ID: 1185057401

View in Genome Browser
Species Human (GRCh38)
Location 22:48588100-48588122
Sequence GGGAGAACTGGATGTTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057396_1185057401 2 Left 1185057396 22:48588075-48588097 CCAGTGGTTTGGGGGGTTGGTCC 0: 1
1: 0
2: 0
3: 3
4: 154
Right 1185057401 22:48588100-48588122 GGGAGAACTGGATGTTCACCAGG 0: 1
1: 0
2: 3
3: 17
4: 240
1185057388_1185057401 24 Left 1185057388 22:48588053-48588075 CCATCTGTGCATAATGGGGGCTC No data
Right 1185057401 22:48588100-48588122 GGGAGAACTGGATGTTCACCAGG 0: 1
1: 0
2: 3
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057401 Original CRISPR GGGAGAACTGGATGTTCACC AGG Intronic
901442338 1:9286065-9286087 GGGAGGCCTGGAAGTTCTCCTGG - Intergenic
902955493 1:19922123-19922145 TGGAGACCCAGATGTTCACCAGG - Intronic
904318148 1:29679461-29679483 GGGAGAGCTGGTTGGTCACAGGG - Intergenic
904484334 1:30814868-30814890 GGGACAACTGCATGTCCTCCTGG + Intergenic
907532799 1:55118383-55118405 GGGAAAACTGGATATTCACATGG + Intronic
907671602 1:56478906-56478928 GGCAGAACAGGATGGCCACCAGG - Intergenic
908386182 1:63643894-63643916 GTGAGAACTGTATGTTCAGGGGG + Intronic
908661307 1:66438397-66438419 GGGAGAAGAAGATGCTCACCTGG - Intergenic
908701190 1:66902755-66902777 GGGACAACTGGATATCCACATGG - Intronic
909198108 1:72652071-72652093 GTGAGAAGTGGCTGTTCACTTGG - Intergenic
912051660 1:105536860-105536882 GGGATAACTGGATATTCACAGGG - Intergenic
913966200 1:143379590-143379612 GGAATGACTGGAAGTTCACCAGG + Intergenic
914060574 1:144205197-144205219 GGAATGACTGGAAGTTCACCAGG + Intergenic
914118576 1:144761172-144761194 GGAATGACTGGAAGTTCACCAGG - Intergenic
914504767 1:148279482-148279504 TGGAGATCTGGATTTTCATCTGG - Intergenic
915709025 1:157875697-157875719 GGGAAATCTGGATGTTCATCTGG - Intronic
917458169 1:175203670-175203692 AGCAGCACTGGATTTTCACCAGG - Intergenic
918237947 1:182598470-182598492 GGGAGAGCTTGATATTCACCTGG - Intergenic
923466485 1:234251693-234251715 GGGAGAACTAGCTGTTCTACAGG + Intronic
924888536 1:248247613-248247635 GACAGAACTTGATTTTCACCAGG + Intergenic
1062822563 10:545786-545808 GGGACAACTGGATATCCACATGG - Intronic
1062834609 10:627375-627397 AAGAGAACTGGATTTTCAGCTGG + Intronic
1063083038 10:2786562-2786584 TGGAGAAGTGGATGTTCTCAGGG + Intergenic
1064122824 10:12634429-12634451 GGGACAACAGGATGATCACTTGG - Intronic
1064966066 10:21016233-21016255 TGGCCAAGTGGATGTTCACCAGG + Intronic
1067556561 10:47277270-47277292 GGAAGCAGAGGATGTTCACCAGG - Intergenic
1076045943 10:127294227-127294249 GGGAGAAAAGGAAGTTCAACTGG - Intronic
1077238848 11:1500131-1500153 GTGTGAACCTGATGTTCACCTGG - Intronic
1077675384 11:4190060-4190082 GAGAGAACCTGAGGTTCACCAGG - Intergenic
1078835646 11:15026753-15026775 AGGAGAACTAGATGGTCACTTGG + Intronic
1079120019 11:17675486-17675508 GGGTCAACTGGATGTCCACAGGG + Intergenic
1081170390 11:39862107-39862129 GGGACAACTGGATATCCACAGGG - Intergenic
1081640354 11:44749055-44749077 GGCAGAGCTGGATCTGCACCTGG + Intronic
1082202202 11:49385879-49385901 GGCAGAACTGGGTGCCCACCAGG + Intergenic
1082897513 11:58207791-58207813 GGTAAAACTGGATATTCACATGG + Intergenic
1083026282 11:59553889-59553911 GTAAGAAGTGGAGGTTCACCGGG + Intergenic
