ID: 1185061736

View in Genome Browser
Species Human (GRCh38)
Location 22:48610554-48610576
Sequence GGCAGCTCGGGACCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 293}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185061726_1185061736 11 Left 1185061726 22:48610520-48610542 CCCCAGCACGGAGGAGCAGAGGG 0: 1
1: 1
2: 5
3: 31
4: 285
Right 1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG 0: 1
1: 1
2: 1
3: 18
4: 293
1185061728_1185061736 10 Left 1185061728 22:48610521-48610543 CCCAGCACGGAGGAGCAGAGGGG 0: 1
1: 1
2: 5
3: 23
4: 267
Right 1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG 0: 1
1: 1
2: 1
3: 18
4: 293
1185061730_1185061736 9 Left 1185061730 22:48610522-48610544 CCAGCACGGAGGAGCAGAGGGGC 0: 1
1: 1
2: 3
3: 22
4: 244
Right 1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG 0: 1
1: 1
2: 1
3: 18
4: 293
1185061723_1185061736 16 Left 1185061723 22:48610515-48610537 CCCATCCCCAGCACGGAGGAGCA 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG 0: 1
1: 1
2: 1
3: 18
4: 293
1185061720_1185061736 26 Left 1185061720 22:48610505-48610527 CCACAGAAGGCCCATCCCCAGCA 0: 1
1: 1
2: 4
3: 37
4: 345
Right 1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG 0: 1
1: 1
2: 1
3: 18
4: 293
1185061724_1185061736 15 Left 1185061724 22:48610516-48610538 CCATCCCCAGCACGGAGGAGCAG 0: 1
1: 0
2: 1
3: 33
4: 283
Right 1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG 0: 1
1: 1
2: 1
3: 18
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185061736 Original CRISPR GGCAGCTCGGGACCACCAGG AGG Intronic
901017210 1:6238802-6238824 GACACCTCAGGACCACCAGAGGG + Intergenic
902644896 1:17791216-17791238 GGGAGCTGGGGACAAGCAGGAGG - Intronic
903264994 1:22152834-22152856 CGCAGCTTGGGGCCTCCAGGAGG + Intergenic
903545826 1:24122925-24122947 GGCAGCCGGGCACCACCATGTGG - Intronic
903662325 1:24985678-24985700 GGCAGCTGGGGACTTCCTGGAGG - Intergenic
904761118 1:32804981-32805003 GGCACCTCGGGACGCCGAGGCGG + Intronic
906898200 1:49802711-49802733 GGCACCACGGGACCAGAAGGCGG + Intronic
907220581 1:52904616-52904638 GACAGCTCGGCACCAGAAGGAGG - Intronic
907223085 1:52921479-52921501 GGCAGCGGGGGACCGGCAGGTGG - Intronic
913972031 1:143423204-143423226 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
914066412 1:144248817-144248839 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
914112741 1:144717537-144717559 GACAGCCCGGGGCCAGCAGGTGG - Intergenic
915111300 1:153566031-153566053 GGCAGCTGGGGGACATCAGGAGG + Intronic
918172364 1:182010473-182010495 GGCACCTCGGGAGGCCCAGGTGG - Intergenic
918434571 1:184498174-184498196 GGCAGCTCTCCTCCACCAGGTGG + Intronic
920519812 1:206614835-206614857 GGCAGCTCAGACCCACCAGTGGG - Intergenic
921045045 1:211470230-211470252 AGCCGCCCGTGACCACCAGGGGG + Intergenic
921109038 1:212014790-212014812 GGCACCTCGGGAGGCCCAGGCGG - Intronic
922644771 1:227275849-227275871 GGCACCTCGGGAGGCCCAGGCGG - Intronic
1062983566 10:1745788-1745810 GGCAGCTGTGGAGGACCAGGAGG - Intergenic
1063195286 10:3735734-3735756 GGCAGCTGGGGAGCACCTGTAGG + Intergenic
