ID: 1185058804

View in Genome Browser
Species Human (GRCh38)
Location 22:48594909-48594931
Sequence GGGACATGGGGCAGTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185058804_1185058813 0 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC No data
Right 1185058813 22:48594932-48594954 CAGCACACCTTCGGCTGAGCAGG No data
1185058804_1185058816 18 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC No data
Right 1185058816 22:48594950-48594972 GCAGGGTGCCTGTACCCCTGAGG No data
1185058804_1185058817 19 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC No data
Right 1185058817 22:48594951-48594973 CAGGGTGCCTGTACCCCTGAGGG No data
1185058804_1185058809 -9 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC No data
Right 1185058809 22:48594923-48594945 CCATGTCCCCAGCACACCTTCGG No data
1185058804_1185058814 1 Left 1185058804 22:48594909-48594931 CCCTTGGGACTGCCCCATGTCCC No data
Right 1185058814 22:48594933-48594955 AGCACACCTTCGGCTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185058804 Original CRISPR GGGACATGGGGCAGTCCCAA GGG (reversed) Intronic