ID: 1185058804

View in Genome Browser
Species Human (GRCh38)
Location 22:48594909-48594931
Sequence GGGACATGGGGCAGTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185058804_1185058813 0 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1185058813 22:48594932-48594954 CAGCACACCTTCGGCTGAGCAGG No data
1185058804_1185058817 19 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1185058817 22:48594951-48594973 CAGGGTGCCTGTACCCCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 201
1185058804_1185058809 -9 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1185058809 22:48594923-48594945 CCATGTCCCCAGCACACCTTCGG 0: 1
1: 0
2: 0
3: 32
4: 225
1185058804_1185058814 1 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1185058814 22:48594933-48594955 AGCACACCTTCGGCTGAGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 115
1185058804_1185058816 18 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1185058816 22:48594950-48594972 GCAGGGTGCCTGTACCCCTGAGG 0: 1
1: 0
2: 0
3: 30
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185058804 Original CRISPR GGGACATGGGGCAGTCCCAA GGG (reversed) Intronic
900154332 1:1198033-1198055 GGGGCCTGGGGAAGTCCCAGGGG - Intergenic
900158486 1:1212755-1212777 GGGACATGGGGCAGAGCCTGTGG + Intronic
901082541 1:6591720-6591742 GGGCCAAGGGGTAGCCCCAAGGG + Exonic
901426172 1:9183274-9183296 GGAGCATGGGGCAGCCCCCAAGG + Intergenic
905217316 1:36418064-36418086 GGGCCATGGGGCATTCCCCAGGG + Exonic
905492481 1:38355304-38355326 GGAGCATGGGGAAGTCCCAGTGG + Intergenic
906460457 1:46032194-46032216 GGGACATGGGGCTGGCCAACGGG - Exonic
907387675 1:54136598-54136620 GGGGGAAGGGGCAGTCACAAGGG - Intronic
911893870 1:103404926-103404948 GGGACCTAGGGCAATCCCATGGG - Intergenic
915107968 1:153546105-153546127 GGGACAGGGAGTAGTCCCATGGG + Intronic
920457681 1:206113477-206113499 GGGACAGTGGGTTGTCCCAAAGG - Intronic
921672353 1:217939941-217939963 AGGACATGGGGAAGTCCCTCAGG - Intergenic
923525364 1:234768484-234768506 GGGACATGGGGCAGAACCAGAGG - Intergenic
1063009075 10:2004608-2004630 GGGACATGGGCTAGTCTCATGGG - Intergenic
1064384228 10:14877012-14877034 GGGAATTGGGGCAGTCACATAGG + Intergenic
1069601975 10:69713828-69713850 GTGACATGGGCCAGTCGCAGTGG + Intergenic
1070268447 10:74927588-74927610 GGGAAATGGGGCAGCCTCAAAGG + Intronic
1072245875 10:93543351-93543373 GGATCATGGGACAGTCCCCAGGG - Intergenic
1073061487 10:100736263-100736285 GGGACAGGTGGCAGGCCCCAGGG + Intronic
1073067337 10:100770570-100770592 GGGCCATGGGGCTGGCCCAAGGG - Intronic
1075515000 10:123101503-123101525 GGGGCATGGGGAAGTGGCAAGGG - Intergenic
1076751156 10:132544053-132544075 GTGACATGGGGCAGCCACCATGG - Intronic
1077523937 11:3052990-3053012 GGGACATGGGAATGTCCCAAAGG + Intronic
1081976025 11:47235343-47235365 GGCCCAGGGGGCAGTCCCACTGG - Exonic
1082631695 11:55549754-55549776 GGGCCATGGGGCAGTCTCAGGGG + Intergenic
1083094158 11:60232886-60232908 GGGGCATGGAGCAGTTCCATGGG - Intronic
1083899177 11:65635489-65635511 GGGTCAGGGGGCCGGCCCAAGGG - Intronic
1087196124 11:95305827-95305849 GGGTCACGAGGCAGCCCCAAAGG + Intergenic
1087812377 11:102622455-102622477 TGGAGATGGGGCAGTCCAGACGG - Intronic
1089287500 11:117417139-117417161 GGGTCATGGGTCCATCCCAAAGG - Intergenic
1090011531 11:123049752-123049774 GGGTCATGGGGCAGCACCCACGG + Intergenic