1083666101 11:64275560-64275582 GGGAGAGCTGGATATTCACCTGG - Intronic
1084672359 11:70614862-70614884 GGGAGTACTGGATGTCCCCATGG + Intronic
1086653465 11:89320270-89320292 GGCAGAACTGGGTGCCCACCAGG - Intergenic
1087155416 11:94896959-94896981 GGGAGGACTGCATGTCCCCCTGG - Intergenic
1091455386 12:603613-603635 GGGATAACTGGATGTCCACATGG - Intronic
1091796881 12:3302400-3302422 GAGAGAGCTGGATGTACACAGGG + Intergenic
1094308680 12:29052422-29052444 GGGAAAACTGAATATTCACATGG - Intergenic
1095290989 12:40480144-40480166 GGGACAACTGGAACTTCATCTGG + Exonic
1095291252 12:40482688-40482710 GGGATAACTGGATCATCACCTGG + Exonic
1095291257 12:40482718-40482740 GGGACAACTGGATCATCACCTGG + Exonic
1095291288 12:40482985-40483007 GGGACAACTGGACTATCACCTGG + Exonic
1095291308 12:40483135-40483157 GGGACAACTGGACCATCACCTGG + Exonic
1095291436 12:40484062-40484084 GGGACAACTGGACTATCACCTGG + Exonic
1095291468 12:40484242-40484264 GGGACAACTGGATCATCAGCTGG + Exonic
1095291583 12:40485049-40485071 GGGACAATTGGATCATCACCTGG + Exonic
1095291590 12:40485079-40485101 GGGACAACTGGATCATCAACTGG + Exonic
1095291596 12:40485109-40485131 GGGATAACTGGATTATCAGCTGG + Exonic
1095292207 12:40489361-40489383 GGGACAACTGGATCATCAGCTGG + Exonic
1095292443 12:40491068-40491090 GGGACAACTGGATTATCAGCTGG + Exonic
1095773957 12:45991797-45991819 GGGAGGACTGGAAGGTCAGCTGG - Intronic
1096285513 12:50296270-50296292 GGAACAACTGGATATTCACATGG - Intergenic
1096932528 12:55229028-55229050 CAGAGGACTGGAGGTTCACCAGG + Intergenic
1101103453 12:101417982-101418004 AGGACAACTGGATATTCACATGG - Intergenic
1102099869 12:110270066-110270088 GAAAGAACTGGATTTTCACAGGG + Intergenic
1102205651 12:111089098-111089120 GGGAGAACTGCATCTCCACTTGG - Intronic
1105750828 13:23420666-23420688 TCGGGAACTGGATGTCCACCTGG + Intronic
1106596397 13:31143461-31143483 GGCAGAACTTGATATTTACCAGG - Intronic
1109206391 13:59487561-59487583 GGGAGAACTGGTTGTTTAAATGG - Intergenic
1110245160 13:73315181-73315203 GAGAAAACTGGATATTCACATGG + Intergenic
1111424281 13:88058815-88058837 GGGAAAACTGGATTTCCACCTGG - Intergenic
1112687640 13:101849816-101849838 GGGAGAGCTGGAGTTTGACCTGG - Intronic
1113742599 13:112721864-112721886 GGGCGACCAGGAGGTTCACCAGG + Intronic
1114032387 14:18588340-18588362 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1114077168 14:19167366-19167388 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1114084995 14:19232198-19232220 CTGAGTGCTGGATGTTCACCTGG + Intergenic
1114274594 14:21131198-21131220 GGGATAACTAGATGTCCACATGG + Intergenic
1114570413 14:23663355-23663377 GAGACAACTGTCTGTTCACCAGG + Intergenic
1115661735 14:35501692-35501714 GGGAAAACTGGATATCCACATGG + Intergenic
1116153616 14:41174456-41174478 GGGAAAACTAGATGTCCACGTGG + Intergenic
1118160232 14:63281197-63281219 GGCAGAATAGGATGTTCACGAGG - Intronic
1118630043 14:67694680-67694702 GGGAGAACTGAGTGTTCAGAAGG + Intronic
1119106103 14:71925615-71925637 GGGAAAACTGGATATCCACATGG - Intergenic
1121313189 14:92946119-92946141 GGGAGAGCTGCACGTCCACCTGG - Intronic
1122728160 14:103774071-103774093 GGGATAACTGGATATTTACATGG + Intronic
1123064362 14:105609105-105609127 GGGAGAACTCGCTCATCACCTGG - Intergenic
