ID: 1185065769

View in Genome Browser
Species Human (GRCh38)
Location 22:48631064-48631086
Sequence CGCCCTGTCCTTTCTAAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185065759_1185065769 12 Left 1185065759 22:48631029-48631051 CCCTGCAGGAACGTTCTGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1185065769 22:48631064-48631086 CGCCCTGTCCTTTCTAAGGACGG 0: 1
1: 0
2: 0
3: 8
4: 78
1185065761_1185065769 11 Left 1185065761 22:48631030-48631052 CCTGCAGGAACGTTCTGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1185065769 22:48631064-48631086 CGCCCTGTCCTTTCTAAGGACGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185065769 Original CRISPR CGCCCTGTCCTTTCTAAGGA CGG Intronic
900585250 1:3429514-3429536 CTCCCTGTCCACTCTGAGGACGG - Intronic
903143152 1:21352162-21352184 CTCCCTGTCCTCTCTGAGGAAGG + Intergenic
909928503 1:81467378-81467400 CTCCCTGTCTTTTTTAAAGAGGG - Intronic
911553911 1:99318939-99318961 CCCCCAGTCTTTTCTATGGAAGG - Intergenic
912457268 1:109806466-109806488 GGCCCTGTCCCTTCTAATGTGGG + Intergenic
916327663 1:163581395-163581417 TACCCTGTCTTTTATAAGGAAGG - Intergenic
917511997 1:175676410-175676432 TGCCCTGGCCTTTCTCTGGAGGG - Intronic
1066377678 10:34872288-34872310 CATCCTGTCCTACCTAAGGAGGG + Intergenic
1067534498 10:47099093-47099115 TTCCCTGTCCTTTATATGGAGGG + Intergenic
1069744097 10:70703888-70703910 GCCCCTGGTCTTTCTAAGGAAGG - Intronic
1074235234 10:111578210-111578232 AGCCCAGTCCTTCCTTAGGACGG - Intergenic
1074376361 10:112944041-112944063 CTCCCTGTGCTTTTTAAGGGTGG - Intergenic
1075688346 10:124379213-124379235 CTCCCTGGCCTTTCCAAGGGTGG + Intergenic
1078317672 11:10306106-10306128 CGCCCTGTGCTGTCCAGGGACGG + Intronic
1078797993 11:14612857-14612879 ACTCCTGCCCTTTCTAAGGAAGG - Intronic
1081430650 11:42973019-42973041 CTCCCTCTCCTCTCTAAGGGTGG - Intergenic
1081674688 11:44961929-44961951 GTCTCTGTCCTCTCTAAGGAGGG + Intergenic
1083279743 11:61619501-61619523 CCCCCTGCCCTTTTTAATGATGG + Intergenic
1083345105 11:61984022-61984044 TGCCCTTTCCTTGCTAAGGAAGG + Intergenic
1095535313 12:43239216-43239238 CCCCCTGCCCTTTCTCATGAAGG + Intergenic
1096116169 12:49056710-49056732 CGGGCTGTCCTTGCTAAGGGTGG - Intronic
1100471072 12:94893646-94893668 CACCCTGTCCAGTCTGAGGAGGG + Intergenic
1102301543 12:111775162-111775184 TGCCGTGTCCTTTCTAAGTGGGG - Intronic
1109386400 13:61633928-61633950 CTCCTTTTCCTTTGTAAGGAGGG - Intergenic
1112157457 13:96833204-96833226 TGCCCTCTCCTCTCTCAGGAGGG + Exonic
1116999224 14:51355241-51355263 TGCCCTGTCCCTTCTCCGGAGGG + Intergenic
1118960517 14:70525820-70525842 AGCCCTGGGCATTCTAAGGAAGG + Intronic
1122863696 14:104594001-104594023 CGGCCTGTCGGCTCTAAGGAGGG + Intronic
1125630593 15:41143896-41143918 TGCCCTGTTCTTTCTAGTGAAGG + Intergenic
1132339402 15:101068584-101068606 CCCCCTGTGCCTTCTGAGGAAGG - Intronic
1133665494 16:7963641-7963663 TGCTCTGTCCTTTCTAAGAAAGG - Intergenic
1143002786 17:3805615-3805637 TTTCTTGTCCTTTCTAAGGAAGG + Intergenic
1144654225 17:17025187-17025209 AGCCCTGTTCTTTCTCAGGAAGG - Intergenic
1148462241 17:47845471-47845493 CATCCTGTCCCTTTTAAGGAGGG + Exonic
1149222617 17:54433091-54433113 CACACTGTCATTTCTCAGGATGG + Intergenic
1149417681 17:56477404-56477426 AACCTTTTCCTTTCTAAGGAAGG - Intronic
1160971184 19:1768471-1768493 CGCACTGTCTTTACAAAGGAAGG + Intronic
1162030397 19:7914753-7914775 GGCCCTGTCCTTGGCAAGGAGGG - Intergenic
