ID: 1185057599

View in Genome Browser
Species Human (GRCh38)
Location 22:48589067-48589089
Sequence GGGTCTGAAGATGGATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185057599_1185057601 -10 Left 1185057599 22:48589067-48589089 CCAGAAAATCCATCTTCAGACCC 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1185057601 22:48589080-48589102 CTTCAGACCCTCCTGTCCCCAGG 0: 1
1: 0
2: 2
3: 21
4: 284
1185057599_1185057602 -9 Left 1185057599 22:48589067-48589089 CCAGAAAATCCATCTTCAGACCC 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1185057602 22:48589081-48589103 TTCAGACCCTCCTGTCCCCAGGG 0: 1
1: 0
2: 1
3: 27
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185057599 Original CRISPR GGGTCTGAAGATGGATTTTC TGG (reversed) Intronic
905823686 1:41013908-41013930 AGGGCTGAAGCTGGATTTACAGG + Intergenic
905841928 1:41188121-41188143 GGCTCTGAACATGCATTTTGAGG - Intronic
906089829 1:43169526-43169548 GGGTCTCAAGCTGGATTTTAGGG - Intronic
907340294 1:53730707-53730729 GATTCTGAAGATGGACTTGCAGG - Intronic
909754624 1:79208674-79208696 GGCTCTGAGGATGTATTCTCAGG - Intergenic
911163758 1:94707737-94707759 GCGGCTGAAGATGGCTTCTCAGG - Intergenic
911221932 1:95257287-95257309 GACTCTGAAGATGGATATCCAGG + Intergenic
912560047 1:110544544-110544566 GTGTCTGCACATGGATTTTTGGG + Intergenic
912978061 1:114347535-114347557 GCGTCTGGAGATGTATGTTCTGG + Intergenic
917765003 1:178206146-178206168 TCGTCTCAAGATGGCTTTTCTGG - Intronic
917918482 1:179728567-179728589 TGGTCTCCAGATGGGTTTTCTGG + Intergenic
918238999 1:182605364-182605386 GGGTCTAGAGTTAGATTTTCAGG + Intergenic
918479070 1:184957765-184957787 GAATCTGAAGTTGGATTCTCTGG - Intronic
918860769 1:189824106-189824128 GGTTCTGAAAATGTATTTCCTGG + Intergenic
919604352 1:199662982-199663004 GGGACTAGAGAGGGATTTTCTGG - Intergenic
919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG + Intronic
921056777 1:211548550-211548572 AGGTCTGAAGATTTGTTTTCTGG + Intergenic
1062937697 10:1400503-1400525 TGGGCTGCAGATTGATTTTCAGG - Intronic
1063071179 10:2666755-2666777 GGGTCTGAAGATTTATTGTTTGG - Intergenic
1068076783 10:52265679-52265701 AGCTCTGAAGATGCATTTGCTGG - Intronic
1069832571 10:71290234-71290256 GGGTCTGAAGTAGGGTTGTCTGG - Intronic
1071264290 10:83950626-83950648 GGCTTTGAAGTTGGAATTTCTGG - Intergenic
1071974354 10:90940042-90940064 GGGGCTGGAGTTGGATCTTCTGG + Intergenic
1074259727 10:111839876-111839898 GTCTCTTAAGATGGATTTTGTGG - Intergenic
1074688613 10:115982249-115982271 AGGTCTGAAGATGAATGATCCGG - Intergenic
1076305499 10:129463202-129463224 GGGCCTGGAGATGGATTTATGGG - Intergenic
1079417537 11:20253500-20253522 GGATTTGAAGATGGATCTCCAGG - Intergenic