1090134071 11:124177572-124177594 GGAACATGGGGCAATACCAGTGG + Intergenic
1091579931 12:1779091-1779113 GTGAAATGGGGCAGTCCCCATGG + Intronic
1092288038 12:7141162-7141184 AGGAGATGGGGCAGTGCCTAGGG + Intronic
1093364100 12:18271202-18271224 GAGACATGGGGCAGTAGCGAAGG - Intronic
1096578472 12:52569496-52569518 GGGACATGGGGCAGGTTCATTGG + Intronic
1096780964 12:53991878-53991900 GGGCAGTGGGGCAGTCCCACTGG - Intronic
1099635507 12:85206388-85206410 GGGATATGGGGCAGGGCCACTGG + Intronic
1100539636 12:95545959-95545981 GAGACATGAGGAAGGCCCAAGGG - Intronic
1102578309 12:113871264-113871286 GGGCCACGGGGCAGGGCCAAGGG - Intronic
1103851149 12:123934399-123934421 GGGCCATGGGGCAGGGCCACAGG + Exonic
1104015203 12:124957265-124957287 GGGGCCTGGGGCACTCTCAAAGG + Intronic
1117690439 14:58299466-58299488 GGGACCTGGGGAAGCCCGAAGGG + Intronic
1119119488 14:72060997-72061019 GGGGAATGTGGCAGTCCTAAAGG + Intronic
1119195736 14:72715539-72715561 GGGAAATGGGGCAGCCCCTGGGG + Intronic
1119660506 14:76447966-76447988 GAGACGTGGGGCAATCCCAGAGG - Intronic
1119787651 14:77325139-77325161 GGGAGAAGTGTCAGTCCCAAGGG - Intronic
1121628851 14:95408155-95408177 GAGACATGGGGCCCTCCCATGGG + Intronic
1122135774 14:99632017-99632039 TGGACATGGGGCAGGGCCAGTGG + Intergenic
1123468034 15:20530500-20530522 GGGCCATGCGGCAGTCCCCTGGG - Intergenic
1123650079 15:22470542-22470564 GGGCCATGCGGCAGTCCCCTGGG + Intergenic
1123728349 15:23125709-23125731 GGGCCATGCGGCAGTCCCCTGGG - Intergenic
1123740485 15:23279384-23279406 GGGCCATGCGGCAGTCCCCTGGG + Intergenic
1123746513 15:23323174-23323196 GGGCCATGCGGCAGTCCCCTGGG - Intergenic
1124278780 15:28346491-28346513 GGGCCATGCGGCAGTCCCCTGGG - Intergenic
1124303919 15:28565117-28565139 GGGCCATGCGGCAGTCCCCTGGG + Intergenic
1124593903 15:31078123-31078145 GGCACATGGGGCACTCCTCATGG - Intronic
1125768939 15:42152697-42152719 GGGAGATGGGACAGCCCCACGGG - Exonic
1128108790 15:65063292-65063314 AGGACAAGGGGAATTCCCAAGGG - Intronic
1128579194 15:68797007-68797029 GGGACATGGGGCAGTTACCCTGG + Intronic
1130916840 15:88311864-88311886 GAGACCTGGGGCAGTGTCAAAGG - Intergenic
1131112961 15:89776831-89776853 GGCACAGCGGGCAGCCCCAAGGG - Exonic
1131259325 15:90880418-90880440 GCAACATGGGACAGTCCCACAGG - Intronic
1134133167 16:11663439-11663461 AGGACATGGGGCCATCCCACAGG - Intergenic
1135291746 16:21245350-21245372 GGGACATGTGGCTGACACAAAGG + Intronic
1135522437 16:23187733-23187755 GGATGATAGGGCAGTCCCAAGGG - Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138167581 16:54817562-54817584 GGGTCATGGGGCAGACCCAGCGG - Intergenic
1138910435 16:61390796-61390818 GGGACTTGTGGTAGTCCCATTGG + Intergenic
1140073352 16:71672761-71672783 GAAACATGGGGCAGTTCCCAGGG - Intronic
1141172716 16:81701374-81701396 TGGACATGGGGCAGGCCCCCGGG - Intronic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1143548374 17:7614022-7614044 GGGACAGAGGGCCTTCCCAAAGG + Intronic
1144339561 17:14300856-14300878 GGAACAAGGGGCGGGCCCAAAGG - Intergenic
1146291480 17:31610643-31610665 TGGAGATGAGGCAGTCCCAGGGG + Intergenic
1148835368 17:50463156-50463178 GGGACAACAGGCAGCCCCAAGGG + Exonic
1150461400 17:65356682-65356704 AGGACATGAGGCAGTGCCACTGG - Intergenic
1151003658 17:70408071-70408093 GGGACATGCGGCAGGGCTAAGGG - Intergenic
