ID: 1185066619

View in Genome Browser
Species Human (GRCh38)
Location 22:48635474-48635496
Sequence GCAGCAGCTCCTCCTCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185066611_1185066619 5 Left 1185066611 22:48635446-48635468 CCCTACCCAGGGGGCCCAGAACC No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066604_1185066619 17 Left 1185066604 22:48635434-48635456 CCGTCTCCCAGTCCCTACCCAGG No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066610_1185066619 10 Left 1185066610 22:48635441-48635463 CCAGTCCCTACCCAGGGGGCCCA No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066616_1185066619 -10 Left 1185066616 22:48635461-48635483 CCAGAACCTTCCAGCAGCAGCTC No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066614_1185066619 -1 Left 1185066614 22:48635452-48635474 CCAGGGGGCCCAGAACCTTCCAG No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066615_1185066619 -9 Left 1185066615 22:48635460-48635482 CCCAGAACCTTCCAGCAGCAGCT No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066603_1185066619 27 Left 1185066603 22:48635424-48635446 CCTCTAGCAACCGTCTCCCAGTC No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066609_1185066619 11 Left 1185066609 22:48635440-48635462 CCCAGTCCCTACCCAGGGGGCCC No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066602_1185066619 30 Left 1185066602 22:48635421-48635443 CCGCCTCTAGCAACCGTCTCCCA No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066612_1185066619 4 Left 1185066612 22:48635447-48635469 CCTACCCAGGGGGCCCAGAACCT No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data
1185066613_1185066619 0 Left 1185066613 22:48635451-48635473 CCCAGGGGGCCCAGAACCTTCCA No data
Right 1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185066619 Original CRISPR GCAGCAGCTCCTCCTCCGTG AGG Intronic