ID: 1185065322

View in Genome Browser
Species Human (GRCh38)
Location 22:48629124-48629146
Sequence TCCACCTCGAGGGGAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185065322_1185065332 19 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065332 22:48629166-48629188 GCTTGAGGGCTGGGCCTGCTGGG 0: 1
1: 0
2: 2
3: 30
4: 394
1185065322_1185065329 9 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065329 22:48629156-48629178 AGCAATGCTTGCTTGAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 228
1185065322_1185065327 4 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065327 22:48629151-48629173 ACTTCAGCAATGCTTGCTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1185065322_1185065330 10 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065330 22:48629157-48629179 GCAATGCTTGCTTGAGGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 136
1185065322_1185065328 5 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065328 22:48629152-48629174 CTTCAGCAATGCTTGCTTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 138
1185065322_1185065331 18 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065331 22:48629165-48629187 TGCTTGAGGGCTGGGCCTGCTGG 0: 1
1: 1
2: 3
3: 43
4: 494
1185065322_1185065333 20 Left 1185065322 22:48629124-48629146 CCAGCGGCTCCCCTCGAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185065333 22:48629167-48629189 CTTGAGGGCTGGGCCTGCTGGGG 0: 1
1: 0
2: 6
3: 46
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185065322 Original CRISPR TCCACCTCGAGGGGAGCCGC TGG (reversed) Intronic
900123804 1:1060660-1060682 TCCTCCTCGATGGGAGCCCCAGG - Intergenic
900187370 1:1338715-1338737 TGCACCCCCAGGGGAGCCTCTGG + Intronic
903232623 1:21931275-21931297 CTCACTTCGCGGGGAGCCGCCGG - Intronic
904480326 1:30789255-30789277 TACACATCGAGGGGGGCCACAGG - Intergenic
904799360 1:33081795-33081817 CCCACCTAGAGGGTAGCCGGTGG - Exonic
915645005 1:157264187-157264209 TTCACCTTGAGGGGAGCTGAAGG + Intergenic
920855613 1:209658899-209658921 TCCTCCTCCAGGGAAGCCCCAGG + Intergenic
1064286812 10:13998752-13998774 ACCACCTCCAGGGTATCCGCTGG + Intronic
1074078673 10:110151283-110151305 CCCACCTGGTGGGGAGGCGCTGG + Intergenic
1077141492 11:1026809-1026831 TCCACCTCGTGGCCAGCCCCAGG + Intronic
1079357256 11:19740028-19740050 TCCCCCTGGAGGGCAGCCACTGG + Intronic
1084296051 11:68213873-68213895 TCCGCCACGAGGGGAGGCGACGG - Intergenic
1089160777 11:116435405-116435427 TCCCACTCCAGGGGAGCAGCAGG - Intergenic
1090635942 11:128690551-128690573 TCCCCCGGGAGGGGAGCGGCGGG - Intronic
1096830151 12:54307451-54307473 TCCAGGTAGAGGGGAGCAGCAGG - Intronic
1103901495 12:124305915-124305937 GCCACCTCGAGGCCAGCTGCTGG + Intronic
1103907887 12:124336637-124336659 ACCATCGCGAGGGGAGCCGTTGG + Intronic
1110798913 13:79672184-79672206 TCCTCCTCAAGGGCAGCAGCAGG - Intergenic
1112339124 13:98537961-98537983 TGCACCCCGAGCGGAGCAGCTGG - Intronic
1116341101 14:43724177-43724199 TCCACCTGGAGCAGAGCTGCTGG + Intergenic
1125516585 15:40324254-40324276 GGGACCTCGGGGGGAGCCGCTGG + Intergenic
1129893061 15:79084612-79084634 TCCTCCTCGTGGGGCTCCGCTGG + Intronic
1132569504 16:637920-637942 CCCACCTCGAGGAGAGCCCCAGG + Intronic
1132679513 16:1134002-1134024 TCCACCTGGAAGGCAGCCACGGG + Intergenic
1133021115 16:2967373-2967395 GCCCCGTCGAGGGGCGCCGCGGG - Exonic
1141177302 16:81729585-81729607 TCCAGCCCGAGGGGAGGCGGAGG + Intergenic
1142541213 17:660919-660941 TCCTCCTCCATGGGAGGCGCTGG - Intronic
1150131561 17:62671982-62672004 TCCACCTCTGGGGGTGCAGCAGG - Exonic
1150358402 17:64507160-64507182 TCCACCTCCAGGGAGGCCTCGGG + Intronic
1151595743 17:75077242-75077264 TCCAGCTCTAGGAGACCCGCTGG + Intergenic