1151530027 17:74698249-74698271 AGGAAATGGCACAGTCCCAAAGG - Intronic
1152313653 17:79566807-79566829 GGGACACGAGGCAGTTACAATGG + Intergenic
1152334521 17:79692921-79692943 GGGACATGAGCCAACCCCAAGGG + Intergenic
1152649619 17:81486320-81486342 GTGACATGAGCCAGTCACAAAGG - Intergenic
1152822612 17:82444981-82445003 GGGTACTGGGGCGGTCCCAATGG + Intronic
1153596002 18:6725792-6725814 GGGTCTTGGGGTAGTCTCAAAGG + Intergenic
1157328479 18:46686130-46686152 GGGCCATGGGGTAGTGGCAAGGG + Intronic
1158393502 18:57062307-57062329 GGGAGATCGGGGAGGCCCAAAGG - Intergenic
1160516043 18:79479826-79479848 GGGAGATGGGGCAGTCGCCTGGG + Intronic
1164886414 19:31782458-31782480 GGGATTTGGGGAAGTCCCACAGG - Intergenic
1165750435 19:38256254-38256276 GGGCCAGGGGGCAGTCCCGGGGG - Exonic
1165912497 19:39237848-39237870 GGGACAGAGGCCAGTCCCACGGG + Intergenic
925019934 2:560433-560455 AGGAAAGGGTGCAGTCCCAAGGG - Intergenic
925378378 2:3405331-3405353 GGGACATGGGGCAGTAGGGATGG - Intronic
927211367 2:20640947-20640969 GGGACATGGGGCAGAGCCTTGGG + Intronic
928340051 2:30435149-30435171 GGGACATTGGTCAGTCACCATGG + Intergenic
929583658 2:43100706-43100728 GGGAGAGGGGGAAGTGCCAAGGG - Intergenic
929673162 2:43895479-43895501 GGGACTTGGCACAGTCCCACAGG + Intronic
934704991 2:96470950-96470972 GGGACCTGGGCCAGGCCCCAGGG + Intergenic
936013911 2:108943573-108943595 GTGACATGGGGCAGTCACCACGG + Intronic
937604655 2:123783966-123783988 GGGACATGGGGAATTCACAAGGG + Intergenic
940876229 2:158900455-158900477 GGGACTGGGGGCAGGCCCATGGG - Intergenic
945256119 2:207804537-207804559 GAGACATGGTGCAGTCACAGAGG - Intergenic
948907471 2:240986684-240986706 GGGACAAGGGGCTGTCCCCCAGG - Intronic
1173435032 20:43024714-43024736 TGGACATTGGGCAGGCCCAATGG - Intronic
1173707716 20:45124596-45124618 GGGACTTGGGGCTTTCCCTAAGG + Intergenic
1175970448 20:62684188-62684210 GGGGCATGTGGCAGCCCCAGGGG + Intronic
1179610285 21:42545781-42545803 GGCATGTTGGGCAGTCCCAATGG - Intronic
1182476136 22:30577376-30577398 GGGAAATGGGGCAGTTGCCAAGG - Intronic
1184209740 22:43028485-43028507 GGAACATGGGCCAGTGCCAAGGG - Intergenic
1184455579 22:44607929-44607951 GGGAAATGGGGCATCACCAAGGG - Intergenic
1184884606 22:47334925-47334947 GGGACAAGGGGCATTCCCATGGG + Intergenic
1184893010 22:47390870-47390892 GGGCCATGGGAGTGTCCCAAGGG - Intergenic
1184900607 22:47444315-47444337 GGGACATGTGGGAGCCCCTATGG + Intergenic
1185058804 22:48594909-48594931 GGGACATGGGGCAGTCCCAAGGG - Intronic
956798976 3:72739783-72739805 GGGGCAGGGGGCAGACCAAAAGG + Intergenic
956885677 3:73556962-73556984 AGGACAGGGGACAGTCCCAGGGG - Intronic
967602771 3:191409357-191409379 GGGCCATGGACCAGTACCAAGGG - Intergenic
968619475 4:1597355-1597377 GGGGCACGGGGCAGTCCTCAGGG - Intergenic
969684508 4:8663325-8663347 GGCACATGGGCTATTCCCAATGG - Intergenic
972802228 4:42488973-42488995 GGGAAATGGAGCATTGCCAACGG - Intronic
975370026 4:73574337-73574359 GGGACTTGGGGCTTTGCCAAAGG - Exonic
975426252 4:74231346-74231368 AGGACATGGAGAAGTTCCAAGGG + Intronic
978239767 4:106501708-106501730 GTGGCATGGGGCAGACCCGAAGG + Intergenic
983319253 4:166174963-166174985 GGGCACTGGGGCAGACCCAAAGG - Intergenic
985664249 5:1173795-1173817 GGGACATGGGGCAGCAACACAGG - Intergenic
989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG + Intergenic
992142835 5:73816737-73816759 TGGACATGGGTCATTTCCAAAGG - Intronic