1080527188 11:33135144-33135166 GGGTTTGAAAACTGATTTTCTGG - Intronic
1081961073 11:47137944-47137966 GGGTCTGAAGATAGAGTTGGAGG + Intronic
1082764348 11:57155349-57155371 TGGACTGAAGATGGATGTGCTGG - Intergenic
1084534739 11:69750063-69750085 TGGGCAGAAGATGGAGTTTCTGG + Intergenic
1086327215 11:85714465-85714487 GGGTGAGAAAATGGATTATCAGG + Exonic
1086777190 11:90852686-90852708 GGGCCTGAAGATATCTTTTCTGG + Intergenic
1087148669 11:94837996-94838018 AGGCCTGAACATGGATTTCCTGG - Intronic
1087436975 11:98132716-98132738 GGGTAAGAATATGTATTTTCTGG + Intergenic
1090131049 11:124142284-124142306 GGGTTTGAAGACCGATCTTCTGG + Intronic
1093507533 12:19885868-19885890 GGGACTGAAGCTGGGTTTCCTGG + Intergenic
1095068246 12:37810982-37811004 GAGTCTGAAAATGGATTTTTGGG + Intergenic
1095078438 12:37964870-37964892 GAGTCTGCAAATGGATTTTTGGG + Intergenic
1099791115 12:87335112-87335134 GAGACTGAAGATGGATTGTTAGG - Intergenic
1101446638 12:104741584-104741606 AGGTCTGAAGAGCAATTTTCTGG - Intronic
1103068013 12:117916059-117916081 GGGGCTGAAGATGAATTCTTGGG + Intronic
1103142604 12:118562795-118562817 GGCTCTGAAGCCGGACTTTCTGG - Intergenic
1106579685 13:31006434-31006456 GGGTCAGAAAATTGATTTACTGG + Intergenic
1107173059 13:37366549-37366571 TGGGCTGAAGATGTATATTCTGG + Intergenic
1108511099 13:51156508-51156530 GGCTCTGAAGACAGATTTCCTGG - Intergenic
1108732398 13:53248472-53248494 GGGTCAGAAGATGCTTTTCCTGG - Intergenic
1110043887 13:70803564-70803586 GTTTCTTAAGATGGATGTTCAGG + Intergenic
1112593502 13:100786291-100786313 GGGTCTTATGATGGCTGTTCTGG + Intergenic
1112706234 13:102072189-102072211 GGGAGAGAAGATGGAATTTCAGG + Intronic
1113305688 13:109075935-109075957 GGGTATGAAGATGTCTTATCTGG + Intronic
1113333317 13:109353180-109353202 TAGCCTGAAGAAGGATTTTCAGG + Intergenic
1114601499 14:23959140-23959162 GGGTCTGGAAATAGATTTTGGGG + Intronic
1114605681 14:23994270-23994292 GGGTCTGGAAATAGATTTTGGGG + Intronic
1114611189 14:24041909-24041931 GGGTCTGGAAATAGATTTTGGGG + Intergenic
1115424761 14:33245385-33245407 GGATCTGGAGATAGATTATCTGG - Intronic
1116126292 14:40790369-40790391 GGGTATGAAGAAGGATTCTGAGG - Intergenic
1118906195 14:70025186-70025208 GGGTCTGAAGATGCAGATTTGGG + Intronic
1119049155 14:71349326-71349348 GGGTCTTATGATCTATTTTCAGG + Intronic
1119696323 14:76716074-76716096 TGGTCGGAAGATGGGCTTTCAGG - Intergenic
1121081210 14:91109763-91109785 GGTTCTGGAGATGGGTTTTTGGG - Intronic
1122301282 14:100732581-100732603 GGCTCTGCAATTGGATTTTCTGG + Intronic
1122767753 14:104083538-104083560 GGACCTGAAACTGGATTTTCAGG + Intergenic
1125376426 15:39034992-39035014 GGTTCTGAGGATGCTTTTTCTGG - Intergenic