1123093598 14:105753514-105753536 GGGAGAACTCGCTCATCACCTGG - Intergenic
1124527310 15:30469068-30469090 GAGACACCTGGATGTTCATCAGG - Intergenic
1124742897 15:32313947-32313969 GGGAGATCTGCCTGCTCACCCGG - Intergenic
1124771343 15:32538615-32538637 GAGACACCTGGATGTTCATCAGG + Intergenic
1125830438 15:42712528-42712550 GGGAGAACTGGATATCCATATGG - Intronic
1127549259 15:60021128-60021150 GGCAGAACTTGATGTACATCAGG - Intronic
1131457653 15:92595925-92595947 GGGGGAACTGGATATGCACAGGG + Intergenic
1131900356 15:97081469-97081491 TGGAGAACAGGATGTTTACATGG - Intergenic
1133706726 16:8361771-8361793 GGGAGTACTGGGTGCTTACCCGG + Intergenic
1136456241 16:30381382-30381404 GGGAGTCCTGGATGTTCTTCCGG + Exonic
1138507861 16:57486987-57487009 GGGAGAACTGGATGTTTTGAGGG - Intronic
1138999989 16:62498298-62498320 GGGAGAAATGGATGTGCAGAAGG + Intergenic
1141004621 16:80340341-80340363 GGAAGAACTGGATGCCCAGCTGG - Intergenic
1142867599 17:2800079-2800101 GGGAAATATGGATGTCCACCTGG + Intronic
1143566118 17:7721823-7721845 GGCAGAACTGAATGCTCAGCAGG + Intronic
1143741990 17:8961149-8961171 GGAGGAACTGGCAGTTCACCAGG + Intronic
1143976398 17:10833149-10833171 GGAACAACTGGATATTCACATGG + Intronic
1144907836 17:18650924-18650946 GGGAGAACTTTATCTTAACCTGG + Intronic
1147322794 17:39656357-39656379 GAGGGAACTGGATGGACACCAGG - Intronic
1148677473 17:49453527-49453549 GGATGAACTGGAAGTTCCCCAGG - Intronic
1151835753 17:76581642-76581664 GGGAGAAGTGGCTGAGCACCAGG - Intronic
1152101532 17:78304570-78304592 GGAAGAACAGGATGCTCTCCCGG - Intergenic
1152388105 17:79987101-79987123 GGCAGAACTGGCTGCCCACCAGG + Intronic
1153548007 18:6229688-6229710 GGGAAAACTGGATATTCACATGG - Intronic
1159432378 18:68369865-68369887 GGGAAAACTGGATATTCGCATGG + Intergenic
1159590147 18:70325262-70325284 TGGAGACCTGCATCTTCACCTGG + Exonic
1159999662 18:75004619-75004641 TTGAGAACTGGAATTTCACCAGG + Intronic
1161138836 19:2636364-2636386 GTGAGAACTGGCTGTGGACCTGG - Intronic
1161519329 19:4714786-4714808 GTGAGAACTGGTTGTTATCCCGG - Intronic
1161771310 19:6232368-6232390 GGGACAACTGGATACCCACCCGG + Intronic
1163242068 19:16070407-16070429 CGGAGACCTGGATGCTCCCCAGG - Intronic
1165803728 19:38567884-38567906 GGGAGAACTGGAGGTGCAGAGGG + Exonic
1168567356 19:57435956-57435978 GGGAAAACAGGATGTTGAACGGG + Intronic
1202699981 1_KI270712v1_random:157085-157107 GGAATGACTGGAAGTTCACCAGG + Intergenic
925206239 2:2008895-2008917 GGGAAAACTGAATTTTCACATGG - Intronic
925567690 2:5273911-5273933 GGGGGAACTAGGTGTTCTCCAGG - Intergenic
927849781 2:26491610-26491632 GGGAGAGGTGGATTTTCAGCAGG + Intronic
932703233 2:74004632-74004654 GGGAGTAGTGGATGATCACCTGG + Intronic
934170913 2:89540560-89540582 GGAATGACTGGAAGTTCACCAGG + Intergenic
934281218 2:91614878-91614900 GGAATGACTGGAAGTTCACCAGG + Intergenic
935942151 2:108251341-108251363 AGGAGAACTGGCTGGTCACATGG + Intronic
937292398 2:120789492-120789514 GGGCAGACTGGATGGTCACCAGG + Intronic
941062760 2:160866535-160866557 GGGAGAACTTGCTGATCATCAGG + Intergenic
947063511 2:226193826-226193848 GGGAGAACTACATTTTCACAGGG - Intergenic
948928695 2:241116460-241116482 GGGTGACGTGGATGTTCTCCGGG - Intronic
949060694 2:241955357-241955379 GGGAGACATGGGTGTTCAACGGG + Intergenic
