ID: 1185067772

View in Genome Browser
Species Human (GRCh38)
Location 22:48640601-48640623
Sequence CATTTCTTGCAGAGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185067772 Original CRISPR CATTTCTTGCAGAGGCTGGG CGG Intronic
900285810 1:1899778-1899800 CATTTCCTGCCATGGCTGGGTGG + Intergenic
900331784 1:2138495-2138517 CACTTCTTGCAGAGGAGGGAAGG + Intronic
900332619 1:2143884-2143906 CGTGGCTTGCAGGGGCTGGGGGG - Intronic
900860594 1:5226547-5226569 CATTGTTTGCAAAGGCTTGGAGG - Intergenic
900898536 1:5501405-5501427 GACTTCTGCCAGAGGCTGGGCGG - Intergenic
902207923 1:14883259-14883281 CTTTTCTTGCCCAGGCTGGAGGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
902999101 1:20252014-20252036 CATTCCTGGCAGAGGCAGTGTGG - Intergenic
903403721 1:23078973-23078995 CACATCCTGCAGAGGTTGGGTGG - Exonic
904396754 1:30227524-30227546 CTTTCCTTGGAAAGGCTGGGAGG - Intergenic
905030340 1:34878772-34878794 CAATTTTTCCAGAAGCTGGGTGG + Intronic
905689916 1:39935466-39935488 CATTTTTTGCACAGGATAGGTGG + Intergenic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG + Intergenic
908524275 1:64972826-64972848 AATTATTTGCATAGGCTGGGTGG + Intergenic
908829944 1:68168768-68168790 TATGTCTGCCAGAGGCTGGGAGG - Intronic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG + Exonic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
919867273 1:201791957-201791979 CATGTCTGGGAGATGCTGGGGGG + Intronic
920208486 1:204311071-204311093 CTTTTCCTGCACCGGCTGGGAGG - Intronic
921188896 1:212692777-212692799 CATTTCTTGCATATCCTGAGGGG - Intronic
922236565 1:223726762-223726784 CATTTGTATCAGGGGCTGGGAGG - Intronic
1063195077 10:3734391-3734413 CAGGTCTTGCAGAGGATGGCTGG + Intergenic
1065715258 10:28560640-28560662 AATTTCTTTAAGAGTCTGGGTGG - Intronic
1068064426 10:52110543-52110565 CATGTTGTGCAGAGGCAGGGAGG + Intronic
1068501168 10:57841140-57841162 CTTTTCTTGTAAATGCTGGGTGG - Intergenic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1071828669 10:89350622-89350644 CATTTCTTGCAGGGGGTTGGGGG + Intronic
1074310004 10:112313908-112313930 CATTTCCTTCAGAGGCAGAGAGG - Intergenic
1074389109 10:113042184-113042206 CATTCCTTCCAGAGCCTGTGTGG + Intronic
1074807899 10:117072429-117072451 CACTTCTTTCAGAGGGTGTGTGG - Intronic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1076206352 10:128607414-128607436 AATTTCCTGCAGGGGCTGGTGGG - Intergenic
1076436960 10:130453127-130453149 CAAAGCTTGCAGAGGCTGGCTGG - Intergenic
1076705110 10:132297218-132297240 CATGTCCTGCAGAGGGTGTGGGG - Intronic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076900883 10:133336797-133336819 CATTTCTTGCAGAATGTGGGCGG - Intronic
1077296690 11:1829691-1829713 CATGTCTTGAAGTGTCTGGGTGG - Intronic
1078236537 11:9490321-9490343 CATTTGTTACCCAGGCTGGGTGG + Intronic
1081623007 11:44630230-44630252 CAGTTCTTGCCCAGGCTGGAGGG + Intergenic
1081807686 11:45899406-45899428 CAGCTCTCTCAGAGGCTGGGAGG + Intronic
1084574815 11:69982341-69982363 GGGTTCTGGCAGAGGCTGGGTGG - Intergenic
1085373248 11:76031705-76031727 TAATGCTTGCAGGGGCTGGGGGG + Intronic
