ID: 1185061531

View in Genome Browser
Species Human (GRCh38)
Location 22:48609591-48609613
Sequence GGTTCTTTTGCAGGAGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185061531_1185061536 7 Left 1185061531 22:48609591-48609613 CCCGTTTCTCCTGCAAAAGAACC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1185061536 22:48609621-48609643 TTCTGAAGCTCACAGACCTGAGG No data
1185061531_1185061537 11 Left 1185061531 22:48609591-48609613 CCCGTTTCTCCTGCAAAAGAACC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1185061537 22:48609625-48609647 GAAGCTCACAGACCTGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 287
1185061531_1185061539 29 Left 1185061531 22:48609591-48609613 CCCGTTTCTCCTGCAAAAGAACC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1185061539 22:48609643-48609665 GATGGTGTATGAGTTCCCCAAGG 0: 1
1: 0
2: 4
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185061531 Original CRISPR GGTTCTTTTGCAGGAGAAAC GGG (reversed) Intronic
903269728 1:22179919-22179941 GGGTCTCTGGAAGGAGAAACAGG - Intergenic
908670071 1:66536284-66536306 AGATCTTTTGCAAGAGAAATTGG + Intronic
908797100 1:67841244-67841266 GTTTGTTTTGCAGAAGAAAGAGG - Intergenic
910291110 1:85601287-85601309 GGGTCTTATGCAGATGAAACAGG - Intergenic
916369564 1:164074962-164074984 GTTTCCTTTTGAGGAGAAACAGG - Intergenic
917249141 1:173038214-173038236 CTTTCTTTTGCAGGAAGAACTGG + Intergenic
921326444 1:213989408-213989430 GGTTCTTGGGCAGCAGAAATGGG + Intronic
922399812 1:225240747-225240769 GTTACTTTTGCAAGAGAATCAGG - Intronic
923412930 1:233727580-233727602 TTTTCTTTTGCAAGAGAAACTGG - Intergenic
923702688 1:236315086-236315108 GGTTTTTTTTCAGTAGAGACAGG - Intergenic
1064265380 10:13821273-13821295 GGTTCTGTGGCAGGGGACACAGG + Intronic
1064877931 10:20016531-20016553 TATTCTTTTGCAGAAGAAAATGG - Intronic
1065608894 10:27450795-27450817 ACTACTTTTTCAGGAGAAACAGG + Intergenic
1068746117 10:60532616-60532638 GGTTCTCATGCAGTAGAGACTGG + Intronic
1068778708 10:60896401-60896423 GATTCTTTTACAGCTGAAACAGG - Intronic
1069556706 10:69402998-69403020 GGCTCTTCTGCAGGGGAACCAGG + Intergenic
1070562817 10:77580650-77580672 GGCTCTTCTGCAGGAGCAAGAGG - Intronic
1071901534 10:90125549-90125571 GGCTCTTTTACAGGAAACACTGG + Intergenic
1075612788 10:123866734-123866756 GATTCTTTTGCAGCAGACATTGG - Intronic
1076639262 10:131902487-131902509 GGTTATTAAGCAGGTGAAACTGG + Intronic
1076828182 10:132980933-132980955 GGCTCTAGAGCAGGAGAAACAGG + Intergenic
1077527380 11:3075339-3075361 GGGACTTTTACAGAAGAAACTGG + Intergenic
1078028683 11:7725713-7725735 GTTTCTTTTGTAGGAGAAGTTGG + Intergenic
1078285624 11:9951779-9951801 GGTTCTTTTACAAGAAAAAATGG + Intronic
1080569585 11:33543655-33543677 AGTTCTCTTTCAGCAGAAACTGG + Exonic
