ID: 1185068110

View in Genome Browser
Species Human (GRCh38)
Location 22:48642065-48642087
Sequence GAGGGGCCTGCACTTTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185068103_1185068110 8 Left 1185068103 22:48642034-48642056 CCAGCAGCATGCTGAGGGGGGCA 0: 1
1: 1
2: 2
3: 13
4: 194
Right 1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 182
1185068097_1185068110 29 Left 1185068097 22:48642013-48642035 CCTGCTGGCATCGTGGGTGGACC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185068110 Original CRISPR GAGGGGCCTGCACTTTTCTG AGG Intronic
900412031 1:2516927-2516949 GAGGGGCCCCCACCTTACTGAGG - Intronic
902158829 1:14512619-14512641 GATGGGCCTTAGCTTTTCTGGGG - Intergenic
902505557 1:16937489-16937511 GAGGAGCCGGGACTTGTCTGAGG + Intronic
903822069 1:26111014-26111036 GAGGCGCCTGCACCTGGCTGCGG - Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
904200882 1:28818388-28818410 CAGGGAGCTGCACTTGTCTGTGG - Intronic
904410255 1:30320728-30320750 GAGGGGCCTGTCCTTCTCCGGGG - Intergenic
907821245 1:57971789-57971811 GTGGGACCTGCCCTCTTCTGTGG - Intronic
909427808 1:75547366-75547388 GAGAGTTCTGCTCTTTTCTGTGG - Intronic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
912503431 1:110137621-110137643 GAGGTGGCTGAACCTTTCTGTGG - Intergenic
912545516 1:110448378-110448400 GAGGAGGCAGCACTTTGCTGGGG - Intergenic
912709810 1:111942297-111942319 GTGGGGCTTGCACTTTTGTGTGG + Intronic
915934342 1:160082009-160082031 TGGGGGACTGCACTTTTCTCAGG - Intronic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
917142749 1:171853834-171853856 GAGGGGACTGCAGGTTACTGAGG - Intronic
917573618 1:176296473-176296495 GAGGGGCACCCACCTTTCTGAGG + Intergenic
918109023 1:181439681-181439703 GAGAGGCTTGCCCTTTTGTGGGG - Intronic
918709341 1:187707060-187707082 GAGGGGCATGCTCTTTGCTTGGG + Intergenic
922586119 1:226736367-226736389 GCGGGGCCCGCCCCTTTCTGGGG + Exonic
923149007 1:231217524-231217546 GAGGAGCCACCACTTTCCTGGGG + Intronic
924518501 1:244785899-244785921 GCAGGGCCTGCAGTTTTCAGGGG - Intergenic
1062893480 10:1084598-1084620 GATGGACATTCACTTTTCTGTGG + Intronic
1064424084 10:15214552-15214574 CAGGGAGCTGCAGTTTTCTGTGG + Exonic
1067215680 10:44300662-44300684 CAGGGTCCTGCAACTTTCTGGGG + Intergenic
1067289758 10:44932323-44932345 GGGGGAGCTGGACTTTTCTGGGG - Intronic
1068176912 10:53472647-53472669 GAGAGGCATGCCCATTTCTGGGG - Intergenic
1070312434 10:75283510-75283532 GAGGGGCCTGCCTCTTCCTGAGG + Intergenic
1071866050 10:89733131-89733153 GAGGGGCATTCACTTGTCTAAGG + Intronic
1073764188 10:106664107-106664129 CAGGGGCCTGTTCATTTCTGTGG - Intronic
1075875684 10:125803876-125803898 GGAGGGCCTGCCCTTCTCTGTGG + Intronic
1077328998 11:1975815-1975837 GAGGGCCCTGCACAGCTCTGGGG - Intronic