1169496577 20:6121735-6121757 GGCAGACCTGGATTTCCACCTGG - Intronic
1171212421 20:23327137-23327159 TGGAGAGCAGGAGGTTCACCAGG - Intergenic
1172487539 20:35307340-35307362 AGGGGAACAGGATGTTCAGCAGG + Intronic
1173817279 20:45997850-45997872 GGGAGGACTGGATTTGGACCAGG + Intergenic
1174449183 20:50609317-50609339 GGGGGCCCTGGAGGTTCACCTGG - Exonic
1176708876 21:10133730-10133752 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1179434839 21:41353588-41353610 GGGAAAGCTGGATATTCACATGG + Intronic
1179524244 21:41965510-41965532 GGGTGACCTGGAGGCTCACCTGG + Intergenic
1179822331 21:43944013-43944035 GGCAGAGCTGGGTGTTCTCCTGG + Intronic
1180292974 22:10860995-10861017 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1180456498 22:15515397-15515419 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1180495780 22:15890417-15890439 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1183090451 22:35518748-35518770 CGGAGAACAGGATGGTCACAAGG - Intergenic
1183609368 22:38887873-38887895 GGGAAAACTGGATATCCACATGG + Intergenic
1183835123 22:40446182-40446204 GGGAAAACAGGATTTTCACGTGG - Intronic
1185057401 22:48588100-48588122 GGGAGAACTGGATGTTCACCAGG + Intronic
949339858 3:3017737-3017759 GGGAGAAGTGGGTGCTCACGAGG + Intronic
953971868 3:47354541-47354563 TGGAGAAATTGATGTTCAGCTGG - Intergenic
954714688 3:52521203-52521225 GGGGGGTCTGGATGTTCTCCAGG + Intronic
955285493 3:57637193-57637215 GGCAGAACTTGATATTTACCTGG + Intronic
957420559 3:79963752-79963774 GGGAAAACTGGATATCCACATGG + Intergenic
959094060 3:101934352-101934374 GAGAGAAGATGATGTTCACCGGG + Intergenic
959865468 3:111264526-111264548 GAGAAAACTGGATATTCACATGG + Intronic
961429728 3:126872768-126872790 GGCAAAACAGGATGTTCTCCAGG + Intronic
962834584 3:139176836-139176858 GGGAAAACTGGATATCCACATGG - Intronic
963701183 3:148628715-148628737 GGAAGAACTGGATATCCACAAGG + Intergenic
965150165 3:164962981-164963003 TGGAGAAGTGGATTTGCACCAGG + Intergenic
966632562 3:182094898-182094920 GGGAGAACTGGATGTGAAGGGGG - Intergenic
969028859 4:4195319-4195341 GGAATGACTGGAAGTTCACCAGG - Intronic
969502273 4:7560321-7560343 GGGATGAATGGATTTTCACCTGG + Intronic
970142464 4:12997078-12997100 GGAAGAAGTGAATGTTCACTTGG - Intergenic
971048836 4:22837316-22837338 GGGAAAACTGGATTTTCACAGGG + Intergenic
973596300 4:52493986-52494008 GGGAAAACTAGATATTCACATGG + Intergenic
974302899 4:60092616-60092638 GGGACTACTGGATATTCACTTGG + Intergenic
975487975 4:74956019-74956041 TGAAGAACTGTATGTTCAGCTGG - Intronic
976768089 4:88619411-88619433 GGTATAAGTGGCTGTTCACCTGG + Intronic
980239190 4:130151240-130151262 GGGAAAACTGGATATTCACATGG + Intergenic
985701800 5:1378032-1378054 GGGACCACTCCATGTTCACCCGG + Intergenic
986181002 5:5392929-5392951 GGAAGAGCTGGAAGCTCACCTGG + Intergenic
987439667 5:17940806-17940828 TGGAGAAATGTATTTTCACCTGG - Intergenic
989264397 5:39456218-39456240 GAGTGCACTGGATGCTCACCAGG - Intronic
989636303 5:43538926-43538948 GGGAGAACTTTATCTTAACCTGG - Exonic
990166167 5:52995648-52995670 GAGACATCTGGATGTACACCTGG + Intronic
991276255 5:64850366-64850388 GGGAAAACTGGATATCCACATGG + Intronic
992774747 5:80079662-80079684 GGGAGCAATGGATGTGCAGCAGG + Intronic
993776690 5:92008763-92008785 GGGAAAACTGGATATCCACTTGG + Intergenic