1080632510 11:34091924-34091946 GGTTCATTAACAGGAGGAACTGG - Exonic
1085830162 11:79891719-79891741 AGTATTTTTGCAGTAGAAACTGG - Intergenic
1087500592 11:98948136-98948158 TGTTTTTTTGGAGGAGAAATGGG - Intergenic
1090632976 11:128666630-128666652 GCTTCTATTGCAGGAGACAGAGG - Intergenic
1091110481 11:132961920-132961942 AGTGCTTTTGCAGAGGAAACTGG - Intronic
1092920543 12:13227816-13227838 GGTTCTACTGAAGGAGAAATGGG + Intergenic
1094305807 12:29017733-29017755 GGTTTTGTTGCTGGGGAAACTGG + Intergenic
1095783434 12:46085687-46085709 GTAGCTTTTCCAGGAGAAACAGG + Intergenic
1096023446 12:48341153-48341175 GTGCCTTTTGCAGGAAAAACTGG - Exonic
1096260629 12:50088061-50088083 TGCACTTTTGCAGGAGAACCAGG + Intronic
1096278808 12:50234108-50234130 AGTTCTTTTCAAGGAGGAACAGG + Intronic
1097662176 12:62442720-62442742 GGTTCTTTGAAAGGATAAACAGG - Intergenic
1100168522 12:91945938-91945960 GGTTTTTTTGGAGGAGGAAAAGG + Intergenic
1100603175 12:96129825-96129847 GGCTCTCTTGCAGGTGTAACAGG - Intergenic
1101189818 12:102321000-102321022 GCTTCTTTTGTAGGAGATACTGG + Intergenic
1101811877 12:108114474-108114496 GGTTTTTTTCCAGAAGAAAGTGG + Intergenic
1101823191 12:108199964-108199986 TGTAATTTTGCAGGAGAAAATGG + Intronic
1102352277 12:112202665-112202687 GCTTCCTATGCAGGAAAAACTGG - Intronic
1102994053 12:117334740-117334762 GGATGTTTTGCAGGAGGAAAAGG - Intronic
1103394934 12:120600209-120600231 CCTGCTTCTGCAGGAGAAACTGG - Intergenic
1104872554 12:132010474-132010496 GGTTCTTTTCCAGGATCAGCAGG + Intronic
1105869555 13:24492124-24492146 GGATCCTCTGCAGGAGAAAGGGG - Intronic
1106306478 13:28515556-28515578 GGTTTGCTTTCAGGAGAAACTGG - Intergenic
1106918075 13:34536798-34536820 GATACTTTTGAATGAGAAACAGG + Intergenic
1108555616 13:51588863-51588885 GGTTCTTTTTCTGGATAAAAAGG + Intronic
1108645734 13:52425447-52425469 GGTTGGTTTACAGGAGAAGCTGG + Intronic
1111337560 13:86841819-86841841 GGCTATTTTGCAGGAGATATAGG + Intergenic
1111351260 13:87034570-87034592 GGTTCTTTTGGAGAAGAACTGGG + Intergenic
1116586017 14:46705556-46705578 ATTTCTCTGGCAGGAGAAACTGG - Intergenic
1117002185 14:51382114-51382136 GGGTGTGTTGCAGGAGCAACAGG + Intergenic
1118731392 14:68669458-68669480 GGGACTTTTGGATGAGAAACAGG + Intronic
1126272096 15:46831872-46831894 GTATATTTTGCAGGAGAGACTGG - Intergenic
1128134184 15:65250501-65250523 GTTTATTTTACAGAAGAAACAGG - Intronic
1130201421 15:81831310-81831332 GGTTATTTTGAAGGATAAAAAGG - Intergenic
1131257774 15:90872943-90872965 GGTTCTGGTGCTGGAGAAAAGGG + Exonic
1131861739 15:96661043-96661065 GGCTCTTTTGCAGGTGAGAGAGG + Intergenic
1134839340 16:17389128-17389150 TGTTCTTTTGCAGGAGCACAGGG + Intronic
1137311077 16:47259513-47259535 GATTTGATTGCAGGAGAAACGGG + Intronic