1079077507 11:17393258-17393280 GTGGGGACTGCACTTTCCTGGGG + Intronic
1082734758 11:56844110-56844132 GAAGGTCTTGGACTTTTCTGAGG - Intergenic
1082985749 11:59169673-59169695 GAAAGGCCTGCTCTTGTCTGTGG + Intergenic
1083668904 11:64289638-64289660 GAGGGGCCTGCAGTTTGCAAGGG + Intergenic
1085511739 11:77091667-77091689 GAGGGGCCTGCTCTGTTCCCTGG + Intronic
1089401129 11:118165253-118165275 GAGGGTCCTGCCCTCTTCTCTGG - Exonic
1202811977 11_KI270721v1_random:30994-31016 GAGGGCCCTGCACAGCTCTGGGG - Intergenic
1091631119 12:2161636-2161658 GAGTCACTTGCACTTTTCTGGGG + Intronic
1092254065 12:6916730-6916752 GTGAGGCCTGCTCTTTGCTGGGG + Intronic
1092495110 12:8985876-8985898 GAGGGTCCTGCCCTTTACTGGGG - Intronic
1093498123 12:19780236-19780258 GGGAGGGCTGCACTGTTCTGGGG + Intergenic
1093590869 12:20900819-20900841 GCTGGGCCTGAACTTCTCTGGGG + Intronic
1093772703 12:23036044-23036066 GAGGCGCCTGCACATTTCCGGGG - Intergenic
1099816701 12:87657810-87657832 CAGGGGTATGCACTTTTCTTGGG + Intergenic
1101477568 12:105065055-105065077 AAGGAGCCTGCAGTTTTATGGGG - Intronic
1101519960 12:105473076-105473098 GATGGGGCTGCAGTTGTCTGGGG - Intergenic
1103862521 12:124026066-124026088 GAGGGGTCTCCACTTTTTGGAGG + Intronic
1105775394 13:23654595-23654617 AAGGGCCCTGCTCATTTCTGTGG - Intronic
1106075706 13:26459243-26459265 TAGGGGCAGGGACTTTTCTGAGG + Intergenic
1110669555 13:78161400-78161422 GAGGAGCCTGCCCTGTTCTCTGG + Intergenic
1110941108 13:81350017-81350039 GAGTGGCATGCATGTTTCTGTGG + Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1112733869 13:102396057-102396079 GAAGGGCATGGAGTTTTCTGAGG - Intronic
1117132026 14:52695907-52695929 GAGGGGCCTGTGTTTTCCTGCGG + Intergenic
1118901280 14:69987889-69987911 GCGGGGGCTGCAACTTTCTGGGG + Intronic
1119725592 14:76920242-76920264 GAGGGGCCTTCTCTTGACTGGGG + Intergenic
1121010374 14:90516868-90516890 GAGGGTCCAGCCCTTTTCTTAGG - Intergenic
1121348639 14:93155081-93155103 GAGGGGCCTACACTTGTCCTTGG + Intergenic
1123118484 14:105905491-105905513 GAGGCGTCTGCAGTTTTCTCTGG + Intergenic
1125274604 15:37977807-37977829 AAGGGCCCTGCATTTCTCTGAGG - Intergenic
1128234229 15:66056598-66056620 GAGGGCCCTGCATTCTTCTCTGG - Intronic
1130192244 15:81748543-81748565 CAGGGCCATGCTCTTTTCTGAGG - Intergenic
1130763748 15:86849259-86849281 GAGGGACTTGCAATTTGCTGAGG - Intronic
1130901158 15:88207713-88207735 GAGGGGCCTTGGCTTATCTGGGG - Intronic
1132335557 15:101046218-101046240 GAGGGGAATGCCCTTTGCTGGGG + Intronic
1132683205 16:1152305-1152327 AAGGGGCCTGCACTTCTCCTCGG + Intergenic
1132907700 16:2291596-2291618 GAGGGGCCTGCACTGCCTTGGGG - Intronic
1133286924 16:4694777-4694799 GAGGGGGCTGCACTGCTCCGAGG + Intronic