1085980682 11:81720030-81720052 CATTTCTTGTAGAGAATGTGTGG - Intergenic
1093176619 12:15919950-15919972 CATTTCTTTCTCAGGCTGTGGGG - Intronic
1093952640 12:25181289-25181311 CATTTTTTGCAGAGGTGGGGGGG + Intronic
1095728695 12:45480730-45480752 TATTTGTTGCAGGGGTTGGGAGG - Intergenic
1096574606 12:52544820-52544842 CTTTTCTTGGAGAAGCTGAGTGG + Intronic
1097042439 12:56163851-56163873 CATGGCATGCAGTGGCTGGGTGG + Intronic
1100591228 12:96031664-96031686 CCTTTTTTGCACAGGCTGGTAGG + Intronic
1101322859 12:103688617-103688639 CATTTGTTGCAATGGCTGGCTGG - Intronic
1101940303 12:109094887-109094909 CATTTCTCATAGAGGCTGAGAGG - Intergenic
1103605674 12:122084345-122084367 CATTGCTTGTAGACGCTGGTTGG + Intronic
1104236551 12:126943925-126943947 CAGTTGTGGCAGAGCCTGGGAGG + Intergenic
1104494217 12:129221524-129221546 AATTTCCTCCATAGGCTGGGTGG + Intronic
1104540056 12:129655675-129655697 ACTTTGTTGCAGTGGCTGGGAGG - Intronic
1105316335 13:19268109-19268131 GCTTTCTTGCTGAGGCTGTGGGG - Intergenic
1105500348 13:20966396-20966418 CATTGCTGGCACAGGTTGGGTGG - Intergenic
1105888971 13:24668491-24668513 CACTGCTTGCTGAGGCTGAGGGG + Intergenic
1106394692 13:29368313-29368335 CACTTCCTGGAGAGGATGGGTGG - Intronic
1108035963 13:46290959-46290981 GATTTCATGCAGAGGCAGGGAGG + Intergenic
1109197842 13:59398340-59398362 CCTTTTTTCCAGAGGCTGGCTGG - Intergenic
1110827609 13:79990842-79990864 CATTCCTTCCAGAAGCTTGGGGG - Intergenic
1112521322 13:100097846-100097868 TATTTTTTGTAGAGACTGGGCGG - Intronic
1114257737 14:21017402-21017424 CATCTCTTCCAGGAGCTGGGGGG + Exonic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1116077618 14:40131480-40131502 AAATTCTTGCAGAGGCTTAGAGG + Intergenic
1117309075 14:54504272-54504294 CATTTCTTGGCCAGGCTCGGTGG + Intergenic
1117415405 14:55490883-55490905 AATTTCTTGTAGAGATTGGGGGG + Intergenic
1118734290 14:68690867-68690889 CATGCCTTTCAGAGGGTGGGGGG - Intronic
1119480014 14:74953263-74953285 CACGTCTTGGAGAGGCAGGGAGG + Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122768781 14:104087845-104087867 CATTTCTGAAAGAGGCTGTGAGG + Intronic
1126572896 15:50170498-50170520 CAGTTCTTGTGGAGGGTGGGGGG - Intronic
1128082695 15:64865776-64865798 CATTTCCTGCAGGACCTGGGTGG - Exonic
1128559331 15:68654391-68654413 CATTCCTTGCAGAGCCAGGGAGG + Intronic
1132292857 15:100715392-100715414 CTTCTCCAGCAGAGGCTGGGAGG - Intergenic
1132437512 15:101821175-101821197 CCTTTCTTGGAGGGGGTGGGAGG + Intergenic
1132525424 16:411798-411820 CATTTCTGGCAGGTGCTGGGTGG + Intronic
1133850878 16:9502242-9502264 CATTTCTTACATTTGCTGGGAGG + Intergenic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1134286637 16:12867686-12867708 CATTTTTTGCAGAGATGGGGGGG + Intergenic
1134442694 16:14308649-14308671 TATTTTTTGCAGAGACTTGGGGG + Intergenic
1135635091 16:24068838-24068860 CATTTCTTTCAGATCCTGGTAGG + Intronic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1137292389 16:47060811-47060833 CAATTCTTCCAGGGGCAGGGTGG + Intergenic
1137961921 16:52890108-52890130 CATTTATTGAAGAGACTAGGGGG - Intergenic
