ID: 1185066619

View in Genome Browser
Species Human (GRCh38)
Location 22:48635474-48635496
Sequence GCAGCAGCTCCTCCTCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 297}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185066615_1185066619 -9 Left 1185066615 22:48635460-48635482 CCCAGAACCTTCCAGCAGCAGCT 0: 1
1: 0
2: 5
3: 31
4: 278
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066604_1185066619 17 Left 1185066604 22:48635434-48635456 CCGTCTCCCAGTCCCTACCCAGG 0: 1
1: 0
2: 1
3: 59
4: 557
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066610_1185066619 10 Left 1185066610 22:48635441-48635463 CCAGTCCCTACCCAGGGGGCCCA 0: 1
1: 0
2: 0
3: 33
4: 297
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066612_1185066619 4 Left 1185066612 22:48635447-48635469 CCTACCCAGGGGGCCCAGAACCT No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066613_1185066619 0 Left 1185066613 22:48635451-48635473 CCCAGGGGGCCCAGAACCTTCCA 0: 1
1: 1
2: 0
3: 16
4: 165
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066614_1185066619 -1 Left 1185066614 22:48635452-48635474 CCAGGGGGCCCAGAACCTTCCAG 0: 1
1: 1
2: 2
3: 21
4: 295
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066603_1185066619 27 Left 1185066603 22:48635424-48635446 CCTCTAGCAACCGTCTCCCAGTC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066616_1185066619 -10 Left 1185066616 22:48635461-48635483 CCAGAACCTTCCAGCAGCAGCTC 0: 1
1: 0
2: 3
3: 43
4: 299
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066611_1185066619 5 Left 1185066611 22:48635446-48635468 CCCTACCCAGGGGGCCCAGAACC 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066602_1185066619 30 Left 1185066602 22:48635421-48635443 CCGCCTCTAGCAACCGTCTCCCA 0: 1
1: 0
2: 0
3: 5
4: 153
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297
1185066609_1185066619 11 Left 1185066609 22:48635440-48635462 CCCAGTCCCTACCCAGGGGGCCC 0: 1
1: 0
2: 3
3: 36
4: 285
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 43
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185066619 Original CRISPR GCAGCAGCTCCTCCTCCGTG AGG Intronic
900145602 1:1157611-1157633 CCAGCAGCTCCGCCTCCTCGGGG - Intergenic
900237371 1:1599207-1599229 CCGGCAGGTCCTCCTCCGCGGGG + Exonic
900809436 1:4790190-4790212 GCAGCAGCTGCTGCTCCCAGGGG + Exonic
900931760 1:5742274-5742296 GGAGCTCCTCCTCCTCCCTGGGG - Intergenic
901564983 1:10106550-10106572 GCAGACGCCCCTCCTCCCTGAGG + Exonic
901816012 1:11794020-11794042 GCAGCAGCTCCTCCTTCAGCAGG + Exonic
902104619 1:14024032-14024054 GCAGAATTTCCTTCTCCGTGGGG - Intergenic
902847372 1:19122587-19122609 GCAGCAGTTCCTCCACTGTGAGG - Intronic
903011099 1:20330953-20330975 GCAGCCGCTCCCCCTCCATCAGG - Exonic
903500733 1:23798938-23798960 CCAGCAGCTCCAGCACCGTGTGG + Exonic
903888910 1:26556918-26556940 CCAGCACCTCCTCCTGCATGGGG + Intronic
904100760 1:28024967-28024989 ACAGCAGCCCATCCTCCCTGGGG - Intronic
904252144 1:29232708-29232730 CCAGCAAGTCCTCCTCCTTGGGG + Intergenic
904420422 1:30387418-30387440 GCAGCATCTCCTCCATCATGGGG + Intergenic
