ID: 1185060916

View in Genome Browser
Species Human (GRCh38)
Location 22:48606327-48606349
Sequence TGAGTGGATCTCAGCCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185060914_1185060916 -10 Left 1185060914 22:48606314-48606336 CCAGGTTTCAGACTGAGTGGATC No data
Right 1185060916 22:48606327-48606349 TGAGTGGATCTCAGCCCCCAGGG No data
1185060911_1185060916 11 Left 1185060911 22:48606293-48606315 CCGTCGGAGACAGCGTGCACTCC No data
Right 1185060916 22:48606327-48606349 TGAGTGGATCTCAGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185060916 Original CRISPR TGAGTGGATCTCAGCCCCCA GGG Intronic