1137694480 16:50452242-50452264 GGTTCTTTGGCAGGAGTACTAGG + Intergenic
1138419996 16:56892831-56892853 GGTTCTCTGGCAGGTGGAACAGG - Intronic
1139783760 16:69373658-69373680 GGTTTTTTTGGGGGAGAGACAGG - Intronic
1140608355 16:76567951-76567973 GGTCCTTTTTTAGGAGAAAGAGG - Intronic
1142974321 17:3634598-3634620 TGCTCTATTTCAGGAGAAACTGG + Intronic
1144410434 17:14995266-14995288 TGTTCTTATGCAAGAGAACCAGG - Intergenic
1146568322 17:33932153-33932175 GGTTCCTCTGCAGGAGCACCTGG - Intronic
1146749688 17:35367343-35367365 GATTCTTTTGCAGGCAAAAAAGG + Intronic
1147183473 17:38701578-38701600 GGCTCTGTTTCAGGAGGAACTGG - Intergenic
1148777298 17:50102768-50102790 GGTTCTTGTGGAGGTGAAAGTGG + Intronic
1151241967 17:72765173-72765195 AGTTTATTTGCAGGAGAAACTGG - Intronic
1152023422 17:77793763-77793785 GGCTCTTTTGCAGGAGCCCCCGG - Intergenic
1152251496 17:79214996-79215018 GGGTCTTGTGCAGGAGTGACGGG - Intronic
1153350329 18:4073284-4073306 GTCTATTTTGCATGAGAAACTGG - Intronic
1155862304 18:30918589-30918611 GCTTCCTTTGCAGAAGATACAGG - Intergenic
1157277135 18:46319070-46319092 GGAGCTCTAGCAGGAGAAACAGG - Intergenic
1157780020 18:50430194-50430216 GGTTGTTTTGCAGGCTAAAGGGG - Intergenic
1158345873 18:56516806-56516828 GGTCAGTTTGCAGGAGAAAAAGG + Intergenic
1158872945 18:61706587-61706609 GGTTTATTGCCAGGAGAAACTGG - Intergenic
1160357976 18:78244750-78244772 GCTTTTTTTGCAGGGAAAACGGG + Intergenic
1166206315 19:41271837-41271859 GGTTCTTTGGGAAGAGAAATTGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1168219071 19:54947496-54947518 GTTTCCTTTGCAGGAAACACAGG - Exonic
925960435 2:9009466-9009488 AGTTCTTTGGCAAGAGAACCAGG - Intergenic
926532443 2:14066612-14066634 GATTGTTTTCCAGGAGACACAGG - Intergenic
927148275 2:20180839-20180861 GGTTCTTTTGGAGGGGCACCCGG - Intergenic
929050121 2:37829399-37829421 GGTTGTTTTCCAGGGGAAGCTGG + Intergenic
930228922 2:48823983-48824005 GGTTATTCTCCTGGAGAAACAGG + Intergenic
930339576 2:50095419-50095441 GGTTCTTATCCAGGATACACTGG + Intronic
930735525 2:54774608-54774630 GGTCCTTTTGCAAGAGGACCTGG + Intronic
931263847 2:60643124-60643146 GGCCATTTTGCAGGATAAACTGG + Intergenic
933662952 2:84942611-84942633 GGGTCTTGTGCTGGAGAAAGAGG - Intergenic
937001706 2:118473712-118473734 GCTTCTTTTCCTGGAGAAACTGG + Intergenic
939376864 2:141380013-141380035 AATTCTTTTCAAGGAGAAACTGG - Intronic
939508037 2:143073244-143073266 GAATCTTTTGCAGGATAAAGAGG - Intergenic
942385691 2:175440282-175440304 TATTCTTGTGCAGGAGAAAGGGG + Intergenic
943480840 2:188415178-188415200 GGATCTTTTGCTAGAGAAAGGGG + Intronic
944397280 2:199282460-199282482 TGTGGTTTTGCAGTAGAAACTGG - Intronic
944561271 2:200940903-200940925 GTTTCTTTTGCAGGGGGAAGAGG - Intronic