904493245 1:30873026-30873048 GCAGCAGCCCCTCTTCCTCGGGG + Intronic
905262622 1:36730360-36730382 GCAGCAGCGACTCCTCCGGAAGG - Intergenic
905752923 1:40481593-40481615 GCAGCAGGTCCTCCTCACTAAGG + Intronic
906511720 1:46413840-46413862 GAAACAGCTCCTCGTCTGTGTGG + Exonic
906656337 1:47551287-47551309 GCAAGTGTTCCTCCTCCGTGTGG + Intergenic
908572454 1:65423477-65423499 GCAGTACCCCCTCCTCCATGAGG - Intronic
912946291 1:114087575-114087597 GCAGCAGGTCCACCTCCCAGTGG + Intergenic
914950486 1:152109685-152109707 GCTGCAGCTCCTCTTCCTCGCGG + Exonic
915325678 1:155080271-155080293 GCGGCAGCCCCTCCTCCGAGAGG - Intronic
915367336 1:155323559-155323581 GCAGCAGCTGCTCCTCTGGGGGG - Intronic
916271002 1:162941308-162941330 GCAGCAGCAACACCTCAGTGGGG + Intergenic
920038187 1:203079110-203079132 GTTGCAGTTCCTCCTCAGTGTGG + Intergenic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
923071401 1:230568176-230568198 GCTGCAGCTCCTGCTGCCTGTGG + Intergenic
923454449 1:234151106-234151128 CCAGCAGCCCCTCCTCAGTGTGG - Intronic
924774509 1:247106467-247106489 CCTGAAGCTCCTCCTCAGTGTGG - Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1067750834 10:48969938-48969960 GCAGGAGCTCCTCCTCCAGCAGG - Intronic
1069963244 10:72091290-72091312 GCAGCAGCTCCTCATGTTTGGGG - Intergenic
1071598312 10:86943598-86943620 ACTGCAACTCCTCCTCCCTGCGG + Exonic
1072637593 10:97187624-97187646 TCACCAGCTCCTGCTCCATGGGG + Intronic
1073196243 10:101694529-101694551 GCAGCAGCAGCTCCTCCGGCAGG + Exonic
1075087493 10:119423207-119423229 GTAGGAGCTTCTCCTCCGTCTGG - Exonic
1075405845 10:122195239-122195261 GCAGCAGTTCCTCCTGGGTCAGG + Intronic
1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG + Intergenic
1075652786 10:124140167-124140189 CCAGCAGCTCCACCTCCATCAGG - Intergenic
1076567428 10:131408410-131408432 GGAGCATCTCAGCCTCCGTGGGG - Intergenic
1076749795 10:132537091-132537113 GCAGCCGCTCCTCGTGAGTGAGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077107075 11:846799-846821 GCAGCAGTGCCTCCTCCCTGGGG - Intronic
1077231992 11:1461900-1461922 GAAGCAGCTCCACCTCTGGGGGG + Intronic
1077251027 11:1560795-1560817 GCTGCCTCTCCTCCTCCCTGTGG + Intronic
1077510538 11:2958879-2958901 GCAGCAACTCCTCCTTCCTTGGG - Intronic
1077541855 11:3150417-3150439 CCAGCAGCTCCTCCTCCTTAGGG + Intronic
1078039717 11:7848765-7848787 GCTGCAGCTCCCCCTCTTTGTGG + Intergenic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1078600308 11:12724712-12724734 GCAGAACCTCCTGCTCAGTGGGG + Intronic
1079089771 11:17472719-17472741 TCAGCAGCCCCTCCTGTGTGTGG - Intronic
1080143860 11:28955576-28955598 GCAGCAACTCCTCATCTGTTAGG - Intergenic
1081422730 11:42890906-42890928 GCACCAGATGCTCCTCAGTGAGG + Intergenic
1081578484 11:44334646-44334668 GCAGCTGCTCCTCCTGGGAGGGG + Intergenic
1082002555 11:47401081-47401103 GCAGCAGGCCCTCCTGCATGTGG + Intergenic
1082005200 11:47415300-47415322 GCAGCTGCTTCTGCTCTGTGCGG + Exonic
1082026883 11:47578987-47579009 GCAGCAGATCTTCTTCCGGGCGG - Exonic
1083642208 11:64151508-64151530 GCAGTAGGTGCTCCTCAGTGTGG - Intronic
1083889483 11:65588832-65588854 GCAGCAGCCGCTCCTGGGTGTGG + Intronic