1066325251 10:34352592-34352614 GGCACCTCGGGAGGCCCAGGTGG - Intronic
1066495689 10:35939551-35939573 GGCAGCTCAGAGACACCAGGGGG + Intergenic
1066563152 10:36691990-36692012 TGCGACTGGGGACCACCAGGAGG - Intergenic
1067088692 10:43255776-43255798 GTTGGCTCAGGACCACCAGGTGG + Intronic
1069486495 10:68827312-68827334 GGGAGCTCGGGACCTCGAGGCGG + Intergenic
1070625662 10:78049352-78049374 GCCAGCTCAGGAGCACCAGTGGG - Intronic
1075078084 10:119364572-119364594 GGCAGCTGGGGTACAGCAGGAGG - Intronic
1076526646 10:131116419-131116441 GGCAGGTGGGGTCCACCGGGAGG - Intronic
1077012670 11:385819-385841 GGCAGGGCGGGAGCACCACGGGG + Intergenic
1077036087 11:495156-495178 GGCAACTCAGGACCCTCAGGTGG + Intronic
1077307825 11:1875830-1875852 GACAGCCCGGGGCCAGCAGGTGG - Intronic
1077435135 11:2535294-2535316 GGCAGCTGGGGACACCCAGGTGG + Intronic
1079640178 11:22795399-22795421 GGCAGATTGGGAGTACCAGGAGG + Intronic
1081463109 11:43289659-43289681 GCCAGCTGGGGACCTCCAGCTGG - Intergenic
1083640653 11:64143522-64143544 GGGAGCTGGAGCCCACCAGGAGG + Intronic
1083949740 11:65947405-65947427 GGCAGCTGGAGACCACTGGGGGG - Exonic
1084234075 11:67775067-67775089 GGCATCTCTGGATCACCAGCTGG - Intergenic
1084267018 11:68010346-68010368 GGCAGAGCGGGACAGCCAGGAGG + Exonic
1084649279 11:70479209-70479231 AGCATCTCAGGACCACTAGGTGG - Intronic
1084933244 11:72573531-72573553 TGCAGCTCAGGGCCACCAGGTGG - Intergenic
1085159558 11:74328052-74328074 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
1085280393 11:75326132-75326154 GGCAGCTCTGGAGAAGCAGGAGG + Intronic
1087579352 11:100031918-100031940 GGCACCACGGGACCAGAAGGTGG + Intronic
1091981182 12:4865451-4865473 AGAAGCTCAGGACCAGCAGGTGG + Intergenic
1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG + Intergenic
1092140866 12:6182548-6182570 GGCAGCCCGTGACCGCCTGGAGG - Intergenic
1092259733 12:6946431-6946453 GGCGGCCCTGGACCAGCAGGCGG + Intergenic
1092850120 12:12618779-12618801 GGCACCTCGGGAGGCCCAGGCGG + Intronic
1094480045 12:30874473-30874495 GGCTGCTCCGTACCTCCAGGTGG + Intergenic
1095701672 12:45196874-45196896 GGGAGCTCGTGAAGACCAGGAGG + Intergenic
1104037487 12:125107574-125107596 TGCAGGTCTGGACCACCTGGGGG + Intronic
1104139626 12:125974884-125974906 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1106677999 13:31982061-31982083 AGCAGCTCTGGACCAGCAGTGGG - Intergenic
1106833515 13:33610629-33610651 GTCAGCCTGGGGCCACCAGGAGG + Intergenic
1107512055 13:41094844-41094866 GGCAGCTGTGGAACATCAGGAGG - Intergenic
1107666225 13:42693763-42693785 GGCAGGGAAGGACCACCAGGTGG + Intergenic
1113329008 13:109311145-109311167 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
1113962242 13:114132540-114132562 GGCAGCTCAGGCCGAGCAGGAGG + Exonic
1114599669 14:23944195-23944217 GGCACCACGGGACCAAAAGGCGG - Intergenic
1114992279 14:28301305-28301327 GGCTGCCCGGCACCAGCAGGAGG - Intergenic
1118383842 14:65239145-65239167 GGCCGCTCAGGACCACTGGGTGG + Intergenic
1121758359 14:96422042-96422064 GGCACCACGGGACCAGAAGGCGG - Intronic
1123012576 14:105356474-105356496 GGCAGCTCCAGGCCACCAGAGGG - Intronic