947103432 2:226645754-226645776 CGTCCTTTGGCAGGACAAACTGG - Intergenic
947167860 2:227280880-227280902 CTTTCTTTTGCAGGAGATCCAGG + Exonic
1169207155 20:3747015-3747037 GGTTCTTGAGCAGGGGAAATAGG + Intronic
1173469848 20:43314613-43314635 AATTCCATTGCAGGAGAAACAGG + Intergenic
1177698309 21:24602882-24602904 GGTTTTTTTTTAGTAGAAACTGG + Intergenic
1180652565 22:17390491-17390513 GGTTAATTTGGAGAAGAAACAGG - Intronic
1182421001 22:30248536-30248558 GGTCCTTGTGCAGGAGATGCTGG - Intergenic
1183987724 22:41578563-41578585 GGTTTTTTGGCCTGAGAAACTGG + Intronic
1185061531 22:48609591-48609613 GGTTCTTTTGCAGGAGAAACGGG - Intronic
1185196769 22:49476500-49476522 GGTTCATTTATTGGAGAAACTGG - Intronic
949207945 3:1462856-1462878 TCTTCCTTTCCAGGAGAAACTGG + Intergenic
949473445 3:4419989-4420011 AGTTCTTTTGCAAGAGCAAAGGG + Intronic
949935925 3:9115685-9115707 GCTCACTTTGCAGGAGAAACTGG + Intronic
950288611 3:11765131-11765153 AGTTCTTTTGGAGGAAAAACAGG - Intergenic
951306779 3:21073618-21073640 GATTCTTTTGGAAGACAAACAGG + Intergenic
953293423 3:41689091-41689113 GGCTATTTGGCAGGGGAAACTGG - Intronic
956861346 3:73327018-73327040 GCTCCTGTTGCAGGAGAAATGGG + Intergenic
957512448 3:81206904-81206926 GCTTCTTTTGGGGGTGAAACTGG - Intergenic
957986701 3:87581121-87581143 GTTTCTTAGGCAGTAGAAACTGG - Intergenic
958989682 3:100828410-100828432 GCCTCTTTTATAGGAGAAACTGG + Intronic
959366224 3:105461247-105461269 GGTGTTTTTCCAAGAGAAACTGG + Intronic
959384878 3:105691446-105691468 GCTTCATTTACAGGAGAAGCAGG + Intronic
959601953 3:108197129-108197151 GTTTCTTCTGCAGCAGTAACTGG - Intronic
961122735 3:124386546-124386568 GGTTCTTTAGCAGCAGAATCTGG - Intronic
961651022 3:128416666-128416688 GGTTCTTTTGCTGGAGACATTGG + Intergenic
966523466 3:180897512-180897534 GGTTCTTTTGCAAAAGAAAATGG - Intronic
967102856 3:186230588-186230610 GGTGCTTGTGCAGCAGCAACAGG + Intronic
967973749 3:195018845-195018867 GATGCATTTTCAGGAGAAACGGG - Intergenic
969933794 4:10660797-10660819 GATACTTTTGCAGGAGCAGCAGG - Intronic
971251189 4:24974802-24974824 GGTGCTTTTTCTGGAGAGACTGG + Intronic
973268257 4:48232839-48232861 GGATGTTTTGCAGAAGAAATTGG - Intronic
975555099 4:75655073-75655095 GGTTCTTGTGGCAGAGAAACAGG + Exonic
977967210 4:103167371-103167393 GGTGCTTATGCAAGAGAAAAAGG - Intronic
983338263 4:166423346-166423368 GATTCCTTTTCTGGAGAAACAGG + Intergenic
985212187 4:187607086-187607108 GGTTCTTATGGAGGAGAGGCTGG + Intergenic
988462577 5:31453721-31453743 GGTTATTTGGAAGGAGAAACAGG - Intronic
991506921 5:67334921-67334943 ACTTCTTTTGGAGGAGAAACTGG + Intergenic
992045304 5:72882088-72882110 AGGTATTTTGCAGGAGAACCAGG - Intronic
992742924 5:79791894-79791916 GGTTATTTTGCAGAACAAAATGG + Intronic
994711068 5:103264743-103264765 GCTTCTTTAGCTTGAGAAACTGG - Intronic