1133608414 16:7410786-7410808 GAGGGGCCTGCATTTTCATCAGG + Intronic
1135167526 16:20153425-20153447 AAAGGGCCTGGAATTTTCTGAGG - Intergenic
1137734891 16:50716426-50716448 GTGGGGTCTCCACTTTTTTGGGG + Intronic
1138604440 16:58079198-58079220 GATGGGGATGCAGTTTTCTGGGG + Intergenic
1140349430 16:74247969-74247991 GAGAAACCTCCACTTTTCTGAGG + Intergenic
1140681538 16:77390057-77390079 GAGGAGTCTGCATTTTTCTTAGG - Intronic
1141993493 16:87623032-87623054 GAGGGGCCTGGACACTCCTGTGG - Intronic
1142024820 16:87806774-87806796 GAGGGGGCTTCCCTTTTCTGTGG + Intergenic
1142435121 16:90051753-90051775 GAGGGTTCTGCAGTTCTCTGTGG + Intergenic
1144312026 17:14022827-14022849 GAGGGGCCTCCAGTGTGCTGGGG + Intergenic
1144332732 17:14238492-14238514 GAGGGGCCTCCAGTGTGCTGGGG - Intergenic
1144808856 17:17985693-17985715 GAGGTGCTTGCTCATTTCTGTGG - Intronic
1144841958 17:18192196-18192218 GAGGGCCCTGGACTATCCTGGGG - Intronic
1146835409 17:36106764-36106786 TGGGGCCCTGCACTTCTCTGGGG + Intergenic
1147448159 17:40487598-40487620 GGTGGGCATGCACTTTGCTGTGG - Intronic
1151682261 17:75628402-75628424 GAGGGGCGTGGCCTCTTCTGAGG + Exonic
1152528554 17:80903419-80903441 CAGGGGCCGCCACTGTTCTGTGG - Intronic
1152898714 17:82928133-82928155 GAGGGGCCTGCACAAACCTGGGG - Intronic
1154259716 18:12819972-12819994 CAGGGGCCTGCAGTGCTCTGTGG + Intronic
1157300595 18:46476333-46476355 GAGGGGCCTGAACTTGCCTCAGG + Intergenic
1161627301 19:5334776-5334798 GAGGGGCCTTCACTGGCCTGAGG - Intronic
1162552606 19:11365892-11365914 GAGGTGAATGAACTTTTCTGAGG - Intergenic
1164799607 19:31065325-31065347 GAGGGTCCTTCACTCATCTGTGG + Intergenic
1165351543 19:35278586-35278608 GTGGGGCCTGCACTGTTCCTGGG + Intronic
1166243538 19:41510063-41510085 AGGGGGCGTGCACTCTTCTGTGG - Intergenic
925141227 2:1550946-1550968 GAGGTCCCTGCAGGTTTCTGTGG + Intergenic
925388811 2:3482109-3482131 GACGGGGCTGCACTGTCCTGGGG - Intronic
926022869 2:9512630-9512652 GAGGGTCCTGCCCTTTACTGTGG + Intronic
927102293 2:19797333-19797355 CTGGGCCCTGCACTTCTCTGTGG - Intergenic
927844559 2:26464789-26464811 GAGGGGCCCACACTTCCCTGGGG - Intronic
927951743 2:27174947-27174969 CAGAGGCCTGTTCTTTTCTGGGG + Intergenic
928082856 2:28325974-28325996 GGGAGTCCTGCACTTTGCTGTGG + Intronic
932720768 2:74137788-74137810 GAGGGCCCTGCACTTGATTGTGG - Intronic
934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG + Intronic
936555919 2:113498922-113498944 GAGGGGGCTGGGCTTTTCTCCGG + Exonic
937336023 2:121062803-121062825 CAGGGGCCTGGCCTTGTCTGGGG - Intergenic
937451049 2:122002390-122002412 TAGGAGGCTGCACGTTTCTGAGG + Intergenic
939740821 2:145903232-145903254 TAGGGGCCTGAACTTTGCTAAGG + Intergenic
944206396 2:197162949-197162971 GGGCGGCCTGCAGGTTTCTGTGG + Intronic