1138485712 16:57341840-57341862 CATTATTTGCAGAGCCTGGCTGG + Intergenic
1139719342 16:68840318-68840340 GATTTCTTGCCCAGGGTGGGGGG - Intergenic
1143325898 17:6098128-6098150 TATTTTTTGCAGAGACAGGGGGG + Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144761123 17:17708072-17708094 CATTCCTTGGAGATGGTGGGTGG - Intronic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147041636 17:37723766-37723788 CATTCCTTGCAGAGACTTGGGGG - Intronic
1147425923 17:40345813-40345835 TAACTCTTGCAGAGGCTGTGAGG + Intronic
1147428125 17:40355997-40356019 CCTTTCCTGCAGGGGCTGAGCGG + Exonic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1149535699 17:57431791-57431813 GATTTGTTGGGGAGGCTGGGAGG + Intronic
1151192617 17:72409423-72409445 CTTTTCTTGCTGAGGCTGCAGGG - Intergenic
1151480941 17:74369759-74369781 CGTTTCCTGCTGAGGCCGGGGGG - Intronic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1151733561 17:75925080-75925102 CCTTTCCTTCTGAGGCTGGGTGG + Intronic
1152252861 17:79220815-79220837 CAGCTCCTGCAGAGGCGGGGCGG + Intronic
1152830676 17:82495393-82495415 TATTTTTTGTAGAGGCCGGGGGG - Intergenic
1152882953 17:82830755-82830777 GATTTCTTGGAGAGGTTGAGGGG + Exonic
1153035057 18:754017-754039 CATTTCTCACAGGGACTGGGTGG + Intronic
1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG + Intronic
1159486816 18:69071763-69071785 CATTTTATGCAGACGCTCGGAGG + Intergenic
1160212190 18:76890572-76890594 AATTTCTTGAAAAGGCTGTGAGG - Intronic
1160259089 18:77274365-77274387 CTTTGCCTGCAGAGCCTGGGTGG - Exonic
1161045845 19:2134240-2134262 TATTTTTTGTAGAGGCAGGGAGG - Intronic
1161054310 19:2182292-2182314 CAGTGCTTTGAGAGGCTGGGAGG + Intronic
1161673016 19:5624577-5624599 CACTGCCTGCAGGGGCTGGGGGG - Intronic
1161946292 19:7439284-7439306 ATTTTCTTGTAGAGGTTGGGGGG - Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1163301672 19:16451245-16451267 CAGTTGTTGGAGAGTCTGGGCGG - Intronic
1163312284 19:16521707-16521729 CACTCCTTGCAGACCCTGGGTGG - Intronic
1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG + Intronic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1164805441 19:31112729-31112751 CATTTGATGCAGAGTCTAGGCGG + Intergenic
1165821524 19:38679380-38679402 CATATATTGCAGAGGTTGAGGGG - Intronic
1167172842 19:47844823-47844845 CAGCACTTGCAGAGGCTGAGGGG - Intergenic
1168354385 19:55692450-55692472 CAGGTCTGGCAGAGGCTGCGGGG + Intronic
1168570008 19:57458812-57458834 CACTTCTTTCTGAGGCTAGGAGG - Intronic
925736629 2:6969444-6969466 CAGTTCCTTCTGAGGCTGGGAGG - Intronic
925992447 2:9264325-9264347 CATGTCTTCCAGAGACTGGGGGG + Intronic
926054296 2:9765375-9765397 GAGTTTTAGCAGAGGCTGGGTGG + Intergenic
926056348 2:9776256-9776278 CATCTCTAGCCAAGGCTGGGGGG - Intergenic
926130253 2:10298581-10298603 TATTTCTTCCAGAGCCTGTGTGG + Intergenic
926356246 2:12043322-12043344 CCTCTCTTGCCCAGGCTGGGGGG - Intergenic
926385559 2:12332664-12332686 CCTTTCTTGCTGAGGTTGTGGGG + Intergenic
926743012 2:16127706-16127728 CATGTCTCGGAGAGGCTGTGTGG + Intergenic
926913373 2:17871752-17871774 CTTTTCTTTCAGAGGATAGGGGG + Intergenic