1123125784 14:105945139-105945161 GGAAGCACAAGACCACCAGGCGG - Intergenic
1123132394 14:105999430-105999452 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123132419 14:105999528-105999550 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123132483 14:105999744-105999766 GCATGCTCAGGACCACCAGGGGG - Intergenic
1123132608 14:106000277-106000299 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132651 14:106000452-106000474 GGGTGCTCAGAACCACCAGGAGG - Intergenic
1123132671 14:106000533-106000555 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132732 14:106000772-106000794 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132799 14:106001031-106001053 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132823 14:106001112-106001134 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132847 14:106001193-106001215 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132871 14:106001274-106001296 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132895 14:106001355-106001377 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123132918 14:106001436-106001458 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123139571 14:106062077-106062099 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1123142462 14:106094696-106094718 GGGAGCTCAGAACCACCAGGGGG - Intergenic
1123142542 14:106095016-106095038 AGATGCTCGGAACCACCAGGGGG - Intergenic
1123146940 14:106141785-106141807 GGGATCTCAGAACCACCAGGAGG - Intergenic
1123146974 14:106141925-106141947 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123148056 14:106153551-106153573 GGGCGCGCGGGGCCACCAGGGGG - Intergenic
1123149830 14:106170395-106170417 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123149842 14:106170434-106170456 GGGTGCTCAGGACCACCAGGGGG - Intergenic
1123158817 14:106257691-106257713 GGCCGCGCGGGGCCACCAGGGGG - Intergenic
1123164085 14:106309111-106309133 GGGCGCTCAGAACCACCAGGTGG - Intergenic
1123164089 14:106309131-106309153 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123168512 14:106349188-106349210 TGCTGCTCAGGACCAGCAGGGGG - Intergenic
1123175819 14:106417783-106417805 GGGAGCTCATAACCACCAGGGGG - Intergenic
1123175848 14:106417920-106417942 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123176198 14:106421614-106421636 TGCAGCTCAGGGCCAGCAGGGGG - Intergenic
1123187895 14:106537738-106537760 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1123194769 14:106606021-106606043 TGCTGCTCAGGACCAACAGGGGG - Intergenic
1123198397 14:106639024-106639046 TGCTGCTCAGGACCAGCAGGTGG - Intergenic
1123200989 14:106663922-106663944 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123203659 14:106691938-106691960 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123203682 14:106692036-106692058 GGGCGCTCAGGACCAGCAGGGGG - Intergenic
1123203688 14:106692056-106692078 GGGCGCTCAGGACCACTAGGGGG - Intergenic
1123203764 14:106692349-106692371 GGGAGCTCAGAACCACCAGGTGG - Intergenic
1123204071 14:106694877-106694899 GGGTGCTCGGATCCACCAGGGGG - Intergenic