994941057 5:106324751-106324773 TATTCTTTACCAGGAGAAACCGG + Intergenic
996620270 5:125493081-125493103 AGTTCTTTTGAAGGAAAATCTGG - Intergenic
1000291503 5:159875577-159875599 TTTTATTTTTCAGGAGAAACTGG - Intergenic
1000805842 5:165790771-165790793 GGTTCTTTTGGAGGAGATTTTGG + Intergenic
1001290809 5:170457849-170457871 AATTCTTTTTCAGGTGAAACAGG - Intronic
1001462871 5:171933702-171933724 GCTTCCTTTGCAGGATAAGCAGG - Intronic
1001497590 5:172200547-172200569 GGTTCTATTGCGAGAGAAATAGG - Exonic
1002962695 6:1931224-1931246 TGTTCTTTTGCAGATGAAGCAGG + Intronic
1003164504 6:3664373-3664395 GGACCTTCTGCAGGTGAAACTGG - Intergenic
1003762822 6:9199694-9199716 GGTTCCTTTGAAGCAGAAAAAGG - Intergenic
1004552231 6:16659550-16659572 GGTTCCTTTGCAGAAGACATTGG - Intronic
1005094272 6:22095998-22096020 GTTTCTTTTGCCAGAGAAACAGG + Intergenic
1006937926 6:37731389-37731411 GGTTCACTTGCAAGAGCAACAGG + Intergenic
1008142782 6:47851323-47851345 GTTTCTTTTGCAGGTGAATTTGG + Intergenic
1010883776 6:81212420-81212442 GGTATTTTTGTAGTAGAAACTGG - Intergenic
1014032346 6:116720031-116720053 AGTTTATTTGAAGGAGAAACTGG - Intronic
1014553254 6:122813673-122813695 GGATTTTTTGCTGGAGCAACTGG + Intergenic
1015487396 6:133788435-133788457 TGTTCCTTTGCTGGATAAACAGG - Intergenic
1015877860 6:137842359-137842381 GGTTCTTTTTCAGGTAAATCAGG + Intergenic
1016356914 6:143228128-143228150 GGTTCTTTTGGAGGTAACACAGG - Intronic
1017934381 6:158991753-158991775 GGTTCTAATGCAGGAGATCCAGG + Intronic
1018650275 6:165986948-165986970 GGATCTTTTGCAGAAGAGACTGG + Intergenic
1019041228 6:169107937-169107959 GGCTCTTTAGGAGGAGACACTGG - Intergenic
1020701088 7:11484309-11484331 GCTTCGTTTGCAGGAGGAAAGGG - Intronic
1021869390 7:24988872-24988894 GTTTCTTTTGCAAGAAATACTGG - Intergenic
1023985589 7:45092770-45092792 GGCTAGTTTGCAGGAGAAAATGG + Intergenic
1024483927 7:49894719-49894741 GGCTGTTTTGCTGGAGACACAGG + Intronic
1026503575 7:70963397-70963419 GGCTCTTTCCCAGGAGACACAGG - Intergenic
1030582690 7:111378911-111378933 AGTTATTCTGCATGAGAAACAGG + Intronic
1035467322 7:159088079-159088101 GGGTCTTTTACAGGGGAAGCCGG + Intronic
1035685797 8:1522673-1522695 GCTTCTTTTTCAGCAGAAAGAGG + Intronic
1036022466 8:4860866-4860888 GTTTCTCTAGCAGGAGAAGCAGG - Intronic
1037854004 8:22356667-22356689 GGTTATTTTGCAAGAGAAAGGGG - Exonic
1038098925 8:24350101-24350123 GGTCTTTTTGGACGAGAAACTGG + Intronic
1039433158 8:37541518-37541540 GGCACTTTTGCAGTAGACACTGG - Intergenic
1039759694 8:40561455-40561477 GGTAGTTCTGCAGGAGAACCTGG - Intronic
1040287193 8:46106449-46106471 GGTCCTTTTGCGAGAGACACAGG + Intergenic
1040293496 8:46137381-46137403 GGGTCTTCTGCAAGAGACACAGG + Intergenic