994637410 5:102360472-102360494 GGGAAAACTGGATATCCACATGG + Intergenic
995207587 5:109499639-109499661 GAGAGAAGTGGATGCTCACATGG - Intergenic
996521552 5:124432501-124432523 GGGAAAACTGGATATCCACATGG + Intergenic
998218758 5:140258012-140258034 GGGAGAACTGAATGTCAACCAGG + Intronic
998624427 5:143829435-143829457 GGAAGAACTCAATGGTCACCGGG - Intergenic
999059685 5:148620084-148620106 TTGAGGGCTGGATGTTCACCTGG + Intronic
999216468 5:149939749-149939771 GTGAGATCTGGATGTGAACCAGG - Intronic
999911107 5:156200443-156200465 GGGAAAACTGGATATACACATGG + Intronic
1000968829 5:167691745-167691767 AGGAGAACTGGGAGTTCTCCAGG + Intronic
1001398322 5:171432238-171432260 AGGAGAAGTGGATGTTCCCGAGG + Intronic
1001917315 5:175572389-175572411 GGGATAACTAGATATTCACATGG + Intergenic
1004318815 6:14616150-14616172 GGCAGGAATGGATGTTCCCCTGG - Intergenic
1006278482 6:33026982-33027004 GGGAAAACTGGATATCCACATGG - Intergenic
1007394718 6:41570868-41570890 GGGAGAGCTGGCTTTTCCCCTGG + Intronic
1007475388 6:42116407-42116429 GGCAGAACTGGATGACCAGCTGG - Intronic
1008215297 6:48780500-48780522 GGAAGAAATGGATGTTAACAAGG + Intergenic
1010431768 6:75785794-75785816 GGGACAACTGGATATCCACTTGG - Intronic
1012705990 6:102531288-102531310 AGGAGAACTGGATATCCACATGG + Intergenic
1013492026 6:110657180-110657202 GAGAGAACTGGGTTTTCATCTGG - Intronic
1015887738 6:137936210-137936232 GGGAAAACTAGATGTCCACATGG - Intergenic
1016590299 6:145735835-145735857 GAGAGAACTGGACGATCGCCTGG - Exonic
1017593386 6:156001409-156001431 GGGAAAACTGGATATCCACATGG - Intergenic
1018212363 6:161494833-161494855 AGAAGAACTTGATGTTCGCCTGG - Intronic
1021288211 7:18809118-18809140 GGGAAAACTGGATATCCACATGG + Intronic
1021678773 7:23107720-23107742 GGGACCCCTGGTTGTTCACCAGG - Intronic
1023419917 7:39968381-39968403 GGGAAAACTGGATATCCACATGG - Intronic
1023825909 7:44008681-44008703 GGGAGATGTGGATTTTCAGCAGG + Exonic
1023848935 7:44139878-44139900 TGGAGACATGGATGCTCACCTGG - Intronic
1024852752 7:53740411-53740433 GGCAAAACTGGATTTTCACATGG + Intergenic
1025120504 7:56297680-56297702 TGCAGAGCTGGATTTTCACCAGG - Intergenic
1026089479 7:67287532-67287554 GGGAGATGTGGATTTTCAGCAGG + Intergenic
1026724802 7:72862968-72862990 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1026746930 7:73021164-73021186 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1026750582 7:73049307-73049329 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1026754229 7:73077417-73077439 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1026757881 7:73105450-73105472 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1027033035 7:74905735-74905757 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1027089522 7:75288034-75288056 GGGAGATGTGGATTTTCAGCAGG + Intergenic
1027093167 7:75315962-75315984 GGGAGATGTGGATTTTCAGCAGG + Intergenic
1027096810 7:75343929-75343951 GGGAGATGTGGATTTTCAGCAGG + Intergenic
1027119074 7:75502847-75502869 GGGAGATGTGGATTTTCAGCAGG + Intergenic
1027272753 7:76532758-76532780 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1027322537 7:77023751-77023773 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1027326201 7:77051843-77051865 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1027364941 7:77447694-77447716 GGGAGATTTGGCTGCTCACCAGG - Intergenic