1168334785 19:55591661-55591683 CGCCCTATTCACTCTAAGGAAGG + Exonic
1168489637 19:56797402-56797424 CTCTCTCACCTTTCTAAGGATGG - Intronic
925238489 2:2299727-2299749 CTCACTGTCATTTTTAAGGATGG - Intronic
930084681 2:47487460-47487482 CCTCCTGTTCTCTCTAAGGAGGG + Intronic
936404692 2:112192372-112192394 CTCTCTGTCCTTCCAAAGGAGGG - Intergenic
941052537 2:160750635-160750657 TGCCCTGTCCTTTATAATGCTGG + Intergenic
944196741 2:197062474-197062496 CCCACTGTCCCTTCTAAGTAGGG - Intronic
948752264 2:240139571-240139593 AGCCCTGTCCTGTTTGAGGAAGG + Intronic
1169298917 20:4425319-4425341 CCTCCTGTCCATGCTAAGGATGG + Intergenic
1171336853 20:24393040-24393062 TGCCCTGTCCTTTCTGGGCATGG - Intergenic
1172604735 20:36206877-36206899 CGCCCTGTCCTCTGTGAGGAGGG - Intronic
1173246235 20:41339832-41339854 CGCCCAGTCGTTTCTAAGCCTGG + Intergenic
1175991738 20:62793289-62793311 CGCCCCCTCCTTTCTGAGGCAGG - Intergenic
1183483073 22:38075395-38075417 CTCCCTCTCCTTCCTAAGGCAGG - Exonic
1185065769 22:48631064-48631086 CGCCCTGTCCTTTCTAAGGACGG + Intronic
949914711 3:8950461-8950483 CATCCTGTCCCATCTAAGGAGGG + Intronic
950137584 3:10592585-10592607 GGCCTTGTCCCTTCTAAGAATGG + Intronic
950468854 3:13172398-13172420 GGGCCTGTCCTGTTTAAGGAAGG - Intergenic
952942790 3:38456034-38456056 CGCCCTGCCCTGCCTAAGGAGGG - Intronic
963068255 3:141280979-141281001 TGCCATGTGCTTTATAAGGAAGG + Intronic
969299703 4:6290724-6290746 AGCCCAGCCCTTTCTAAGGAAGG - Intronic
986738214 5:10682978-10683000 CGGCCTGTCCAGTCTCAGGAGGG + Intronic
996875787 5:128239022-128239044 CGCCCTTGCCTTTCCACGGATGG + Intergenic
998583806 5:143405026-143405048 GGCCCTCTCCTTTCTCAGGACGG - Intronic
1005864576 6:29927958-29927980 TGTCCTGTCCATTCTCAGGATGG + Intergenic
1005905884 6:30261111-30261133 TGTCCTGTCCATTCTCAGGATGG + Intergenic
1006042954 6:31270556-31270578 TGTCCTGTCCATTCTCAGGATGG - Intronic
1006065841 6:31462237-31462259 TGTCCTGTCCATTCTCAGGATGG - Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1007235744 6:40390472-40390494 CACCCTGTAATTTCCAAGGATGG + Intergenic
1013903289 6:115183357-115183379 TGCCCTGTTCATTGTAAGGATGG - Intergenic
1019354342 7:570971-570993 CGCCCTGTCCTCTCTCCGGCTGG - Intronic
1021910228 7:25378281-25378303 CAGACTCTCCTTTCTAAGGAAGG + Intergenic
1021931419 7:25584997-25585019 TGCCCTGCCCTTTCAAAGAAAGG - Intergenic
1021946643 7:25734166-25734188 CGTCCTGTCCTGTCCAAGGTTGG - Intergenic
1029168067 7:98609863-98609885 GGCCCTGTCCTTCCTCACGATGG + Intergenic
1032080498 7:128856255-128856277 TGCCCTGTCCTGGCTGAGGAAGG - Intronic
1032091613 7:128914307-128914329 TGCCCTGTCCTGGCTGAGGAAGG + Intergenic
1035597398 8:869585-869607 CTCCCTGTCTTTTCCAAGGCTGG + Intergenic
1040884082 8:52240496-52240518 GATCCTCTCCTTTCTAAGGATGG + Intronic
1049357848 8:142197543-142197565 TGCCCTGGCCTTTCTAGGGGTGG - Intergenic
1049607359 8:143535970-143535992 CGCCCTCTCCTCCCTCAGGAGGG + Intronic
1049711999 8:144068978-144069000 CACACTGTGCTTCCTAAGGAAGG - Intergenic
1051369418 9:16345525-16345547 CTCCCTACCCTTCCTAAGGAGGG + Intergenic
1053720458 9:40940817-40940839 CGCTGTTTCTTTTCTAAGGAAGG + Intergenic
1058502737 9:105637795-105637817 CACCCAGTCCTCTCTAAGCAGGG + Exonic
1191158653 X:57303120-57303142 AGTCCTGTTCTTTCCAAGGATGG - Intronic
1194730811 X:97452493-97452515 CCCACAGTCATTTCTAAGGATGG - Intronic
1200101212 X:153689788-153689810 CTCCCTGGCCTTGCTAAGGCCGG + Intronic