1125519298 15:40339300-40339322 GGGTATGAAGATGCATCTACTGG + Intronic
1125741445 15:41967546-41967568 GGAACAGAAGATTGATTTTCAGG + Intronic
1126593795 15:50366023-50366045 GGGTGTGAAGAAAGATTTTCAGG + Intergenic
1126892843 15:53224328-53224350 GGGTCTGTACAAGGATTTTATGG - Intergenic
1130938973 15:88492129-88492151 GGGTTAGAGGAAGGATTTTCTGG - Intergenic
1130972690 15:88746436-88746458 GGGTCTCAAGATTTATTTTCTGG - Intergenic
1132134587 15:99322652-99322674 GGGTCTGAAGATAATTTTCCAGG - Intronic
1132134906 15:99326267-99326289 GGGTCTGAAGATAATTTTCCAGG - Intronic
1132495989 16:263696-263718 GCGGCCGAAGATGGGTTTTCTGG - Exonic
1132857911 16:2055280-2055302 GGGACTGATGATGGGGTTTCTGG + Intronic
1136116379 16:28097471-28097493 GGGTCTCATGATGGATTGGCTGG - Intergenic
1136632780 16:31498775-31498797 GGTCCTGAAGATGGAGTTTAAGG - Intronic
1138118834 16:54381943-54381965 GGGTCTGAATATGAATTTAGAGG + Intergenic
1145061566 17:19737457-19737479 GAGTCTGAAGCTGGGTGTTCTGG - Intergenic
1147243782 17:39107713-39107735 GGGGCTGAAGCAGGATCTTCTGG - Intronic
1148447344 17:47745503-47745525 GGGGCTCAAGAAGGATTTTGGGG + Exonic
1148699824 17:49580669-49580691 GGGTCTGCAGATGGCAGTTCAGG - Intronic
1148908046 17:50923741-50923763 GTGCCTGAAGATGGATTCTGGGG - Intergenic
1150725418 17:67647653-67647675 GGGTCTGTAGATGGGTTCTTTGG - Intronic
1151887220 17:76930187-76930209 GGTTCTGTAGTTGAATTTTCAGG + Intronic
1154554112 18:15727367-15727389 GAATCTGCAGATGGATATTCGGG + Intergenic
1154555754 18:15751194-15751216 GAATCTGCAGATGGATATTCGGG + Intergenic
1155092061 18:22521668-22521690 GGTTCTGCAGATGGATGTTGTGG - Intergenic
1155411887 18:25555526-25555548 TGGTTTGGAGATGTATTTTCAGG + Intergenic
1156474626 18:37397844-37397866 GGGTCTGGGGATGGAATTCCTGG - Intronic
1158863981 18:61619656-61619678 GTGTCTGATGTTGGATGTTCTGG - Intergenic
1161450110 19:4340867-4340889 GGGTCTGGAGATTGCTTTTTTGG + Intronic
1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG + Intronic
1162802118 19:13117027-13117049 GGCTCTGGAGTTGGATTTACCGG + Exonic
1167179534 19:47892015-47892037 GGGCCTGCAGCTGGATTTTCAGG - Intergenic
928346172 2:30498534-30498556 GGGCCTGCAGTTTGATTTTCAGG + Intronic
930001532 2:46864934-46864956 GGGTTTCAACATGAATTTTCAGG + Intergenic
930258040 2:49114097-49114119 GAGTAAGATGATGGATTTTCTGG - Intronic
930369200 2:50482532-50482554 GGGACTGCATATGGATTTGCAGG + Intronic
930570588 2:53081121-53081143 TGGTCTGGACAAGGATTTTCAGG + Intergenic
930848642 2:55934003-55934025 GGGTCTGAAAAATGATCTTCAGG - Intergenic
935896204 2:107740340-107740362 TGGTATGAAGATGGAACTTCTGG + Intergenic
942010118 2:171753433-171753455 GGTTCTTAAGATGGATTTGAAGG + Intergenic