929039920 2:37734310-37734332 GTTTTCTTCCAGATGCTGGGAGG + Intronic
933040478 2:77458673-77458695 CCTTCCTTGCAGAGGTTCGGTGG + Intronic
933119148 2:78514341-78514363 CTTTTCTTGCAGATGTTAGGAGG - Intergenic
933402662 2:81818830-81818852 CCTTTCTTGCAGGGGCAGGGAGG + Intergenic
935169186 2:100597285-100597307 CATTGCTTGAAGACCCTGGGAGG + Intergenic
936026184 2:109032679-109032701 CACCTCTTGCACAGGCTGGTGGG + Intergenic
937358408 2:121212579-121212601 CATGGCTTGTAGTGGCTGGGTGG - Intergenic
940732713 2:157412317-157412339 CTTTTCTTGCCCAGGCTGGAGGG + Intergenic
941243800 2:163072309-163072331 CTTTTCTTGTAAATGCTGGGCGG - Intergenic
941605029 2:167586044-167586066 CATTTTTTGGAGTGGCTGGTAGG + Intergenic
942140434 2:172972141-172972163 GCTGTCCTGCAGAGGCTGGGTGG + Intronic
942441421 2:176041291-176041313 AAATTCTTGCAGAAGCTGCGTGG + Intergenic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
944580692 2:201130156-201130178 CAACTCTTCCTGAGGCTGGGTGG + Intronic
945423126 2:209663547-209663569 CAATTTTTGCAAATGCTGGGTGG + Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
947107379 2:226681654-226681676 CATTTCTGGGAGTGTCTGGGAGG - Intergenic
947532973 2:230924473-230924495 TGTCTCTTGGAGAGGCTGGGCGG - Intronic
948051513 2:234982648-234982670 CAGTTTTTGCACAGGCAGGGAGG + Intronic
948395669 2:237643260-237643282 CATTTCTAGCAAATTCTGGGTGG - Intronic
1169394927 20:5220620-5220642 CATTGCTTCCTGAGGCTTGGGGG - Intergenic
1170301285 20:14887018-14887040 GATTTTTGGCAGAGGATGGGAGG + Intronic
1170367140 20:15610348-15610370 GATTCCTTGCAGAGGCTCTGAGG + Intronic
1171051648 20:21865048-21865070 TTTCTATTGCAGAGGCTGGGGGG + Intergenic
1171296740 20:24023638-24023660 CAATTCTTGTAGGGGCTGAGAGG + Intergenic
1173170682 20:40721048-40721070 CACTTTTTGCATAGTCTGGGGGG + Intergenic
1173921644 20:46750615-46750637 ATTTTCCTGCAGAGGCTGAGCGG + Intergenic
1173941829 20:46917560-46917582 CATTCCTTGGAGATGCTGCGGGG + Intronic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1174869792 20:54172452-54172474 CATTTTCTGCAGAGGATTGGGGG - Intronic
1176095663 20:63343291-63343313 CATTGCCTGCAGAAGCCGGGCGG + Intronic
1179434448 21:41350569-41350591 CATTGATTGCAGAAGCTGTGCGG - Intronic
1180163110 21:46006810-46006832 CATGCCTGGCAGGGGCTGGGAGG + Intergenic
1180698463 22:17769202-17769224 CGTTTCTGCCAGGGGCTGGGTGG - Intronic
1182031415 22:27162208-27162230 CACTTCATGCACAAGCTGGGAGG + Intergenic
1182193447 22:28489033-28489055 CAGCACTTTCAGAGGCTGGGGGG + Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949661225 3:6281277-6281299 CATTTCTTGAAGATCTTGGGTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
952218063 3:31297274-31297296 CATTTCTTGGAGAGGCCTGGTGG - Intergenic
953716851 3:45322978-45323000 AATTTCTTGCAGAGAATGGGGGG - Intergenic
954873572 3:53785877-53785899 CACAACTTGCAGAGGCTGGAAGG - Intronic
956319170 3:67976373-67976395 AATTTCATGGAGAGGCTGGAAGG - Intergenic
957174287 3:76785726-76785748 CATTTCTGGCAGTGGCAAGGGGG - Intronic
957590113 3:82185881-82185903 CATTTCCACAAGAGGCTGGGTGG - Intergenic