945053827 2:205850524-205850546 TAGGGGCCTGCTCTTTGTTGGGG - Intergenic
946104996 2:217361284-217361306 GAGGAGCATGCACTTGGCTGGGG + Intronic
946721361 2:222611879-222611901 GAGGGCCATGCACGGTTCTGTGG - Intronic
1169541058 20:6600178-6600200 GAAGGGTCTGCACTTTTGTCTGG - Intergenic
1170838747 20:19907021-19907043 GAGGGGACTGCATTTTGCGGGGG + Intronic
1172482473 20:35278925-35278947 GAGGGAACTGCACTTTAATGGGG + Exonic
1174955201 20:55090255-55090277 GAGGTGCCTGCACCTAGCTGTGG - Intergenic
1175466195 20:59192446-59192468 GAGGGGCCGAGACTTGTCTGGGG - Exonic
1175787842 20:61723324-61723346 GAGGGGCCTGCCCGGTGCTGAGG - Intronic
1178619276 21:34159550-34159572 GAGGGGCCTGAGCTTCTCAGAGG + Intergenic
1179166142 21:38936740-38936762 GAGGAGCTTGCCCTTCTCTGAGG - Intergenic
1179990706 21:44946976-44946998 GAGGGGCTTGCCCTGGTCTGGGG + Intronic
1180021579 21:45131754-45131776 TAGGGGCTGGCACTTTTCAGAGG + Intronic
1180076466 21:45465844-45465866 GAGGGGTTTGCCCTTTTCTTCGG + Intronic
1182041570 22:27242317-27242339 GAGGGGCCGGCACTTGTTTAGGG - Intergenic
1182321572 22:29481266-29481288 TAGGGGCATGCACTTTGCAGAGG - Intronic
1183370574 22:37429462-37429484 GAGTGGCCGGCACTGTGCTGGGG - Intergenic
1183530896 22:38352728-38352750 CCTGGGCCTGGACTTTTCTGTGG + Intronic
1184075342 22:42173697-42173719 CAGAGGCCTGCACTGCTCTGTGG - Intronic
1184680270 22:46069296-46069318 GAGAGCCGTGCCCTTTTCTGGGG + Intronic
1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG + Intronic
1185068138 22:48642176-48642198 GAGCGGCCTGCGCTTTGCTGAGG + Intronic
950290810 3:11782779-11782801 TTGGGGCATGGACTTTTCTGTGG + Intergenic
950357777 3:12426008-12426030 GATGGGCTTGCACTGTTTTGTGG + Intronic
953610693 3:44445162-44445184 GAGGGGCCTGCAGTGTGCAGGGG + Exonic
954030928 3:47819439-47819461 CAGGGGTCTGCACTCCTCTGGGG - Intronic
954389151 3:50259946-50259968 GAAGGGCCCGCGCGTTTCTGGGG + Intergenic
954462238 3:50633934-50633956 GAGGGGCCTGGCCTGTTTTGAGG + Intronic
956167351 3:66406610-66406632 GAGGGGCATGCAGGTTTCAGAGG - Intronic
957448724 3:80347987-80348009 GAGGGGATTGCACTCATCTGAGG + Intergenic
959378042 3:105608852-105608874 CAGGGGCCTGGACATTGCTGCGG + Intergenic
960565821 3:119130504-119130526 GAGGGGCATCCACATTACTGAGG + Intronic
961628435 3:128279520-128279542 GATGGGCCTGCACCCTTCAGGGG + Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
962272117 3:133984955-133984977 CAGGGGCCTGCAACATTCTGTGG - Intronic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
968649117 4:1753464-1753486 GTGGGGCCAGCACTGCTCTGTGG - Intergenic
968905706 4:3449693-3449715 GAGGGGGCTGGACTCTGCTGGGG - Intergenic
968958554 4:3731075-3731097 GGGGGGCCTGCAATTCCCTGGGG + Intergenic