942112246 2:172693906-172693928 AGGTCTGAAAATGGATCTTGAGG - Intergenic
943006255 2:182391110-182391132 GGCTCTGAAAATGGATATTAAGG + Intronic
943856985 2:192808252-192808274 GGGCCTGCAGCTTGATTTTCAGG + Intergenic
948581171 2:238988173-238988195 GGGCCTGAAGAGGGATGTTGAGG - Intergenic
1172166397 20:32902330-32902352 GGGACTGGAGATGTATTTTTGGG + Intronic
1174337101 20:49870478-49870500 GGGTCTGAAGATAGATGTGCGGG + Intronic
1175466694 20:59194350-59194372 GGCCCTGAAGAAGGATCTTCTGG - Exonic
1175771108 20:61624886-61624908 GGTTCTGCAGATGGTGTTTCTGG - Intronic
1176912738 21:14586908-14586930 GGTTCTAAAGCTGGAATTTCTGG + Intergenic
1178168696 21:30013022-30013044 GGGACTGAAGTCTGATTTTCTGG - Intergenic
1181168687 22:20996426-20996448 GGGTCTGAACATGGAGGGTCAGG + Intronic
1181573610 22:23780795-23780817 GGGTCTGGAGCTGGATGTCCTGG + Intronic
1181998737 22:26903410-26903432 GCTTCTGAAGACGGATTTCCTGG + Intergenic
1182621527 22:31621207-31621229 TGGTCTGCACATGGATTCTCAGG + Intronic
1183684003 22:39351090-39351112 GGGTCTGGAGAGGGGGTTTCTGG + Intronic
1183754415 22:39746878-39746900 GAGTCTGAAGATTTGTTTTCTGG - Intronic
1184460327 22:44634185-44634207 GGATGTGTAGATGGGTTTTCAGG + Intergenic
1184536743 22:45092731-45092753 GGGCTTGAACATGGATTTTAAGG - Intergenic
1185057599 22:48589067-48589089 GGGTCTGAAGATGGATTTTCTGG - Intronic
950547143 3:13645221-13645243 GGGTCCAAACATGGAGTTTCTGG + Intergenic
951284147 3:20788808-20788830 GGGGCTGACTATGCATTTTCGGG + Intergenic
952100590 3:30007996-30008018 GGGTCCAAAGATGTATTTTTAGG - Intronic
953595700 3:44310704-44310726 GGCTCTGAAGCTGGATTGTCTGG - Intronic
954532993 3:51337047-51337069 GGTTCTGCAGAGGGATGTTCAGG + Intronic
957163804 3:76644643-76644665 GGGAGTGAAGATGGATTATGTGG - Intronic
958552758 3:95637671-95637693 GGGCCTGAAGAGTGCTTTTCTGG - Intergenic
959029912 3:101287085-101287107 AGGTCTGAAGTTAGGTTTTCAGG + Intronic
959037699 3:101385571-101385593 GGGTCACAAGATGTATTCTCTGG - Intronic
959663418 3:108895190-108895212 GAGGCAGAAAATGGATTTTCCGG - Intergenic
960134306 3:114090257-114090279 GGGCATGAAGCAGGATTTTCGGG - Intergenic
960571749 3:119191504-119191526 GGGGGTGATGATGGATATTCTGG - Intronic
961882597 3:130072939-130072961 GTGTCAGAAGTGGGATTTTCTGG + Intergenic
962587486 3:136857051-136857073 GGGACTCAAGGTGGATTATCAGG - Intergenic
973239899 4:47946196-47946218 GGGTCTGATGATGAATTATGTGG - Intronic
974510252 4:62830975-62830997 GGATCTGTAGATGTATTTTAAGG + Intergenic
977233952 4:94484714-94484736 GGGTTTGAAGTCGGATGTTCTGG + Intronic
980249132 4:130291329-130291351 AGGTCTGGAGATGTATTTTGGGG + Intergenic