1123208793 14:106738856-106738878 GGGAGCTCAGAACCACCAGGTGG - Intergenic
1123209087 14:106741366-106741388 GGACGCTCAGAACCACCAGGGGG - Intergenic
1123218012 14:106830727-106830749 GGGAGCTCAGAACCAACAGGGGG - Intergenic
1123218026 14:106830785-106830807 GGGAGCTCAGAACCACCAGGGGG - Intergenic
1123218064 14:106830960-106830982 GGGAGCTCAGAACCACCTGGGGG - Intergenic
1123218154 14:106831438-106831460 GTCTGCTCAGAACCACCAGGGGG - Intergenic
1123218200 14:106831613-106831635 GGGAGCTCAGAACCAGCAGGAGG - Intergenic
1123222830 14:106872735-106872757 TGCCGCTCAGGACCAGCAGGGGG - Intergenic
1123223610 14:106879375-106879397 GGACGCTCAGGACAACCAGGGGG - Intergenic
1123406369 15:20021558-20021580 GGAAGCACAAGACCACCAGGCGG - Intergenic
1123515699 15:21028206-21028228 GGAAGCACAAGACCACCAGGCGG - Intergenic
1123582640 15:21730662-21730684 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123582815 15:21731369-21731391 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123582869 15:21731583-21731605 GGGTGCTCAGAACCACCAGGAGG - Intergenic
1123582902 15:21731720-21731742 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123582922 15:21731801-21731823 GGGTGCTCAGCACCACCAGGGGG - Intergenic
1123582945 15:21731882-21731904 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123584156 15:21742269-21742291 TGCTGCTCAGGACCAGCAGGGGG - Intergenic
1123619290 15:22173258-22173280 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123619465 15:22173965-22173987 GGGCGCTCAGAACCACCAGGGGG - Intergenic
1123619519 15:22174179-22174201 GGGTGCTCAGAACCACCAGGAGG - Intergenic
1123619552 15:22174316-22174338 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1123619572 15:22174397-22174419 GGGTGCTCAGCACCACCAGGGGG - Intergenic
1123619595 15:22174478-22174500 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123620806 15:22184872-22184894 TGCTGCTCAGGACCAGCAGGGGG - Intergenic
1125766947 15:42142405-42142427 GCCAGCTCAGGCCCACCAGGAGG + Intronic
1129229117 15:74186943-74186965 GGGAGCTAGGGACCAGCAGAAGG - Intronic
1129232832 15:74206212-74206234 GGCAGCTGGGGGCCAGGAGGGGG - Intronic
1130531236 15:84748835-84748857 GGCGGCCCGGGCCCGCCAGGCGG - Intronic
1131577253 15:93604393-93604415 GGCAGATGGGGACCACCAGGAGG - Intergenic
1132212616 15:100035641-100035663 GCTAGCTTGGGGCCACCAGGAGG + Intronic
1133320549 16:4910805-4910827 GGCAGCACGGGGCACCCAGGTGG + Intronic
1134995197 16:18734008-18734030 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
1136114586 16:28086756-28086778 GGCAGCTGGGCCGCACCAGGGGG + Intergenic
1136680210 16:31956358-31956380 GGGTGTTCAGGACCACCAGGGGG + Intergenic
1136680222 16:31956397-31956419 GGGCGCTCAGAACCACCAGGGGG + Intergenic
1136691951 16:32039151-32039173 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136691981 16:32039258-32039280 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136692054 16:32039492-32039514 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136692088 16:32039632-32039654 GGGATCTCAGAACCACCAGGAGG + Intergenic