1084085155 11:66851654-66851676 ACAGCAGCCCCTGCTGCGTGTGG + Intronic
1084129022 11:67119302-67119324 TCAGCGGCTCCTCCTGTGTGAGG + Intronic
1084429133 11:69101678-69101700 GCAGGAGCTCCTCCTCCTCCTGG + Intergenic
1085045576 11:73351076-73351098 GCTGCTGCTCCTGCTCCTTGTGG + Intronic
1089314684 11:117583487-117583509 GCTGCAGCCCCACCTCCTTGGGG + Intronic
1089367336 11:117929077-117929099 CCAGCAGCTTCTCCTCCCAGGGG + Intronic
1091141581 11:133239670-133239692 GAAGGAGTTTCTCCTCCGTGGGG - Intronic
1091992120 12:4963920-4963942 GCCCCACCTCCTCCTCCATGTGG - Intergenic
1092325504 12:7527480-7527502 GCAGCTGCTCCTCTTCCTAGGGG + Intergenic
1096583166 12:52601348-52601370 GCAGCAGCTCCGCCTCATTCCGG - Exonic
1096616596 12:52836547-52836569 GCAGCAGCTCTTCCTCTCTGTGG - Intergenic
1097101125 12:56590289-56590311 GCAGCAGATCTTCCACCGTGTGG - Exonic
1098394340 12:70002643-70002665 GCAGCAGCCCCTGATCCTTGAGG + Intergenic
1098893284 12:76031201-76031223 GCAGCAGCCCTTCCTCGGTGAGG + Exonic
1101865110 12:108515036-108515058 GCACCTGCTCCTCCTGCCTGTGG + Intergenic
1102260685 12:111441467-111441489 GCAGCAACTCCACCACCCTGAGG - Intronic
1102430666 12:112880553-112880575 GCAGCAACTCCTGCTTCATGGGG - Intronic
1102518811 12:113466658-113466680 GCAGCAACTCCTGTTCCATGTGG - Intronic
1102952208 12:117038378-117038400 GAAGCAGCTCCTGCCCTGTGTGG - Intergenic
1103612070 12:122129994-122130016 GCAGGGGATCCTCCTCCATGGGG - Exonic
1103907599 12:124335495-124335517 GCCGCAGCTCCCCCTCCAGGTGG + Exonic
1104031165 12:125066334-125066356 GCAAAGGCTCCTTCTCCGTGGGG + Intronic
1104169379 12:126265317-126265339 GCAGCAGATGCTCCTGCCTGGGG + Intergenic
1104407846 12:128533309-128533331 ACAGCAGCTCCTCCTCCTGAGGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106054525 13:26226069-26226091 GCAGCAGAACCTCATGCGTGAGG + Intergenic
1106296805 13:28421510-28421532 GCAGCAGCTCCTCCACCATTGGG - Intronic
1109570629 13:64184019-64184041 GCAGCAGGTACTGCTCCTTGTGG - Intergenic
1111928820 13:94492410-94492432 GCAGCAGCTCCTCTTCCTGCAGG + Intergenic
1112892474 13:104255255-104255277 CCAGCAGGTCCTCCTCCCTCTGG - Intergenic
1113560995 13:111280926-111280948 GAAGCTGCTTCTGCTCCGTGTGG + Intronic
1113899507 13:113788421-113788443 CCAGCAGCTCCACCTGCGAGAGG - Intronic
1114648560 14:24269149-24269171 GCACCAGCTCCAGCTCTGTGGGG + Exonic
1115116907 14:29891532-29891554 TCAGCACCTCCTCTTCTGTGAGG + Intronic
1115941476 14:38615315-38615337 GCATCAGCTTCTCCTCCAAGAGG + Intergenic
1117106787 14:52405559-52405581 GCAGCAGCTCCTTCTCTTGGGGG - Intergenic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1119400076 14:74357283-74357305 CCAGCAGCTTCTCCAACGTGTGG + Exonic
1122605565 14:102945397-102945419 GCAGCTGTTCCTCCTCCCAGGGG + Intronic
1122930827 14:104932442-104932464 GCAGCAGCCCCTCCCTCCTGAGG - Intronic
1123117728 14:105902214-105902236 GCAGCATCCCCTCCACAGTGGGG - Intergenic
1126806421 15:52353885-52353907 GGAGCACCTGCTCCTCCTTGCGG + Exonic
1126824422 15:52535021-52535043 GCATATGCTCCACCTCCGTGAGG + Intergenic
1127103153 15:55587945-55587967 GCGGCGGCTCCTCCTCCTCGCGG + Intronic
1128311689 15:66634875-66634897 ACAGCAACACCTCCTCAGTGAGG - Intronic