958098895 3:88983514-88983536 CATTTCTAGCAGTGGTGGGGAGG - Intergenic
964242609 3:154614736-154614758 CACTTCTTGCAGAAACTGGAGGG + Intergenic
966077160 3:175951268-175951290 CATTTCTGGCAGAGGGTTGAAGG + Intergenic
967274332 3:187759106-187759128 CATTTGTTGCAGAGGTTGGAAGG - Intergenic
967305873 3:188058897-188058919 CATTTCTGGCATATTCTGGGGGG + Intergenic
969247978 4:5947900-5947922 GATCTCGTGCAGAGGCTGGCAGG - Intronic
970309676 4:14768855-14768877 CATTTGTAGCAGATGCTGCGGGG - Intergenic
970693930 4:18653654-18653676 CATTTCCTACAGAAGCTTGGAGG - Intergenic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
974267097 4:59599265-59599287 CATTTCTTGTAGAGTCTGGCTGG - Intergenic
975358347 4:73435009-73435031 CATTTTTTTTAGAGGGTGGGAGG + Intronic
978941948 4:114447600-114447622 CACTTGTGGCAGAAGCTGGGGGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
982224954 4:153156579-153156601 CATCTCTTGCAGGGGAGGGGAGG + Intronic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
985958796 5:3284048-3284070 CATTTCCTGGAGAGCCTGGCTGG + Intergenic
986011246 5:3717689-3717711 AATTTCTTGCTGAGGGCGGGGGG + Intergenic
987088537 5:14490590-14490612 CCTTTCTTGCACAGGCCAGGTGG + Intronic
991245134 5:64502584-64502606 TATTTCTTGCAGGAGCTGGGGGG - Intergenic
992541331 5:77767555-77767577 CATTTTTTGCTGGGGCTTGGGGG + Intronic
994164243 5:96592221-96592243 TATTTCTAGCAGAGACAGGGTGG - Intronic
995097764 5:108259544-108259566 CATTTCTAACTGAGGCTGTGTGG - Intronic
997552261 5:134763537-134763559 CATTTGTTACAGAGGCTTGGAGG - Intronic
999806397 5:155085441-155085463 CATTTCTAGCAGCTTCTGGGTGG - Intergenic
999889115 5:155957507-155957529 CATTTCTTTCAGAGGCTCTAGGG + Intronic
1001131665 5:169069426-169069448 CATTTGTTCCACAGGCAGGGAGG + Intronic
1001570549 5:172727748-172727770 CCTTTGCTGCAGAGGCTCGGGGG - Intergenic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002560595 5:180079488-180079510 CATTTAGTGCAGAGCCTGGGAGG - Intergenic
1003479410 6:6517426-6517448 TATTTCTTACAGAGGATGGATGG - Intergenic
1003664434 6:8097082-8097104 CATATCTTGGAGGGGCTGGTGGG + Intronic
1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG + Intergenic
1006498240 6:34439810-34439832 CAGGGCTGGCAGAGGCTGGGGGG - Intergenic
1006749274 6:36366496-36366518 CATTGCTTGGGAAGGCTGGGAGG - Exonic
1007060432 6:38935236-38935258 CATTTCTTACAGAAGCAGTGTGG + Intronic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1009697955 6:67134172-67134194 CATTTCTTGCACAGGCAGTAGGG + Intergenic
1014692189 6:124575540-124575562 CACTTCATGCAGAAGCAGGGTGG - Intronic
1015291809 6:131546162-131546184 CCTTTGTTGCAAGGGCTGGGTGG - Intergenic
1015300815 6:131651210-131651232 AATTACTTGCCGAGGCTGGGTGG - Intronic
1015612927 6:135045134-135045156 CATTACTTTCAAAGGGTGGGTGG + Intronic
1016057886 6:139597836-139597858 CATTTCTTTCAGAGGCCTTGGGG - Intergenic
1016088571 6:139946086-139946108 CATTTCTTGGCCAGGCTTGGTGG - Intergenic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1018711676 6:166501769-166501791 CTGTTCTTCCAGATGCTGGGAGG + Intronic
1021398782 7:20184400-20184422 AAATTGTTGCAGAGACTGGGAGG - Intronic