1136692146 16:32039823-32039845 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136780551 16:32897902-32897924 GGGTGTTCAGGACCACCAGGGGG + Intergenic
1136780563 16:32897941-32897963 GGGCGCTCAGAACCACCAGGGGG + Intergenic
1136792535 16:32982713-32982735 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136792597 16:32982930-32982952 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136792631 16:32983070-32983092 GGGATCTCAGAACCACCAGGAGG + Intergenic
1136792689 16:32983261-32983283 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1136877167 16:33870793-33870815 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1136877225 16:33870984-33871006 GGGATCTCAGAACCACCAGGAGG - Intergenic
1136877259 16:33871124-33871146 GGGTGCTCAGAACCACCAGGGGG - Intergenic
1136889841 16:33961707-33961729 GGGAGCTCAGAACCACCAGGGGG - Intergenic
1136889853 16:33961746-33961768 GGGTGTTCAGGACCACCAGGGGG - Intergenic
1137484734 16:48881776-48881798 GCCAGCTCTGGAGCACCATGTGG + Intergenic
1138405500 16:56789521-56789543 GGCAGCTCTGGAGCCACAGGTGG - Intronic
1138595240 16:58026138-58026160 GGGAGCTCGGAACCAGCCGGCGG - Exonic
1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG + Intronic
1141964409 16:87432265-87432287 GGGAGCTCGGCACCATCAGCCGG + Intronic
1142357414 16:89608439-89608461 GGCAGCTCCAAACCAGCAGGTGG - Intergenic
1203083181 16_KI270728v1_random:1161868-1161890 GGGTGTTCAGGACCACCAGGGGG + Intergenic
1203083193 16_KI270728v1_random:1161907-1161929 GGGCGCTCAGAACCACCAGGGGG + Intergenic
1203083226 16_KI270728v1_random:1161992-1162014 GGGAGCTCAGAACCACCAGGGGG + Intergenic
1203094741 16_KI270728v1_random:1244178-1244200 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1203094812 16_KI270728v1_random:1244409-1244431 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1203094846 16_KI270728v1_random:1244549-1244571 GGGATCTCAGAACCACCAGGAGG + Intergenic
1203094899 16_KI270728v1_random:1244740-1244762 GGGTGCTCAGAACCACCAGGGGG + Intergenic
1144690602 17:17260254-17260276 GGCAGCTCCTGACCCCCTGGGGG - Intronic
1144955187 17:19015508-19015530 CGCAGCTGGGAACCATCAGGAGG - Intronic
1145243501 17:21252993-21253015 GGCCGCCCGGGACCACCCCGCGG + Intronic
1147419801 17:40316872-40316894 GACAGCTCCGGCCCAGCAGGCGG + Intronic
1150655575 17:67037089-67037111 GGCAGCTCCAGACCACAAGAAGG - Intergenic
1151999723 17:77637652-77637674 GGCAGCTCCGCCCCACCTGGAGG - Intergenic
1154151213 18:11908236-11908258 GGCAGATGGGGAGCACCGGGCGG + Exonic
1154478994 18:14798182-14798204 GGCACCACGGGACGACAAGGCGG - Intronic
1155053050 18:22165014-22165036 GGGAGCTCTGGAGCTCCAGGTGG - Intergenic
1160754575 19:750893-750915 GGCTCCTCGGGGCCACCTGGAGG + Intergenic
1160901885 19:1432853-1432875 GGCAACTCGGGTCCAGCAGAAGG + Intronic
1162924757 19:13924801-13924823 GGCAGCTGGGAACCACCGGAGGG - Intronic
1163696881 19:18768650-18768672 GGCAACAGGGGGCCACCAGGGGG - Exonic
1164989659 19:32674913-32674935 GGCGGCGCGGGGCCACCTGGCGG + Intronic
1165327914 19:35124982-35125004 GGCAGCTCGGGAGGTCCAGTAGG + Exonic
1165448206 19:35868420-35868442 AGCAGCTCGGGAACCCCGGGCGG - Intronic