1129104431 15:73296348-73296370 CCACCAGCTCCCCCGCCGTGGGG + Intronic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1129296119 15:74601059-74601081 GCAGCAGCTCCCACTCCCTGAGG + Intronic
1130377936 15:83346676-83346698 CCATCAGCTCCTCCTCTCTGGGG + Intergenic
1130868811 15:87953913-87953935 CCATCTGCCCCTCCTCCGTGCGG + Intronic
1132059631 15:98681588-98681610 GCAGCAGACCCTCCTGCCTGGGG + Intronic
1132154624 15:99486746-99486768 GGAGCTGCTGCTCCTGCGTGCGG + Intergenic
1132333297 15:101027202-101027224 GCAGCAGCGCTTCCTCGGAGTGG + Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG + Exonic
1134090149 16:11387195-11387217 GCAGCAGCTTCTCCTCCATGAGG + Exonic
1134512989 16:14863807-14863829 GCAGCTGCCCTTCCTCCCTGTGG + Intronic
1134700627 16:16262296-16262318 GCAGCTGCCCTTCCTCCCTGTGG + Intronic
1134971198 16:18532363-18532385 GCAGCTGCCCTTCCTCCCTGTGG - Intronic
1136297575 16:29312453-29312475 GCACCATCTCCTCGGCCGTGCGG - Intergenic
1136565144 16:31065352-31065374 ACACCAGCTCATCCTCCCTGGGG + Intronic
1137673686 16:50293344-50293366 GCAGCAGGTTCTCCTGGGTGTGG - Exonic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1138549721 16:57740758-57740780 GCACAGGCTCCTCCTCTGTGTGG + Intronic
1138563187 16:57814254-57814276 GAAGCATCACCTCCTCCATGGGG + Intronic
1138624095 16:58235716-58235738 CCAGCACCTCCTCCTCTGAGAGG - Intronic
1139253668 16:65520589-65520611 GCACGGGCTCCTCCTCTGTGGGG + Intergenic
1139652033 16:68367210-68367232 ACAACTGCTCCTCCTCCATGAGG + Intronic
1140659166 16:77170824-77170846 GCAGCAGCTCAGCATCCCTGGGG - Intergenic
1142382245 16:89739521-89739543 GGGGCGGCTCCTCCTCCGTGTGG - Exonic
1142585545 17:970617-970639 GCTGCTCCTCCTCCTCCATGCGG + Intronic
1143164386 17:4890645-4890667 GCAGCAGCAGCTCCTGCCTGGGG + Exonic
1144016702 17:11203038-11203060 GCAGCAGCTGCTCTGCAGTGTGG + Intergenic
1144950961 17:18993128-18993150 GCAGCAGCACCTCTTCAGGGGGG + Intronic
1145016653 17:19403162-19403184 GCAGCAGCATCTGCTCCCTGTGG - Intergenic
1145018798 17:19414787-19414809 GCAGCAGCTCCTGCACCTTGGGG - Exonic
1145886389 17:28385012-28385034 TCAGCGTCTTCTCCTCCGTGGGG + Intronic
1146399513 17:32492165-32492187 GCAGCAGCTCCTCCTGGGGAAGG - Intergenic
1146793170 17:35764373-35764395 GGGGCAGCCCCTCCTCCCTGGGG - Intronic
1147176447 17:38658957-38658979 GCAGCAGCACCTCCTCTCTGGGG - Intergenic
1148065321 17:44864987-44865009 GCTTCAGCTCCTCCTTCGTCAGG + Exonic
1148097384 17:45061865-45061887 GCAGCAGTTCACCCTCAGTGAGG + Intronic
1148784767 17:50140690-50140712 GCACCAGCCCCTCCTCCCGGTGG + Intronic
1148847709 17:50538901-50538923 GCTGCAGGTCCTCGTCCCTGTGG - Exonic
1149851900 17:60042317-60042339 GCAGCAGCTCATCAGCTGTGAGG + Intergenic
1151535859 17:74738408-74738430 ACAGCAGCTCCTCCTCTCCGAGG - Intronic
1152000033 17:77639548-77639570 GCAGCATCTCCTCCTGCCTGGGG + Intergenic
1152162555 17:78677914-78677936 GGACCAGCTCCACCTCTGTGGGG + Intronic
1152364117 17:79845108-79845130 GCAGCAGCCCGGCCGCCGTGGGG - Intergenic
1152614215 17:81330475-81330497 CCAACAGCGCCTCCTCTGTGAGG - Exonic
1152720785 17:81923003-81923025 TCACCAGCTCCTCATCCGTCAGG + Exonic