1040294931 8:46144241-46144263 GGGTCTTTTGCAACAGAGACAGG + Intergenic
1040306375 8:46214035-46214057 GGGTCTTCTGCAAGAGAAACAGG - Intergenic
1040309908 8:46231545-46231567 GGGTCTTCTGCGAGAGAAACAGG - Intergenic
1040340298 8:46437140-46437162 CAGCCTTTTGCAGGAGAAACAGG + Intergenic
1040755295 8:50766062-50766084 GATTCTATTGAAGGAGAGACTGG + Intronic
1041477458 8:58282171-58282193 GTTTCATGTGCAGGAGCAACTGG + Intergenic
1043004994 8:74808215-74808237 GTGTTTTTTGCAGGAGTAACTGG - Intronic
1043694407 8:83201814-83201836 GTTCCTGTTCCAGGAGAAACAGG - Intergenic
1044221941 8:89679170-89679192 TGTTCTTTTGCAGGATTCACTGG + Intergenic
1044737219 8:95291168-95291190 GGTTCTTTTGAAAAAAAAACTGG - Intergenic
1047467052 8:125126953-125126975 GGTTCTTTCGCAGGTGAGAGAGG + Intronic
1049974857 9:851683-851705 GTTTCATTTGTTGGAGAAACTGG + Intronic
1050753101 9:8964482-8964504 GGTTCTTTAAAAGGATAAACAGG - Intronic
1050950097 9:11579383-11579405 GGTTTCTTTTCAGAAGAAACAGG + Intergenic
1052118903 9:24684210-24684232 GGTTCTTTTGGAAAAGAAATGGG + Intergenic
1052819332 9:33126449-33126471 TGTTTTTTTGCAGGGGAGACAGG + Intronic
1058250152 9:102684002-102684024 TTTTATTTTTCAGGAGAAACAGG + Intergenic
1059342123 9:113603187-113603209 GGTGCTATTGCAGCAGGAACTGG + Intergenic
1059871462 9:118582703-118582725 TGTTCCTTTGCAGAAGAAATGGG + Intergenic
1062221304 9:135417376-135417398 GGTGCTTTTGGAGTAGAAAGGGG - Intergenic
1062311154 9:135938152-135938174 GGTTCCCTTGCAGGACAAATAGG - Intronic
1185703827 X:2251757-2251779 GTTTCTTTTCCAGCAGAAATCGG - Intronic
1186393495 X:9184331-9184353 AGTTCTTTTGCAGAAAAAAAAGG - Intergenic
1187285895 X:17903275-17903297 GCTTCACTTGCAGGAGAAAGGGG + Intergenic
1187684486 X:21802916-21802938 GGTTTGTTTGTAGGAGAGACAGG + Intergenic
1188120605 X:26302220-26302242 TGTTTTTATGCAGGAGAAAATGG - Intergenic
1188898510 X:35698973-35698995 GTGTCATTTGCAGGAGTAACTGG + Intergenic
1189158606 X:38786581-38786603 GGTTGTTTTTAAGGAGGAACAGG + Intergenic
1193485618 X:82082257-82082279 GTGTCTTTTGCAGAAGAAAATGG + Intergenic
1194124917 X:90004771-90004793 GGTTCTTTGAAAGGATAAACAGG - Intergenic
1194645081 X:96449681-96449703 GGTTGTTATGATGGAGAAACAGG - Intergenic
1194817143 X:98456759-98456781 GATTCTTTAACAGGAAAAACAGG - Intergenic
1196532844 X:116809312-116809334 GTTTCTTTTGTAGGAGAAACAGG + Intergenic
1198389943 X:136163582-136163604 AGCTCTTTTGCAGGAAAAATGGG + Intronic
1198486930 X:137096628-137096650 GCTCCTTTAGCAGGAGAGACAGG + Intergenic
1200395156 X:155981684-155981706 GGTTTTTTTGCAGCAAAAATGGG + Intergenic
1201355522 Y:13093208-13093230 GGTTTTTTTGCAGGGGAAATGGG + Intergenic
1201765681 Y:17571656-17571678 GCTTCTTTTGCACTAGAAATGGG - Intergenic
1201835871 Y:18334333-18334355 GCTTCTTTTGCACTAGAAATGGG + Intergenic