1165566819 19:36736750-36736772 GGCACCGCGGGACCAGAAGGTGG + Intronic
1166773829 19:45300459-45300481 GGCAGCTCAGGGCCAGCAGGAGG + Intronic
1167588826 19:50391446-50391468 GGCACCTCGGGAGGCCCAGGCGG + Intronic
1167605389 19:50479133-50479155 GGCTGCTGGGGACCAGCAGGGGG - Intronic
1167735655 19:51293194-51293216 GCCAGCCAGGGACCAGCAGGTGG + Intergenic
1168722672 19:58562832-58562854 GGAGGCTCGGGCGCACCAGGAGG + Exonic
925191815 2:1891346-1891368 GGCGGCTGGGGAGAACCAGGCGG - Intronic
927812974 2:26190442-26190464 GGCAGCACGGGAGCAGCATGAGG - Intergenic
929051121 2:37837841-37837863 GCCAGCTAGGGACTATCAGGAGG + Intergenic
931253309 2:60551521-60551543 CACAGCTCGGGACCGCGAGGAGG - Intronic
932476352 2:72008764-72008786 CACTGCTCGGGAGCACCAGGAGG + Intergenic
934176730 2:89584141-89584163 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
934287036 2:91658501-91658523 GACAGCCCGGGGCCAGCAGGTGG + Intergenic
934560400 2:95310282-95310304 GGCAGCTCGGGACCATCCAGGGG + Intronic
935248974 2:101244954-101244976 GGCATCGCGGGACCAGAAGGCGG + Intronic
938253317 2:129833267-129833289 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
944158975 2:196639451-196639473 GGCAGCACAGGACCCCCCGGAGG + Intergenic
945142313 2:206699806-206699828 GGCAGGTCGGGAGCCACAGGAGG + Exonic
945147800 2:206756894-206756916 TGCAGGTCTGGATCACCAGGTGG - Exonic
948275395 2:236704329-236704351 GGCAGGTAGAGACCAACAGGTGG + Intergenic
948299468 2:236891173-236891195 GGAAGCTGGGGGCCACCTGGGGG - Intergenic
948644085 2:239392925-239392947 GCCAGCTCGGGTCCCCCAGCGGG + Intronic
948756115 2:240160600-240160622 GGCTGCACAGGACCACAAGGTGG - Intergenic
1168994092 20:2119744-2119766 GGCTTCTTGTGACCACCAGGAGG - Intronic
1172125439 20:32622731-32622753 GGCAGCTGAGGCCCACCAGGAGG + Intergenic
1176115002 20:63428344-63428366 GTCAGCTGGGGAGCTCCAGGTGG - Intronic
1178497723 21:33101448-33101470 GGCAGCCCGGGTCCACGCGGCGG - Intergenic
1179797338 21:43793026-43793048 GGAACCTCAGGACCATCAGGCGG - Intronic
1180693799 22:17739358-17739380 TGCAGCTCAGGAACACCAGCCGG - Exonic
1180968262 22:19801601-19801623 GCCAGCTCCAGACCACCACGGGG + Intronic
1181048437 22:20227555-20227577 GGCAGGTGGGAACCAGCAGGTGG - Intergenic
1181301841 22:21885908-21885930 GGCAGATGGGGAGCACCGGGCGG + Intergenic
1182648872 22:31834236-31834258 GCCAGCTCTGGACCAGCATGGGG - Intronic
1183364633 22:37400401-37400423 GGCAGCCCTGGCCCTCCAGGTGG - Intronic
1183730689 22:39616960-39616982 GGGAGTTAGGGACCAGCAGGGGG + Intronic
1184442490 22:44526396-44526418 GGGAGCACGGGGCTACCAGGTGG - Intergenic
1185003530 22:48261870-48261892 GGCAGCTGAGGTCCTCCAGGGGG - Intergenic
1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG + Intronic
1185061753 22:48610618-48610640 GGCAGCTCGGGACCACCTGGAGG + Intronic
950125357 3:10506837-10506859 GGCAGCTCGGGACGCTCGGGCGG - Intronic
950232585 3:11289642-11289664 GATAGCTCGAGCCCACCAGGAGG - Intronic
951294875 3:20921552-20921574 GGCACCGCGGGACCAGAAGGCGG - Intergenic
952748616 3:36805278-36805300 AACAGCTCTGGACAACCAGGAGG - Intergenic