1152802076 17:82335128-82335150 GCAGGAGCACCTGCACCGTGAGG + Intergenic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1155602500 18:27565771-27565793 GCAGCTGCTCCTCTTCCACGTGG - Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160837929 19:1133249-1133271 GCCACGGCTCCTCCTCTGTGAGG + Intronic
1160917518 19:1504245-1504267 TCAGCAAACCCTCCTCCGTGGGG - Intergenic
1161355814 19:3819151-3819173 CCAGGAGCTCCTGCTCCGTGGGG + Exonic
1161664596 19:5567846-5567868 GCAGCAGCGCCTCGTCCGCCAGG + Intergenic
1161794894 19:6380929-6380951 GCAGCACCTCCTCCACCCTGCGG - Exonic
1163711660 19:18850793-18850815 GCAGCTGCTCCTGCTCGGAGGGG - Exonic
1165162659 19:33826916-33826938 GCAACAGCTCCTCATGCGTGGGG + Intergenic
1165770845 19:38379327-38379349 GCAGCCGCTCCAACTCCGTGTGG - Exonic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
1168250317 19:55137868-55137890 GCCTCAGCCCCTCCTCCGTTAGG + Intronic
925281404 2:2687881-2687903 GCAGCCTCTCCTCCCCTGTGAGG + Intergenic
926453887 2:13040483-13040505 GCAGCTGCACCTCCTCCTAGGGG - Intergenic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
927430991 2:23025996-23026018 GGAGCATCTCCTCGTCCGTGTGG - Intergenic
927640263 2:24841411-24841433 GCTCCAGCCCCTCCTCAGTGAGG + Intronic
927846012 2:26473270-26473292 GCAGCAGCTCGTTCTCTGGGAGG + Exonic
928369590 2:30731507-30731529 GCAGCCCCTCCTGCTCCGCGGGG + Intronic
929590201 2:43140528-43140550 GCAGCGGCGCCTCCTCCGATGGG + Intergenic
929813338 2:45210915-45210937 ACAGCACTTCCTCCTCCTTGTGG + Intergenic
929928269 2:46232862-46232884 GCACCAGCTCCTCCTCAGTCAGG + Intergenic
930698189 2:54432569-54432591 GCAGAAGCTCTTCCACAGTGAGG - Intergenic
932763708 2:74457414-74457436 TCAGCAGCATCTCCTCTGTGAGG - Exonic
932784058 2:74584253-74584275 TCAGCAGCTTCTCTTCAGTGAGG + Intronic
934979608 2:98829186-98829208 ACAGCAGGACCTCCTCCCTGTGG + Intronic
937306173 2:120872370-120872392 GCAGCAGCCACTCCTCACTGGGG - Intronic
938256188 2:129861720-129861742 GCAGCAGCTGCTACTCACTGGGG - Intergenic
939142828 2:138376406-138376428 GCAGCAGCTCCTCCCATGTCTGG - Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
942712163 2:178848756-178848778 GCAGCAGCTCCTCGGTGGTGGGG + Intronic
946312936 2:218892866-218892888 GCAGCAGCGCCCCCACGGTGCGG - Exonic
948134759 2:235628291-235628313 CCAGCAGCTCCTCCACCAAGTGG - Intronic
948859236 2:240744935-240744957 GGAGCAGCTCCTTCTCCAGGCGG - Intronic
1168848757 20:962281-962303 GCAGTGGCTCCTCCTCAGAGAGG - Intronic
1169065847 20:2693687-2693709 GCAGCAGCGGCTCCTCCTTCAGG - Exonic
1171400367 20:24869121-24869143 TCAGCACTTCCTCCTCTGTGTGG - Intergenic
1172233381 20:33352398-33352420 GCAGCAGCTCCTCCTTCACCAGG + Intergenic
1175502517 20:59460524-59460546 GCAGCAGCTCCTCCAGCCTGAGG + Intergenic
1175809775 20:61851779-61851801 CAAGCAGCCCCTCCTCCGAGAGG + Intronic
1175880380 20:62254582-62254604 GCAGCTGCTGCTGCCCCGTGCGG + Intronic
1176018097 20:62947760-62947782 GGAGCAGCTCCACCTCCCCGAGG - Exonic
1176083804 20:63286787-63286809 GCGCCAGCTCCTCCTACGTGGGG - Intronic
1177249210 21:18570331-18570353 GCAGCAGCAGTTCCTCCCTGCGG - Intergenic
1178597684 21:33969581-33969603 GCAGTGGCTCCTCTTCCCTGTGG + Intergenic
