:36495730-36495752 GAGTTGGACCAGTGGAGAACAGG + Intronic
1180599847 22:17008506-17008528 GGGTGGCTCCTTGGGAGAAGAGG + Intergenic
1180761963 22:18217360-18217382 AGGTAGGTCCATGGGAAGACAGG - Intergenic
1180773704 22:18407250-18407272 AGGTAGGTCCATGGGAAGACAGG + Intergenic
1180805053 22:18656794-18656816 AGGTAGGTCCATGGGAAGACAGG + Intergenic
1180805690 22:18712614-18712636 AGGTAGGTCCATGGGAAGACAGG - Intergenic
1181069760 22:20325967-20325989 AGGTAGGTCCATGGGAAGACAGG + Intergenic
1181192803 22:21154175-21154197 AGGTAGGTCCATGGGAAGACAGG + Intergenic
1181216639 22:21338399-21338421 AGGTAGGTCCATGGGAAGACAGG - Intergenic
1181544814 22:23596215-23596237 AGGTTGGACCCGGGGAGAACTGG - Intergenic
1181815492 22:25433647-25433669 AGGTTGGACCTGGGGAGAACTGG + Intergenic
1182089776 22:27586248-27586270 GGGTGGGTTGATGGGAGAATGGG - Intergenic
1183630810 22:39031612-39031634 GGGTGGGGCGATGGGAGAAGAGG - Intronic
1184255813 22:43286273-43286295 GAGATGGTCCATGGTAGAGCTGG + Intronic
1184861319 22:47174662-47174684 GGAGTGGTCCATGGCGGAACCGG - Exonic
1185057399 22:48588088-48588110 GGGTTGGTCCATGGGAGAACTGG + Intronic
1203235534 22_KI270731v1_random:148224-148246 AGGTAGGTCCATGGGAAGACAGG + Intergenic
950494110 3:13323632-13323654 AGCTTGTTCAATGGGAGAACTGG - Intronic
950747670 3:15103300-15103322 GGTTTTGTCCATGGGAGAGAAGG - Intergenic
955206255 3:56898620-56898642 GGGGTGATCCCTGGAAGAACTGG + Intronic
963533834 3:146503484-146503506 GGGTTGGGTAGTGGGAGAACAGG - Intergenic
964191282 3:154003970-154003992 GGTTTGGGTCATGGCAGAACAGG - Intergenic
967519654 3:190414983-190415005 TGATTGGTCCATGGGTGAATTGG + Intergenic
968267709 3:197375533-197375555 GTGTTGGCCCATGAGAGAGCAGG + Intergenic
968643598 4:1727512-1727534 GAGCTGGTCCCTGGGAGGACAGG + Intronic
970654755 4:18218784-18218806 GGGGTGGGACATGGGAGAGCAGG + Intergenic
970656076 4:18231174-18231196 GGGATAGTCAATGGCAGAACTGG - Intergenic
977980140 4:103311538-103311560 GGATTGGTCAATGAGAGAAAAGG + Intergenic
985617327 5:931293-931315 GGGTTGGTTCAGGGGAGCTCTGG - Intergenic
985858488 5:2449784-2449806 GGGTTGGCCCCTGTGAGAAGTGG - Intergenic
987757198 5:22111392-22111414 GGGTTGGTCTCAGGGAAAACGGG - Intronic
988492294 5:31715107-31715129 GGGTTGGTCCATGGGTTGATAGG + Intronic
989586160 5:43075211-43075233 GGGTAGGTCCATGGGGGATGTGG + Intronic
995583048 5:113620682-113620704 GCGCTGGTCCCTGGGAGAAGAGG + Intergenic
998065578 5:139155674-139155696 GGGCTGGTCTTTGGGGGAACAGG - Intronic
1001701506 5:173709965-173709987 TGGGTGGTCCATGGGAAAAGGGG + Intergenic
1002585855 5:180247472-180247494 GGGTTGCATCATGGGAGAGCTGG - Exonic
1003083081 6:3037830-3037852 GGTTTGTTCCATGGCGGAACTGG - Intergenic
