ID: 1185068019

View in Genome Browser
Species Human (GRCh38)
Location 22:48641635-48641657
Sequence GTGTGTGAGGGGAGGGTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3003
Summary {0: 1, 1: 1, 2: 60, 3: 367, 4: 2574}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185068019_1185068031 25 Left 1185068019 22:48641635-48641657 CCGCACACCCTCCCCTCACACAC 0: 1
1: 1
2: 60
3: 367
4: 2574
Right 1185068031 22:48641683-48641705 TGCACACGGCCTCGCTAACTGGG 0: 1
1: 0
2: 0
3: 1
4: 95
1185068019_1185068030 24 Left 1185068019 22:48641635-48641657 CCGCACACCCTCCCCTCACACAC 0: 1
1: 1
2: 60
3: 367
4: 2574
Right 1185068030 22:48641682-48641704 GTGCACACGGCCTCGCTAACTGG 0: 1
1: 0
2: 1
3: 3
4: 39
1185068019_1185068029 11 Left 1185068019 22:48641635-48641657 CCGCACACCCTCCCCTCACACAC 0: 1
1: 1
2: 60
3: 367
4: 2574
Right 1185068029 22:48641669-48641691 CTCGCACACGCGTGTGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185068019 Original CRISPR GTGTGTGAGGGGAGGGTGTG CGG (reversed) Intronic
Too many off-targets to display for this crispr