1179479188 21:41666896-41666918 GCAGGAGCCCCACCTCCCTGCGG - Intergenic
1180048152 21:45319085-45319107 GCAGCAGCCCTTCCCCCTTGGGG - Intergenic
1180231759 21:46430594-46430616 GCAGCTGCTCCTCCTCCAGCTGG - Exonic
1180614997 22:17121025-17121047 GCAGCCCCTCTTCCTCCGCGGGG - Exonic
1180948570 22:19710116-19710138 GCATCAGCTCCTGCTGGGTGGGG - Intergenic
1181005542 22:20011717-20011739 GCAGCATCTCCTCTTCCTCGGGG - Intronic
1182260448 22:29070354-29070376 GCAGCAGCCCCTCCTCCAATTGG - Intergenic
1183055562 22:35303236-35303258 GCATCATCACCTCCTCCCTGAGG + Intronic
1183328399 22:37206594-37206616 GCAGCAGCTCCTACCCCAAGAGG - Exonic
1183454781 22:37916677-37916699 GCTGCAGCTCCTCCAGGGTGGGG - Intronic
1183988792 22:41584339-41584361 GCAGCAGCTCCTCCCCCAGGTGG + Exonic
1184230920 22:43158057-43158079 GCAGCCGCCCCTTCTCCCTGGGG + Intronic
1184690071 22:46113533-46113555 GCAGCAGCTGCCCCTTCCTGGGG + Intronic
1184784675 22:46665916-46665938 CCAGCAGCTCCTTCCCCGGGCGG + Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185347315 22:50316282-50316304 GCAGCAGCTTCTCCTTGGGGAGG - Intronic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
953424324 3:42780867-42780889 GCAGCAGTTCCTCATCTCTGAGG + Intronic
953875035 3:46661885-46661907 GCAGCTGTTGCTCCTCAGTGTGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954264229 3:49460628-49460650 GCAGCTGCTCCTCCTACCTTGGG - Intergenic
954881037 3:53836213-53836235 GCAGCTGCTCCTCCTCTCTCAGG + Intronic
956684884 3:71816928-71816950 GCAGAATCCCCTCCTCCGCGGGG + Intergenic
959067873 3:101676479-101676501 GCAGCAGCTCCGCCGCCCAGAGG + Intronic
960821595 3:121738733-121738755 TCAGCAGATTCTCCTCAGTGTGG - Intronic
961405503 3:126676962-126676984 GCAGCCTCTCCTCCTTGGTGGGG + Intergenic
961478108 3:127161165-127161187 GCAGCAGCTCTTCCCCTATGTGG - Intergenic
962628138 3:137248164-137248186 GCAGCAGCCCCACCTCCCTGGGG - Intergenic
964182846 3:153908553-153908575 GGAGCAACTACTCCTCAGTGTGG + Intergenic
967889911 3:194357649-194357671 CCTGGAGCTCCTCCTGCGTGTGG - Intronic
968622890 4:1611642-1611664 GCAGCAGAGGCGCCTCCGTGGGG + Intergenic
968646685 4:1744601-1744623 GCTGCAGCTTCTCCTCCGCGTGG - Exonic
969329862 4:6468173-6468195 GCAGCATCCCCTCTTCAGTGTGG + Intronic
970100425 4:12515085-12515107 TCAGCAGCTCCCCCTCACTGTGG - Intergenic
972351001 4:38236195-38236217 GCAGCAGCTGCTTCACGGTGGGG - Intergenic
972841401 4:42933875-42933897 ACATCAGCTCCTCCTTCTTGGGG - Intronic
973807966 4:54543959-54543981 GCAGCAGCTTCTGCTCTCTGCGG + Intergenic
973822422 4:54674217-54674239 CCAGCAGCTTCTCCCCAGTGTGG + Intronic
973982006 4:56315050-56315072 ACCGCAGCTCCTCCACCTTGCGG - Exonic
976297247 4:83484863-83484885 GCCGCCGCGCCTCCTCCCTGCGG - Intronic
977007947 4:91595787-91595809 GCAGCACCTTGTCCTCAGTGTGG + Intronic
982066185 4:151656840-151656862 GCAGTACCTGCTCTTCCGTGTGG + Exonic
984642015 4:182177121-182177143 ACAGCGGCTTCTGCTCCGTGCGG - Intronic
985264123 4:188142311-188142333 GCAGCTGCTCCTCTTCCTTCAGG - Exonic
985556169 5:559010-559032 GCGGCGGCCCATCCTCCGTGAGG - Intergenic
985556189 5:559083-559105 GCGGCGGCCCATCCTCCGTGAGG - Intergenic