953538367 3:43793159-43793181 GGCAGCTCTCCACCACCAAGGGG + Intergenic
953920767 3:46949681-46949703 GGCAACTTGGGTCCACCATGTGG + Intronic
954137579 3:48589150-48589172 GGCAGTGTGGGGCCACCAGGAGG + Intronic
954327358 3:49870778-49870800 GGAGGCTCAGAACCACCAGGAGG + Intergenic
954761692 3:52879304-52879326 GGCAGCCTTTGACCACCAGGAGG + Intronic
954942146 3:54383379-54383401 GGCAGGTTGGGACAACCCGGTGG + Intronic
955924699 3:63993793-63993815 GGCTTCTCATGACCACCAGGTGG - Intronic
956178997 3:66500587-66500609 GGCCGCTCCGGAGCACCCGGCGG + Exonic
960864263 3:122184233-122184255 GGCAGTTGGGGACCCCGAGGGGG + Intronic
961904714 3:130251097-130251119 GGAACCTCGGGGCCACCATGAGG + Intergenic
963733575 3:148994214-148994236 AACAGCACAGGACCACCAGGAGG + Exonic
966617322 3:181926418-181926440 GGCACCTCGGGAGGCCCAGGCGG + Intergenic
968221455 3:196942963-196942985 GGCCGCTCGGGGCCACCACCAGG + Intergenic
968439823 4:617619-617641 GGCAGGTGGGGAACCCCAGGTGG - Intergenic
968702570 4:2063809-2063831 GGCTGCACGGGCCCACGAGGAGG + Exonic
972311762 4:37889830-37889852 GGCAGTTCCAGACCCCCAGGTGG - Intergenic
973293429 4:48491057-48491079 GGCAGCTCGGGACCGTCGGCCGG - Exonic
976636445 4:87291133-87291155 GGCACCGCGGGACCAGAAGGCGG - Intergenic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
981628365 4:146787864-146787886 GGCAGCTGGTGACCGACAGGAGG - Intronic
982182985 4:152765869-152765891 GGCACCTCGGGAGGCCCAGGCGG + Intronic
985737083 5:1590022-1590044 GGCCCCTCGGGACCACCATCTGG - Intergenic
986449603 5:7851159-7851181 GGCAGCTCCGGGTCGCCAGGCGG - Exonic
986671898 5:10150143-10150165 GGCACCTGGGGGCCACCAAGAGG + Intergenic
991711655 5:69414990-69415012 GGCTGCTCGGTGCCACCAGCCGG - Intergenic
992818692 5:80471578-80471600 GGCACCACGGGACCAGAAGGCGG + Intronic
996448918 5:123595053-123595075 GGCAGCTTGGGACTCCCAGCAGG + Exonic
997870209 5:137499402-137499424 GGCAGCGCGCGGCCACCAGGGGG - Intronic
998754413 5:145360232-145360254 GGTAGGTCGGCACCACCACGTGG + Intergenic
999682498 5:154073116-154073138 GGCACCGCGGGACCAAAAGGCGG - Intronic
1002319059 5:178364369-178364391 GGCAGCTCCAGGCCCCCAGGAGG + Intronic
1002436505 5:179234929-179234951 GGCAGGTCAGGCCCATCAGGAGG - Intronic
1002639003 5:180621827-180621849 GGCAGCTCAGGAGCACCGGCTGG + Exonic
1003953881 6:11144525-11144547 AGCAGCTTGTGACCACGAGGTGG + Intergenic
1006573497 6:35025445-35025467 GGCAGCAAGGGACCAGCAAGCGG - Intronic
1008106422 6:47444385-47444407 GGCACCTCGGGAGGCCCAGGCGG + Intergenic
1008542609 6:52558268-52558290 AGGAGCCCGGGAGCACCAGGTGG + Intronic
1011851590 6:91636020-91636042 GGAAGCTTGGGACCAGAAGGTGG + Intergenic
1013584589 6:111566911-111566933 GGCAGCTCAGAACCAGCTGGAGG - Intronic
1014405837 6:121049202-121049224 GGCATCACGGGACCAGAAGGCGG + Intergenic
1017374081 6:153747334-153747356 GGCAACTCCAGACCACAAGGGGG + Intergenic
1018419545 6:163630251-163630273 GGCTGCTCCTGACCTCCAGGAGG - Intergenic
1018713482 6:166514324-166514346 GGCAGCAAGGGGCCACCAGAGGG + Intronic
1019660189 7:2219782-2219804 TGCTGCTCTGGAGCACCAGGAGG - Intronic
1020405826 7:7833075-7833097 GGCAGCTTGGGACCACAGTGTGG + Intronic