1007560754 6:42806328-42806350 GGGTTGGGGCAGGGGAGGACAGG + Intronic
1008778232 6:55067432-55067454 GGGTTGGAGCAAGGGAGAAATGG - Intergenic
1009350937 6:62678126-62678148 GGGTGGGTCCATGGGCAAGCAGG + Intergenic
1010075183 6:71789746-71789768 GTGCTGGTCCCTGGGAGAAGAGG - Intergenic
1011645540 6:89454403-89454425 GGGTTTATCCCTGGGAGATCAGG + Intronic
1013484854 6:110587108-110587130 GGTTTGGTGCATGGGAGCCCTGG + Intergenic
1016336529 6:143011327-143011349 GAGATAGTCCCTGGGAGAACAGG - Intergenic
1016901640 6:149108720-149108742 GGGTTGGCCTCTGGGGGAACAGG - Intergenic
1017948400 6:159115477-159115499 TGGCTGGTCCATGGCAGAGCTGG - Intergenic
1019127757 6:169852278-169852300 GGGCTGGGCCATGCGAGAGCCGG - Intergenic
1019577148 7:1743089-1743111 GGGGGGGTCCATGGGGGAGCAGG + Intronic
1020091572 7:5345065-5345087 GGTCTGTGCCATGGGAGAACGGG - Intronic
1021210592 7:17847727-17847749 GAGTTTGTCCATGAGAGAATGGG - Intronic
1021584241 7:22190849-22190871 GAGAGGGTCCATGGGAGAAAAGG - Intronic
1021939665 7:25667355-25667377 GTGGTGGGCCATGGAAGAACAGG + Intergenic
1027791343 7:82641277-82641299 GCGCTGGTCCCTGGGAGAAGAGG - Intergenic
1029863461 7:103600561-103600583 GGGCTGGTGCAAGGGAGACCTGG - Intronic
1033088509 7:138364303-138364325 GGTTTGGTTCATGGGAACACTGG - Intergenic
1034272664 7:149810988-149811010 TGGTTCGTCCATGTGAAAACTGG + Intergenic
1038230896 8:25698650-25698672 GAGTTAGTCCATGAGAGAAGGGG + Intergenic
1043658201 8:82699880-82699902 GGGTTGGATCATGGGACAAATGG - Intergenic
1047000478 8:120568144-120568166 GGGATGGTCCATGCCAGAAATGG - Intronic
1047799339 8:128292742-128292764 GGGGTGCTCCATGATAGAACTGG - Intergenic
1052367435 9:27628515-27628537 GGGTTGGTTGATGGGGGAAGTGG + Intergenic
1059728734 9:117035170-117035192 GCTTTGGTCCCTGGGAGACCTGG + Intronic
1061933319 9:133844429-133844451 GGATTTGTCCATCAGAGAACGGG + Intronic
1062556449 9:137115161-137115183 GGGTTTGTCCAAGCGATAACGGG + Intronic
1189352865 X:40290012-40290034 AGGTTGATCCATGAGAGAACAGG + Intergenic
1192739387 X:73877741-73877763 GGGTTGCTCCATCAGAGAACAGG + Intergenic
1197312621 X:124924586-124924608 GTCATGGTCCCTGGGAGAACAGG - Intronic
1198765392 X:140074980-140075002 GGGTTGGAACATGTGGGAACAGG - Intergenic
1198771750 X:140138182-140138204 GGGTTGGAACATGTGGGAACAGG - Intergenic
1199951382 X:152708745-152708767 GGGTTGTGCCAGGGGAGGACAGG + Intergenic
1199954029 X:152727969-152727991 GGGTTGTGCCAGGGGAGGACAGG + Intronic
1199955660 X:152740484-152740506 GGGTTGTGCCAGGGGAGGACAGG - Intergenic
1199958301 X:152759716-152759738 GGGTTGTGCCAGGGGAGGACAGG - Intergenic
1201530838 Y:14988417-14988439 GTGCTGGTCCCTGGGTGAACAGG - Intergenic