1027228193 7:76258034-76258056 CATCTGTGGCAGAGGCTGGCTGG + Intronic
1028333270 7:89622711-89622733 CATTCCTTGCAGAGACTGTGAGG + Intergenic
1029529974 7:101118867-101118889 TATTTTTTGTAGAGGTTGGGGGG + Intergenic
1029802722 7:102966531-102966553 AATGTCTTGCAGAAGCTGGCAGG + Intronic
1030710218 7:112740436-112740458 CTTGTCTTGCAGAGGGTGAGTGG + Intergenic
1031147706 7:118015368-118015390 CATTTCCTGTAGAGACTGGCAGG + Intergenic
1034110746 7:148535506-148535528 CATTTCTGCCAGAGCCTGGGGGG + Intergenic
1034594764 7:152179643-152179665 AATTTGTTGAAGAGGTTGGGGGG + Intronic
1036152174 8:6308830-6308852 GATTACTTACAGAGGCTGGAAGG - Intergenic
1037403052 8:18512939-18512961 CAGTTATTCCAGGGGCTGGGAGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038172955 8:25154831-25154853 CCTTTCTTGCAGAGGCCTTGTGG - Intergenic
1038671461 8:29586458-29586480 CATTCCTTCCAGAAGGTGGGAGG + Intergenic
1039299609 8:36195197-36195219 CTTTTCTTTCAGAAGTTGGGTGG + Intergenic
1042044861 8:64638747-64638769 AATTTGTTTCAGGGGCTGGGAGG + Intronic
1042127142 8:65549618-65549640 CATTTGTCACAGAGTCTGGGTGG - Intergenic
1042813539 8:72852629-72852651 CATTTTTTGCACAGGATGGCAGG + Intronic
1044725906 8:95193999-95194021 CATTCCTTCCAGAGGCTCCGGGG - Intergenic
1044865926 8:96571293-96571315 CATTTCAGGCAGAGGCAGAGCGG + Intronic
1045875588 8:106977255-106977277 TCTTTCTTGCAGAGGCAGAGAGG + Intergenic
1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG + Intergenic
1047850942 8:128857135-128857157 CATTTTTTGCGGAGGATGAGAGG - Intergenic
1050526482 9:6550904-6550926 CCTTTGTTGCAGATGATGGGAGG - Exonic
1052293890 9:26876102-26876124 CATTTCTTGCAGAGGATCCAGGG + Intronic
1054715050 9:68548493-68548515 AATTTCCTGCAGCAGCTGGGTGG + Intergenic
1054817840 9:69492571-69492593 CATTACTGGCTAAGGCTGGGGGG + Intronic
1056566584 9:87777948-87777970 CATTTTTTCCACAGACTGGGGGG + Intergenic
1057567952 9:96181544-96181566 CATCTCCTGCAGAGGCTGCAGGG - Intergenic
1057603438 9:96479997-96480019 TATTTTTTGTAGAGACTGGGTGG - Intronic
1059395944 9:114034235-114034257 CACCTCTTGGAGAGGTTGGGTGG - Intronic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1061599554 9:131658510-131658532 CATTCCTTCCAGAGGAAGGGTGG + Intronic
1062231932 9:135486698-135486720 CACTTCTTGGAGCAGCTGGGCGG + Exonic
1185477580 X:424660-424682 TATTTTTAGCAGAGGCGGGGGGG - Intergenic
1186475977 X:9857982-9858004 CAGCGCTCGCAGAGGCTGGGAGG - Intronic
1193693491 X:84678417-84678439 CATTTCTTGTACAGGAGGGGAGG + Intergenic
1194226688 X:91269104-91269126 CATTGTTGCCAGAGGCTGGGAGG - Intergenic
1195571464 X:106402371-106402393 CACTTCTTGCTGCAGCTGGGTGG + Intergenic
1195732543 X:107981363-107981385 GAGGTCTTGCAGGGGCTGGGAGG - Exonic
1198646447 X:138812080-138812102 TAGTGCTTGCAGGGGCTGGGAGG - Intronic
1198806749 X:140501728-140501750 CCTTTCTTGAAGAGGCGGAGTGG + Intergenic
1200842574 Y:7798112-7798134 CATTTCAGACAGAGGCTAGGTGG + Intergenic
1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG + Intergenic
1201594270 Y:15650479-15650501 CATTTTTTGATGAGGCTGGGAGG - Intergenic