985556208 5:559156-559178 GGGGCAGCCCATCCTCCGTGAGG - Intergenic
985628957 5:1005041-1005063 GCCGCACCTCCTCCTCCATCCGG + Intergenic
986738774 5:10687612-10687634 GAAGCAACTCCTCATCCCTGAGG - Intronic
988067325 5:26237743-26237765 GCAGCAGCTCCTCATCCTGCGGG + Intergenic
990376109 5:55172940-55172962 ACAGCATCTCCTCTTCCGTGCGG + Exonic
991215628 5:64155145-64155167 CCAATAGCTCCTCCTCCCTGGGG - Intergenic
991227774 5:64292754-64292776 TCAGCAGCCCCTCCCCCATGGGG + Intronic
991281804 5:64923074-64923096 GCTGCAGCACCTCCTACCTGTGG - Intronic
992151575 5:73909687-73909709 GCAGCAGCTCCTCCTGCGACTGG - Exonic
992615194 5:78540741-78540763 ACAACAGCTCCTCCTCCTTGGGG + Intronic
996304831 5:122035224-122035246 GCAGCAGCCCCTCCTCTTTCAGG + Intronic
997177696 5:131796697-131796719 GCAGCATCTGGTCCTCGGTGGGG - Intronic
997447636 5:133953004-133953026 GCAGCAGCTTCTACCCCATGAGG - Intergenic
997609991 5:135209197-135209219 GCCTCATCTCCTCCTCAGTGAGG + Intronic
998279117 5:140787862-140787884 GCAGCAGCTCCAGCTCCTCGTGG - Exonic
998279959 5:140796536-140796558 GCAGCAGCTCCACTTCCTCGTGG - Exonic
998282305 5:140823344-140823366 GCAGCAGCTCCACTTCCTCGTGG - Exonic
998287467 5:140877044-140877066 GCAGCAGCTCCAGCTCCTCGTGG - Exonic
1000338510 5:160259667-160259689 TCAGCAGCTCCTTCTTGGTGAGG + Exonic
1001246048 5:170106293-170106315 TCATCAGCTCCTCCTGCGAGGGG - Exonic
1002138939 5:177126867-177126889 GCTGCACCTCCTCCTGGGTGAGG - Intergenic
1003118673 6:3301615-3301637 GCTGCAGCTCCTCCTCTGCTGGG - Intronic
1004193745 6:13486710-13486732 GCAGCAGCACCTCATCAATGCGG + Exonic
1005364987 6:25067719-25067741 GCAGCAGCTCCTGTTCCTTCTGG - Intergenic
1006122492 6:31815791-31815813 GCACCACCTACTCCTGCGTGGGG + Exonic
1006122690 6:31816785-31816807 GCAGCAGCTTCTGCACCTTGGGG - Exonic
1006124355 6:31827985-31828007 GCACCACCTACTCCTGCGTGGGG + Exonic
1006124553 6:31828979-31829001 GCAGCAGCTTCTGCACCTTGGGG - Exonic
1006851543 6:37102405-37102427 ACATCAGCTGCTCCTCCCTGGGG - Intergenic
1007762061 6:44139002-44139024 GCAGCAGCACCTCATGGGTGTGG - Intronic
1017031422 6:150226447-150226469 GAAGCAGCTCCTCCTAAGTCTGG - Intronic
1017803369 6:157920421-157920443 GCAGCTGCAGCTTCTCCGTGAGG - Intronic
1018979565 6:168592289-168592311 GGAGCTCCTCCTCCTCCCTGAGG + Intronic
1019020870 6:168916690-168916712 GGAGCACCTCCTCATCCCTGAGG + Intergenic
1019090741 6:169530682-169530704 GCAGCAGCTCAGCCTTCTTGAGG + Intronic
1019368460 7:647431-647453 CCAGCAGCTCCCACTCCGTCCGG + Intronic
1019405606 7:882417-882439 GCAGCAGTTCCTGGTTCGTGTGG + Intronic
1020120795 7:5502119-5502141 GCAGCAGCTGCTCCACCGGGAGG + Intronic
1022842978 7:34182258-34182280 GCAGCAGCCCCACCTCCTTGGGG - Intergenic
1024557092 7:50613262-50613284 GCAGCAGCCCCTCCTCTCAGTGG - Intronic
1028018635 7:85744459-85744481 CCAATAGCTCCTCCTCCTTGTGG + Intergenic
1030008938 7:105146501-105146523 GCAGGTGCTCCTCCTCCTTCAGG - Exonic
1030128883 7:106180062-106180084 GCAGCAGCGTCACCTCTGTGTGG + Intergenic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1035565505 8:638157-638179 GCAGAAGCTCCTACCACGTGTGG + Intronic