980296527 4:130925472-130925494 TGGTCTGATTATGGATTTTCTGG + Intergenic
980325034 4:131332795-131332817 GGGACTGCAGCTTGATTTTCAGG - Intergenic
982112645 4:152070976-152070998 GGGGCTGAAGATGGATTCTGCGG - Intergenic
982243848 4:153328900-153328922 GGGTCTGAAGATAGAATTCAAGG + Intronic
982605804 4:157515033-157515055 GGGTCAAAAGATGTGTTTTCTGG + Intergenic
982720501 4:158854867-158854889 GGGTCTTATGATCTATTTTCAGG + Intronic
983115565 4:163811899-163811921 GTGTCTGCAGAGGGATTTCCAGG + Intronic
984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG + Intronic
984426124 4:179588266-179588288 GGGCCTGAAGATTGCTTTTGAGG + Intergenic
985227499 4:187778415-187778437 GGGCCTGCAGTTTGATTTTCAGG + Intergenic
986216217 5:5721535-5721557 TGCTCTGAAGATGGAGTTACAGG + Intergenic
987443836 5:17991671-17991693 GGGTTTAAAAATGTATTTTCTGG + Intergenic
991561993 5:67963637-67963659 GAGTCTGAAGCTGGAGTTTTAGG + Intergenic
991590307 5:68244472-68244494 GGGTATGAAGATGAGTTTTAGGG + Intronic
992749648 5:79850185-79850207 GGGTCTCAAGCTGTGTTTTCTGG - Intergenic
993322680 5:86493005-86493027 GGGCCTGAAGATTTATTTTTAGG + Intergenic
993756445 5:91735833-91735855 GGGCCTGCAGTTTGATTTTCAGG + Intergenic
993949885 5:94161413-94161435 GGGTCTGAAGAAGGATGAGCAGG - Intronic
996434317 5:123417764-123417786 GGCTCTGAAGCTGGATTGCCTGG + Intronic
1001134437 5:169090660-169090682 GAGACTGAAGCTGGGTTTTCTGG + Intronic
1001161798 5:169324677-169324699 GTGTCTGATGCTGGTTTTTCTGG + Intergenic
1001791848 5:174464478-174464500 GGCTCTGGACCTGGATTTTCAGG - Intergenic
1003592105 6:7445199-7445221 GGATCTGAAGATGATTCTTCAGG + Intergenic
1005270285 6:24156374-24156396 GGGTCTGAAAAGGGAATTTGGGG - Intergenic
1008506897 6:52239429-52239451 GGCTCCGAAGAAGGATTTTGTGG - Intronic
1009516905 6:64631453-64631475 GGGCCTAAAGGAGGATTTTCAGG - Intronic
1010329330 6:74604369-74604391 GGTTCAGAAGATCAATTTTCAGG - Intergenic
1012256841 6:97042867-97042889 GGGTCTGTAGGTGGATGTTGGGG + Intronic
1014600978 6:123411752-123411774 GTTTCTGAAAATGGATTTTATGG + Intronic
1015409459 6:132876746-132876768 GGGCCTGTAGCTTGATTTTCAGG - Intergenic
1015560611 6:134511226-134511248 GTGTCTGGAGATGGAGTCTCTGG - Intergenic
1016426694 6:143942566-143942588 GGGTCTGGAGGTGGTTTTTCAGG + Exonic
1016446045 6:144132853-144132875 AAGTCAGAAGATGGATTTTTAGG - Intergenic
1016559359 6:145377963-145377985 GGGCCTGCAGCTTGATTTTCAGG + Intergenic
1017992223 6:159501038-159501060 GGGTATGCTGATGGAATTTCTGG - Intergenic
1020548418 7:9565693-9565715 GGGCTTGAAGATGGAATATCTGG - Intergenic
1024109382 7:46129944-46129966 AGGCCTGCATATGGATTTTCTGG + Intergenic
1025139689 7:56451748-56451770 GGGTCTTCAGAAGTATTTTCTGG - Intergenic