992377798 5:76206346-76206368 GGGACACTGGGCAATCCCACTGG - Intronic
994005467 5:94832081-94832103 GAAAAATGGGGCAATCCCAAGGG + Intronic
998903293 5:146878169-146878191 GGACCATGGTGCAGTCCCACTGG - Exonic
999397380 5:151238616-151238638 GGGCCAAGGGGGAGTCCCGATGG - Intronic
1000534923 5:162468382-162468404 GGGACGTAGGTCACTCCCAATGG + Intergenic
1001700436 5:173702759-173702781 GGGACTTGGTGCAGTCCCATTGG - Intergenic
1003083108 6:3038064-3038086 GGGACAAGAGGCAGGTCCAATGG + Intergenic
1004378836 6:15114851-15114873 GGGACATGGCGATGGCCCAAGGG + Intergenic
1006428377 6:33980232-33980254 GGGAGATGGTGCAGTGCCCAGGG + Intergenic
1006991491 6:38218507-38218529 GGGACATCTGGCAGGTCCAAGGG - Intronic
1007690028 6:43694964-43694986 GGGAAATGGGGTAGAACCAAGGG - Intergenic
1011484935 6:87831176-87831198 CGGACATGGGGCAGTGCAAAAGG - Intergenic
1011554866 6:88563782-88563804 GGGAAATGGGACAGACCCAGGGG - Intergenic
1017019434 6:150128425-150128447 GGGCCATGGGCCACTCCTAATGG - Intergenic
1019150180 6:170000471-170000493 GGGACATGGGGCATTCGACATGG - Intergenic
1019630269 7:2045312-2045334 GGGACATGGGGGACTCTCATAGG - Intronic
1019888477 7:3925840-3925862 GGGAAAAGGGGGAGTGCCAATGG - Intronic
1020272068 7:6602879-6602901 GGGACATGAGGCAGGTCCCATGG - Intronic
1022332946 7:29397495-29397517 GGGAAATGAGGCAGTCCCAAGGG - Intronic
1022653669 7:32298956-32298978 TGGAGATGGGGCAGTCGCGACGG - Exonic
1027799481 7:82733826-82733848 GGGTCATGGGGCGGGCCCTAAGG - Intergenic
1029794276 7:102876941-102876963 AGTAAATGGGGCAGTCCCAGAGG + Intronic
1033310683 7:140259821-140259843 GGGACAAGGGGCTGTCCCATGGG + Intergenic
1034273101 7:149812654-149812676 GGGTCAGGTGGCAGTGCCAAGGG - Intergenic
1042463642 8:69101094-69101116 GGGACCTGGGGCAGGAACAATGG - Intergenic
1045131208 8:99155437-99155459 GGGACATGGGACAGTCTCATAGG + Intronic
1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG + Intergenic
1048503146 8:134996803-134996825 GGGACAAAGGGCAGGCCCATGGG + Intergenic
1049416519 8:142497959-142497981 GAGACCTTGGGCAGGCCCAAGGG - Intronic
1051156740 9:14156579-14156601 GGGTCATGTGGCATTCCCAGAGG - Intronic
1057028733 9:91757121-91757143 GGCACATGGGGAAGGCCCTAGGG + Intronic
1057268031 9:93631682-93631704 GGGACCTGGGGCTGCCCCATGGG + Intronic
1059411113 9:114132917-114132939 GGGACCTTGGGCAATCCCATTGG + Intergenic
1061520489 9:131114697-131114719 GGGGCATGGGGCAGTCCGGAAGG + Intronic
1061520818 9:131116906-131116928 GGGACTGGGGCCAGGCCCAAAGG - Intronic
1062528827 9:136990753-136990775 GTGACATGAGGCAGCCCTAAGGG - Intergenic
1186725299 X:12351304-12351326 GGGGCAGGGGGCTGTGCCAATGG - Intronic
1188489543 X:30723024-30723046 GGGGCATGGGGCTGTCTCAGAGG + Intronic
1189280934 X:39819955-39819977 GGGATCTGAGACAGTCCCAAAGG - Intergenic
1189563354 X:42213847-42213869 GGGACTTGGGTCACTCTCAAAGG + Intergenic
1190282544 X:48940557-48940579 GGGCCATGGGGGAGTGGCAAGGG - Intronic
1190365238 X:49686983-49687005 GGGGCATTGGGCAGACCCACTGG - Intergenic
1190432949 X:50395058-50395080 GTGACATGGGACAGATCCAATGG + Intronic
1190649855 X:52558114-52558136 GGGACATGGTGCTGACACAATGG + Intergenic
1191836693 X:65470581-65470603 GGGACAAGGGAAAGCCCCAAGGG - Intronic
1197709592 X:129655718-129655740 GGGACATGGGACAGCTCCTATGG + Intergenic
1200087300 X:153613645-153613667 GGGACATGGGGCAATGAGAAGGG - Intergenic