1035924791 8:3715916-3715938 GCTGCAGCCCCTACTCCCTGTGG + Intronic
1037403321 8:18515537-18515559 GCAGCATCTCCTTCTCTGAGGGG + Intergenic
1037656061 8:20885176-20885198 GCAGCAGCTGCTTCTGCCTGCGG - Intergenic
1038429842 8:27491280-27491302 GCGCCAGGGCCTCCTCCGTGCGG - Exonic
1039973355 8:42338792-42338814 GCAGCGGGTCGTCTTCCGTGGGG + Intronic
1044287665 8:90427943-90427965 GCAGCAGCACCTTCTCAGTAAGG - Intergenic
1044392138 8:91663612-91663634 ACAGCAGCTGTTCCTCCCTGTGG - Intergenic
1047433609 8:124815735-124815757 TCAGTAGCTCCTCCTCTGTTGGG + Intergenic
1049080468 8:140439082-140439104 GCAGCAGCTCCACCGACATGTGG + Exonic
1049164718 8:141118772-141118794 GAAGCAGTTCCTCCTCGGAGTGG + Intronic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049377155 8:142294736-142294758 GCAGCAGCAGCTCCTCTGTAGGG - Intronic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1049659891 8:143815246-143815268 GCAGCAGCTCCTCCAGGCTGCGG + Exonic
1049668588 8:143859645-143859667 GCAGCAGCTGCACGTACGTGAGG + Exonic
1049669004 8:143861247-143861269 GCAGCAGCTGCACGTACGTGAGG + Exonic
1049669419 8:143862849-143862871 GCAGCAGCTGCACGTACGTGAGG + Exonic
1049669830 8:143864442-143864464 GCAGCAGCTGCACGTACGTGAGG + Exonic
1049670246 8:143866050-143866072 GCAGCAGCTGCACGTACGTGAGG + Exonic
1050455752 9:5832730-5832752 GCAGCAGCTCGTGCTACGCGGGG - Exonic
1050526967 9:6554687-6554709 CCAGGACCACCTCCTCCGTGGGG + Exonic
1052226596 9:26096453-26096475 TCAGCAACTACTCCTCAGTGTGG + Intergenic
1053014703 9:34655210-34655232 GCAGCTGCTGCTCATCTGTGGGG - Exonic
1054948493 9:70823072-70823094 GCAGCAGCCTAGCCTCCGTGAGG - Intronic
1056787285 9:89602410-89602432 GCCTCAGCCCCTCCTCCGAGAGG - Intergenic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1060966303 9:127714180-127714202 GCAGCAGCTCCTGCTCAGCAGGG + Exonic
1060978731 9:127780348-127780370 ACAGCAGCTCCCCCTCCATGGGG + Intergenic
1061406306 9:130394671-130394693 GCTGAAGCACCTCCTCTGTGTGG + Intronic
1061627489 9:131849632-131849654 GCTGCAGCTCCTCATCCGAGAGG + Intergenic
1061919091 9:133772361-133772383 GGAGCCTCTCCTCCTCCCTGTGG + Intronic
1061952089 9:133942338-133942360 GCAGCAACAGCTCCTTCGTGGGG - Intronic
1062461605 9:136664728-136664750 GCAGGAGCTGCTCCTCCGGGTGG - Exonic
1062568836 9:137175236-137175258 CCAGCAGCTCCTCCTCCTTCTGG + Exonic
1062727390 9:138083345-138083367 GAAGCAGCTCCACCTCCACGTGG - Intronic
1187228071 X:17393544-17393566 GCTTCAGCTCTTCCTCTGTGAGG + Intronic
1187271939 X:17787857-17787879 GCAGCAGCACCTCCACCTGGAGG - Intergenic
1187371672 X:18714225-18714247 GAAGCAGCTCATGCTCAGTGTGG + Intronic
1187524539 X:20042403-20042425 GCAGCTCCTGCTCCCCCGTGAGG - Intronic
1189573347 X:42323109-42323131 GCAGCAGCTCTTCCTGAGTGAGG + Intergenic
1192153011 X:68723721-68723743 GCAGCAGATCCTCATCCCAGAGG - Exonic
1193108309 X:77703424-77703446 GCATCAGCTCTTTCTCTGTGAGG + Intronic
1193809486 X:86034982-86035004 CCAGCAGTTACTCCTCAGTGTGG - Intronic
1196787439 X:119433263-119433285 GCAGAATCTCCTCTTCCTTGAGG + Intronic
1200111599 X:153743570-153743592 GCCGCTGCTTCTCCTCCGTCAGG - Exonic
1201377915 Y:13342175-13342197 GCAGCAGTTCCACCACTGTGGGG - Intronic