1152365884 17:79856028-79856050 TCCAGCTCCTGGGGAGCCACCGG + Intergenic
1161424876 19:4198122-4198144 TGCATCTCCAGGGGACCCGCGGG - Intronic
1162033653 19:7927810-7927832 TTCACCTCCAGGGGAGCAGCCGG - Intronic
1162780220 19:13002791-13002813 CCCACCCTGAGGGGAGCCGGGGG + Intronic
1162822566 19:13231911-13231933 TCCACCTCCTGGGGAGGCGTTGG - Intronic
1162926050 19:13930946-13930968 TCCACTTCCAGGGGAACCGGGGG - Intergenic
1163436872 19:17301258-17301280 TCCACCTCCAGGGCGGCCGGCGG + Exonic
1163692267 19:18744261-18744283 TCCACCTCCCTGGGAGCCGCAGG - Intronic
1164755073 19:30683125-30683147 GCCACCTAGAGGGCAGCCGGAGG - Intronic
1164985126 19:32642892-32642914 GCCAGCTGGATGGGAGCCGCTGG - Intronic
1167974230 19:53210708-53210730 TCGATCTCGCTGGGAGCCGCAGG + Intergenic
926056728 2:9778089-9778111 TCCACCTTGAGGAGAGGAGCTGG - Intergenic
927215965 2:20667887-20667909 GCCTCCTCGAGGGGACCAGCCGG - Intronic
930346139 2:50183868-50183890 TTCACCTGGTGGGGAGCTGCAGG + Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
934045665 2:88170824-88170846 TCCACCCCTAGGGGTGCCGTCGG + Intronic
935237451 2:101150939-101150961 ACCACCTCGACGGGAGCCCGCGG + Intronic
938181491 2:129188997-129189019 TCCAACTCTAGGGCAGCCCCAGG + Intergenic
948157963 2:235799928-235799950 TCCACCCCGAGGGCAGCGCCAGG - Intronic
948692473 2:239715382-239715404 TCCACATCTAGGGGAGAGGCAGG - Intergenic
948768204 2:240233949-240233971 CCCTCCTCGGGGGGTGCCGCAGG + Intergenic
948802713 2:240440116-240440138 TGCACCTCGTGGGCAGCCTCGGG + Intronic
1171369569 20:24652833-24652855 TGCTCCTGGAGGGGAGCCCCTGG + Intronic
1172290123 20:33770066-33770088 TACACCTTGAGGGAAGACGCTGG - Exonic
1180074124 21:45454176-45454198 TCCTTCTCGAGGGCAGGCGCAGG - Intronic
1183979693 22:41532248-41532270 TCCGCCTCGTGGGCAGCCCCAGG - Intronic
1185065322 22:48629124-48629146 TCCACCTCGAGGGGAGCCGCTGG - Intronic
954962468 3:54578486-54578508 TCCCCCTCGGGAGGAGCCGTTGG + Intronic
967250914 3:187537061-187537083 TACACCAGGAGGGGAGCAGCAGG - Intergenic
995309888 5:110698597-110698619 TCCAACTCTAGGGGAACCACTGG + Intronic
997401997 5:133611092-133611114 GACACCTAGAGGGGAGCGGCGGG + Intronic
998381227 5:141727094-141727116 TCAACCTCTAGGGGAGCCTCAGG + Intergenic
999347412 5:150836552-150836574 TCTTCCTCTAGGGGAGCCACCGG + Intergenic
1003164081 6:3661067-3661089 TGCACCTTGAGGGAAGCTGCAGG - Intergenic
1003371981 6:5537448-5537470 TCCAGCTCGAGAGGAGGCCCGGG - Intronic
1003371988 6:5537476-5537498 TCCAACTCGAGAGGAGGCCCGGG - Intronic
1003371995 6:5537504-5537526 TCCAACTCGAGAGGAGGCCCGGG - Intronic
1003372002 6:5537532-5537554 TCCAACTCGAGAGGAGGCCCGGG - Intronic
1004140314 6:13012102-13012124 TCCCCCTCTAGGGGAGGCGATGG + Intronic
1006401473 6:33820464-33820486 TCCACCTCCTGGGGAGCCTGAGG - Intergenic
1018151060 6:160940111-160940133 TCCACCTGGATGGGTGCCTCTGG + Intergenic
1018458087 6:163970980-163971002 TCCACCTCGACAGGTCCCGCTGG - Intergenic
1018698960 6:166412269-166412291 TCCAGCCCGTGGGGAGCCCCGGG + Exonic
1032257726 7:130310700-130310722 TCCACCTAGAGAGGGGCCGAAGG - Intronic
1033165625 7:139036194-139036216 TCCACGTCCAGGGGATCCGCAGG - Intergenic
1035266842 7:157693770-157693792 TCCAGGGCGAGGAGAGCCGCGGG - Intronic
1036012803 8:4746722-4746744 TCCACCTCGGTGGGAGTCACCGG + Intronic
1037819550 8:22129066-22129088 TCCATCTCGAGGCGGGCTGCCGG + Exonic
1037906604 8:22719208-22719230 ACCACCTCCAGGGCAGCCTCAGG - Intronic
1040030243 8:42817318-42817340 TCCATCTCGAGGGGACCCTGTGG - Intergenic
1040387144 8:46921287-46921309 TCCTTCTCCAGGGGAGCCCCTGG - Intergenic
1044607150 8:94057488-94057510 CCCACCTACAAGGGAGCCGCTGG - Intergenic
1060485839 9:124045670-124045692 GCCTGCTCGCGGGGAGCCGCGGG - Intergenic
1061926324 9:133807780-133807802 TCCACCCCGAGGAGTGCCGGTGG + Intronic