ID: 1185060916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:48606327-48606349 |
Sequence | TGAGTGGATCTCAGCCCCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185060914_1185060916 | -10 | Left | 1185060914 | 22:48606314-48606336 | CCAGGTTTCAGACTGAGTGGATC | No data | ||
Right | 1185060916 | 22:48606327-48606349 | TGAGTGGATCTCAGCCCCCAGGG | No data | ||||
1185060911_1185060916 | 11 | Left | 1185060911 | 22:48606293-48606315 | CCGTCGGAGACAGCGTGCACTCC | No data | ||
Right | 1185060916 | 22:48606327-48606349 | TGAGTGGATCTCAGCCCCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185060916 | Original CRISPR | TGAGTGGATCTCAGCCCCCA GGG | Intronic | ||