1026969904 7:74461391-74461413 GGGTCTCAAGGTGCATTTTCTGG + Intronic
1027239636 7:76318560-76318582 GGCTCTGAAGCTGGCTTTCCCGG - Intergenic
1029555247 7:101264418-101264440 GGCCCTGAAGATGGATCTGCTGG + Intergenic
1032511131 7:132473238-132473260 GGCTCTGAAGTTGGTTTTTCTGG + Intronic
1034364685 7:150536192-150536214 GGATCTGAAGATGAACTTTAAGG + Intergenic
1035893424 8:3371082-3371104 GGAGCTGAAGATGTATGTTCTGG - Intronic
1035942407 8:3916797-3916819 GGCTGTGAAGATGGATTATGGGG + Intronic
1037507948 8:19551288-19551310 TGATCTGAAGGTGGAGTTTCCGG - Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041798606 8:61773125-61773147 GGCTCTGAAGTTAGATTTCCTGG + Intergenic
1043194006 8:77267223-77267245 GAGCATGAAGATGGACTTTCAGG + Intergenic
1043933171 8:86113710-86113732 TAGTCTGGAGATGAATTTTCAGG - Exonic
1044667568 8:94646481-94646503 GGATTTGGAGATGGATTTTTTGG + Intronic
1048673637 8:136752077-136752099 TGGTCACAAGATGTATTTTCTGG + Intergenic
1049201032 8:141340771-141340793 GGGTCTTAGGATTGATTTTCTGG + Intergenic
1051095932 9:13465145-13465167 AAGTCTGAAAATGGATCTTCAGG + Intergenic
1051408185 9:16761531-16761553 GAGTCTAACAATGGATTTTCTGG - Intronic
1052335216 9:27312313-27312335 GGCTCTGGAGATGGATTGCCTGG + Intergenic
1055870603 9:80874462-80874484 TGGTGTGAGGATGGTTTTTCTGG - Intergenic
1057896572 9:98913658-98913680 GGGTCTCAAAAAGGGTTTTCAGG + Intergenic
1059031494 9:110702426-110702448 GTGCCTGAAGATGGAATTTCTGG - Intronic
1060161445 9:121369288-121369310 GTTTCTAAAGATGGAATTTCAGG - Intronic
1061395894 9:130343170-130343192 GGGGCTGAGGAGGGATCTTCTGG - Intronic
1061428859 9:130518496-130518518 GGGTAGGAAACTGGATTTTCTGG - Intergenic
1185963317 X:4570551-4570573 GGGCCTGCAGTTTGATTTTCAGG + Intergenic
1188120537 X:26301074-26301096 TGGTCAGAAGATCGATTGTCAGG - Intergenic
1190484363 X:50910219-50910241 GGGTCTGAACCAGGATTCTCTGG - Intergenic
1190718963 X:53131043-53131065 GGCTTTGAAGATGGCTCTTCAGG + Intergenic
1191601490 X:63014090-63014112 GGGTCTGAAGGTGGGCTTTGGGG + Intergenic
1192659422 X:73026727-73026749 GGGTCTGAGGATGGGCTTTGAGG + Intergenic
1193678735 X:84489915-84489937 GGGTCTGAAGATTTCTTTTAAGG + Intronic
1193740954 X:85216361-85216383 GAGTCTGAATATGGCTTATCTGG + Intergenic
1195438977 X:104879911-104879933 TGGACTGAGGATTGATTTTCAGG + Intronic
1196388033 X:115179879-115179901 TGCTCTAAAGATGGATTATCTGG + Intronic
1196507265 X:116462335-116462357 GAGTGTGAATGTGGATTTTCTGG - Intronic
1197605633 X:128582059-128582081 GGGCCTGCAGTTTGATTTTCAGG - Intergenic
1197987574 X:132283275-132283297 TGGGCTCAAGATGGATTATCAGG - Intergenic
1201886224 Y:18885199-18885221 GGGCCTGCAGTTTGATTTTCAGG + Intergenic