ID: 1185066626

View in Genome Browser
Species Human (GRCh38)
Location 22:48635509-48635531
Sequence ATGCGCTGCGCAGTGACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185066626_1185066630 15 Left 1185066626 22:48635509-48635531 CCAGGCGTCACTGCGCAGCGCAT 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1185066630 22:48635547-48635569 GCAGCCCCTGCGTGTCTGTCTGG 0: 1
1: 0
2: 2
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185066626 Original CRISPR ATGCGCTGCGCAGTGACGCC TGG (reversed) Intronic
905472549 1:38204456-38204478 ATGCTCTGAGCATTGACGCGGGG + Intergenic
913611968 1:120517281-120517303 GTGCTCTGAGCAGGGACGCCGGG - Intergenic
914579222 1:149004958-149004980 GTGCTCTGAGCAGGGACGCCGGG + Exonic
922757286 1:228103375-228103397 GTGCGCTGCGCAGAGGCGCGCGG - Exonic
1073063392 10:100745153-100745175 GCGCGCTGCGCTGTGAAGCCGGG - Intronic
1073414290 10:103368330-103368352 AGGCGCTGCGCCGTGAGGCCGGG + Exonic
1077253166 11:1569615-1569637 ATGTGCTGCACAGAGACGCTGGG - Intronic
1078464994 11:11543613-11543635 ATGTGCTGGGCACTGAAGCCAGG - Intronic
1080458366 11:32434652-32434674 ACGCGCGGGGCAGTGGCGCCAGG - Intronic
1082626299 11:55491057-55491079 ATGAGCTGCTCTGTGTCGCCAGG + Intergenic
1084858833 11:72005204-72005226 AGGCCCTGCACAGTGACCCCAGG + Intronic
1085031512 11:73273739-73273761 ATGGGCTGCACAGAGAAGCCAGG - Intronic
1113782504 13:112984823-112984845 ATGAGCTGCACAGAGACACCGGG - Intronic
1116826282 14:49676651-49676673 AGGCACTGCGCACTGAGGCCAGG + Intronic
1129383183 15:75180700-75180722 AGGTGCTGGGCAGTGAGGCCCGG - Intergenic
1133601381 16:7343223-7343245 ATAAGCTGCCCAGTGACGGCTGG - Intronic
1141996039 16:87636912-87636934 ACGCGCAGCGCAGTGGGGCCTGG + Intronic
1141999306 16:87655045-87655067 AGGCGCTGCCCACTGACCCCAGG - Intronic
1142235791 16:88921919-88921941 ATGCGCCGCGCAGAGAGGTCTGG - Intronic
1145750091 17:27349352-27349374 AGGCTCTGCGCAGGGCCGCCCGG + Intergenic
1154142157 18:11833707-11833729 ATGTGCTGGGCAGAGAGGCCAGG - Intronic
1163399306 19:17082462-17082484 ATGCTCTGAGCAGTGAGCCCAGG - Intronic
1166502893 19:43354263-43354285 ATCCGGTGCTCAGTGACGCGGGG - Exonic
1167076963 19:47256229-47256251 AAGCACTGGGCACTGACGCCTGG - Intronic
947916147 2:233833056-233833078 ATGCCCTGGGCAGTGATGGCAGG - Intronic
948465528 2:238150037-238150059 GTCAGCTGAGCAGTGACGCCAGG - Intronic
1175823700 20:61925150-61925172 ATGGGCTGGGCAGAGACGGCAGG + Intronic
1185013156 22:48327672-48327694 ATGAGCGGCGCAGTGAAGCCTGG - Intergenic
1185066626 22:48635509-48635531 ATGCGCTGCGCAGTGACGCCTGG - Intronic
1185187221 22:49408290-49408312 AGGCCCTGCTCAGTGACCCCAGG - Intergenic
955403704 3:58611615-58611637 CTGCACTGGGCAGTGACACCTGG + Intronic
969134161 4:5016611-5016633 ATGAGCTGCGCATTGATGCAGGG - Intronic
997794479 5:136795006-136795028 ATGAGCTGGGCTGTGACTCCAGG - Intergenic
1010001712 6:70955948-70955970 TTGCGCTGCTCAGTGGCGCGCGG + Exonic
1017264646 6:152428356-152428378 TCGCGCTGCTCAGTGACTCCAGG + Exonic
1019708354 7:2507105-2507127 ATGCACTGGGCAGGGATGCCAGG + Intergenic
1024945682 7:54805431-54805453 ATGCCCTGCCCAGTGCTGCCTGG + Intergenic
1027263345 7:76480430-76480452 AGGCGCTGGGCAATGACCCCGGG + Exonic
1027314723 7:76978537-76978559 AGGCGCTGGGCAATGACCCCGGG + Intergenic
1037759403 8:21732105-21732127 ATGTTCTATGCAGTGACGCCAGG - Intronic
1038516984 8:28195692-28195714 ATGCGCTGAGCAGTCATGCCTGG + Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1057900384 9:98943813-98943835 GCGCGCTGCGCACTCACGCCCGG - Exonic
1061975928 9:134068053-134068075 ATGCGCTGCGCCGCGGCGCCTGG + Intronic
1199846235 X:151694775-151694797 TTGGGCTGCGCAGGGACGCCTGG + Intergenic
1200136174 X:153875841-153875863 CTGTGCTGCGCGGTGCCGCCGGG - Exonic