1021794962 7:24245276-24245298 GGCAGCTCAGGACTCCCAGTAGG + Intergenic
1022187753 7:27986902-27986924 GGCACCTCGGGAGGCCCAGGCGG - Intronic
1022721867 7:32948708-32948730 GCCAGCTAGGGACCTCCAGCTGG - Intergenic
1025947381 7:66114934-66114956 GGCAGCTAGGGGCGACGAGGCGG + Exonic
1026966945 7:74446155-74446177 GGGAGCTCTGGATCAGCAGGTGG - Intergenic
1029365024 7:100111198-100111220 TGCAGATCTGGGCCACCAGGCGG + Exonic
1030319304 7:108147129-108147151 GGCAGCTCTGAGCCAGCAGGAGG + Intergenic
1030329252 7:108255413-108255435 GGCACCTCGGGAGGCCCAGGTGG - Intronic
1032057813 7:128697643-128697665 CGCAGCCCGGGACCTCCTGGTGG + Intergenic
1032842656 7:135726583-135726605 GGAAGCAGGTGACCACCAGGAGG + Intronic
1034264415 7:149774018-149774040 GCCAGGTCGGGAGCTCCAGGGGG + Intergenic
1034268321 7:149791636-149791658 GGCAGTTCTGTAGCACCAGGAGG - Intergenic
1035491319 7:159281381-159281403 GGCATCCAGGGACCAGCAGGGGG - Intergenic
1038008804 8:23457580-23457602 GGGAGCGGGGGACCACCAGTGGG + Exonic
1038742182 8:30225557-30225579 GGAAGCCCGGTAACACCAGGAGG - Intergenic
1040006859 8:42628246-42628268 GGGAGCTCTGGACCTCCACGTGG - Intergenic
1040277247 8:46020327-46020349 GGCATCACGGGACCAGAAGGTGG + Intergenic
1040554981 8:48470174-48470196 GCCAGCCCGGGACCAGCGGGAGG + Intergenic
1041073036 8:54143749-54143771 GGGAGCAGGGGAACACCAGGAGG - Intronic
1042792116 8:72619574-72619596 GGCAGCTATGGAGCCCCAGGAGG - Intronic
1043427676 8:80164634-80164656 AGCAGCTTGGGACGCCCAGGTGG + Intronic
1048410600 8:134168635-134168657 GCCAGCTGGGGACCTCCAGCTGG + Intergenic
1048422267 8:134288865-134288887 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1049655860 8:143796983-143797005 GTCATCTCGGGACCTCCTGGGGG - Intronic
1049681396 8:143920154-143920176 GGCTGCTCGGGCCCGGCAGGAGG - Exonic
1056166685 9:83947760-83947782 GGCACCTCGGGAGGCCCAGGCGG - Intronic
1056692734 9:88822182-88822204 GGCAGCTGGGCAGCACTAGGAGG - Intergenic
1060296020 9:122343313-122343335 GGCAGCTTGGGAGGCCCAGGCGG - Intergenic
1060345195 9:122809799-122809821 GGCACCACGGGACCAGAAGGCGG + Intronic
1061016167 9:127981800-127981822 CCCAGCTCAAGACCACCAGGTGG + Intergenic
1062357290 9:136170878-136170900 GTCAGCATGGGGCCACCAGGTGG - Intergenic
1192011415 X:67277478-67277500 GTCAGCTGGAGAACACCAGGAGG - Intergenic
1193565497 X:83071155-83071177 GGCACCACGGGACCAGAAGGCGG + Intergenic
1194188613 X:90807513-90807535 GTCAGCTGGGGAACACCAGTGGG + Intergenic
1194192508 X:90855215-90855237 GGCACCACGGGACCAGAAGGTGG + Intergenic
1195393805 X:104389894-104389916 GGCAGCAGGGGACCAGCAGAGGG - Intergenic
1198267689 X:135024578-135024600 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1199634839 X:149805305-149805327 GCCAGCCCTGGACCACCTGGGGG + Intergenic
1199642923 X:149881362-149881384 GCCAGCCCTGGACCACCAGGGGG + Intronic
1199897540 X:152138376-152138398 GCCAGCTCTGGACCACCTGAGGG - Intronic
1199954067 X:152728174-152728196 GGAAGCTCGGGGAGACCAGGTGG - Exonic
1200535197 Y:4389408-4389430 GTCAGCTGGGGAACACCAGTGGG + Intergenic
1200539140 Y:4437659-4437681 GGCACCACGGGACCAGAAGGTGG + Intergenic