1029397920 7:100320905-100320927 GGGAGATGTGGATTTTCAGCAGG + Exonic
1029718424 7:102347185-102347207 GGGAGATGTGGATTTTCAGCAGG - Intergenic
1029754192 7:102562070-102562092 GGGAGATGTGGATTTTCAGCGGG + Intronic
1029772142 7:102661160-102661182 GGGAGATGTGGATTTTCAGCGGG + Intronic
1031637343 7:124117851-124117873 GGGAAAACTGGATATCCACATGG + Intergenic
1031876608 7:127148866-127148888 GGGAAAACTGGATTTCCACATGG + Intronic
1031953427 7:127916158-127916180 GGGAGAATTTGCAGTTCACCTGG + Intronic
1033395244 7:140967682-140967704 TGGAGAACTGCATGGTCAACAGG - Intergenic
1034471618 7:151257728-151257750 AGGAGAACTGGATGGTCCCCGGG - Intronic
1037497893 8:19458182-19458204 GGAAGGACTGGGTTTTCACCAGG - Intronic
1040004338 8:42606101-42606123 GGGAAAACTGGATTTCCACATGG - Intergenic
1041229408 8:55733722-55733744 GGGAAAACTGGATATTCACCAGG + Intronic
1043530383 8:81143461-81143483 AGGAGCACTGGATCTTCACATGG - Intergenic
1045078589 8:98599468-98599490 GGTTGAACTGGATGTTTATCAGG + Intronic
1046999612 8:120560766-120560788 GAGAAAAGCGGATGTTCACCAGG + Intronic
1047081140 8:121462156-121462178 GGGAAAACTGGATATTCACCTGG + Intergenic
1047716523 8:127600622-127600644 GGCAGAGCTGAGTGTTCACCTGG - Intergenic
1048389568 8:133948520-133948542 AGAAGAAGTGAATGTTCACCAGG + Intergenic
1048575813 8:135689218-135689240 GGAGGACCTGGATGTACACCAGG + Intergenic
1049589322 8:143449096-143449118 GGGAGAACTGAATGGTGTCCTGG - Intronic
1051945282 9:22562016-22562038 GGGAAAACTGGATATCCACAGGG + Intergenic
1052175415 9:25456473-25456495 GGGAGCAGTGGCTGTCCACCAGG - Intergenic
1053019697 9:34686396-34686418 TTGAGAACTGGATGTGCTCCTGG + Intergenic
1053436561 9:38079283-38079305 GGGAAAATTGGATTTTCACATGG - Intergenic
1053451853 9:38200412-38200434 GGGATGACTGGATGATCACCAGG + Intergenic
1053645853 9:40119245-40119267 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1053759865 9:41344291-41344313 CTGAGTGCTGGATGTTCACCTGG + Intergenic
1054538718 9:66256727-66256749 CTGAGTGCTGGATGTTCACCTGG + Intergenic
1057355571 9:94328477-94328499 GGGAGCACTGGATGTCCCCAGGG - Intronic
1057652185 9:96929145-96929167 GGGAGCACTGGATGTCCCCAAGG + Intronic
1058272549 9:102991084-102991106 GGGAAAACTGGATATTCTACAGG + Intergenic
1202793637 9_KI270719v1_random:102700-102722 CTGAGTGCTGGATGTTCACCTGG - Intergenic
1186728997 X:12388090-12388112 GGGAGAACTGGGTATTCACTGGG + Intronic
1186828361 X:13364479-13364501 GGGAGAAAGGGATGTGCACTGGG + Intergenic
1187044179 X:15629718-15629740 TGGAGAACAGGATATTCACATGG + Intronic
1188448599 X:30284685-30284707 AGAAGTCCTGGATGTTCACCTGG - Intergenic
1190854740 X:54282747-54282769 GGAAAAACTGGATGTCCACATGG + Intronic
1192183002 X:68928000-68928022 GGAAGATCTGTGTGTTCACCTGG + Intergenic
1192501587 X:71657373-71657395 GGGGGAACTGGATATTCACACGG + Intergenic
1194518057 X:94882941-94882963 GGGAAAACTGGATATCCACAAGG - Intergenic
1195367623 X:104141302-104141324 GGGACAACTGGATATGCGCCTGG + Intronic
1197541557 X:127769453-127769475 GGGAAAACTGGATATCCACTTGG + Intergenic
1200066351 X:153505871-153505893 TGGAGATCTTGTTGTTCACCAGG - Exonic