974933690 4:68388769-68388791 GAGAGGCAGTCACTTTTCTGTGG - Intergenic
980974096 4:139594426-139594448 GAGGCACCAACACTTTTCTGAGG + Intronic
986835534 5:11632986-11633008 TAGTGTCCTGCACTTCTCTGAGG - Intronic
987958902 5:24777627-24777649 AAGTGGCCTGCATTTTTCTAGGG - Intergenic
991247134 5:64520494-64520516 GAGGCCCCAGCACTTTTCTCTGG + Intronic
995302763 5:110603361-110603383 GATGGGATTGCACGTTTCTGTGG - Intronic
1002838244 6:883663-883685 CAGTGGTTTGCACTTTTCTGGGG + Intergenic
1007551410 6:42732734-42732756 GAGGGTCCTGCACTGTACCGTGG - Intergenic
1007595666 6:43049819-43049841 GAGGGGTCTGGAATTTTCAGAGG - Intronic
1017680157 6:156855434-156855456 GACGGGCCTGCAGTGTTTTGTGG - Intronic
1018055249 6:160046809-160046831 GATGGGCCTGCTCCTTTCTCTGG - Intronic
1018935780 6:168273429-168273451 GGGGGGCCTGGACTTCTGTGTGG + Intergenic
1019354904 7:573396-573418 GAGGGGCCTGCTGGTGTCTGTGG - Intronic
1021571304 7:22067979-22068001 GAGGTGCCTTCCCTTTGCTGCGG + Intergenic
1023461017 7:40397201-40397223 AAGGAGCATGCATTTTTCTGTGG + Intronic
1026096179 7:67348252-67348274 GAGGGGGCTGCTCCTTTTTGGGG - Intergenic
1030540962 7:110830273-110830295 GAGGCTCCTTCACTTTCCTGTGG + Intronic
1033611057 7:142963545-142963567 GAGAGGCAAGCACATTTCTGGGG + Intergenic
1034376929 7:150653742-150653764 GAGGGCTCCGCACTTCTCTGTGG - Intergenic
1035262262 7:157669481-157669503 GAGGGGCCTGCAGAGCTCTGTGG - Intronic
1035328751 7:158082957-158082979 GAGTGGCCTCCTCCTTTCTGAGG - Intronic
1035345476 7:158194408-158194430 GAGGGCCCTGCCCTTGTCTGTGG - Intronic
1035572089 8:679350-679372 GAGGGGCCAGAGCTTTTGTGAGG - Intronic
1036483420 8:9157927-9157949 AAGTGGCCTGCATTTTTGTGAGG + Intronic
1037842588 8:22255906-22255928 GAGGAGCCTGCACTCTAGTGAGG + Intergenic
1038388414 8:27171905-27171927 GATCTGCCTGCACTTTGCTGTGG + Intergenic
1038831812 8:31070558-31070580 GAGGGGCCTACAGTTTTATTGGG + Intronic
1040434858 8:47380429-47380451 GCGGGGCCTGCTGTTTGCTGTGG + Intronic
1042137267 8:65644529-65644551 GAGGGGCGTGTGCTTTTGTGCGG - Intergenic
1045263902 8:100602928-100602950 GGGGGGCCTACTCTGTTCTGTGG + Intronic
1045510384 8:102808388-102808410 CAGGAGGCTGCACTCTTCTGTGG - Intergenic
1049048126 8:140169088-140169110 GAGGAGCCTGTACATCTCTGAGG + Intronic
1049409528 8:142466248-142466270 CAGGGGCCTTGACTTTTCTGGGG + Intronic
1052962417 9:34310662-34310684 GAGAGGCCTGCCCTTGCCTGAGG + Intronic
1053446440 9:38156721-38156743 GAGGGGCCAGTGCTTGTCTGAGG + Intergenic
1053475500 9:38379341-38379363 CAGGGCCCTGCTCCTTTCTGAGG - Intergenic
1053740206 9:41128697-41128719 GAGGGGGCTGGGCTTTTCTCCGG - Intergenic
1054443170 9:65284690-65284712 GAGGGGCCTGGGCTTTTCTCCGG - Exonic
1054487110 9:65736811-65736833 GAGGGGCCTGGGCTTTTCTCCGG + Exonic
1054688142 9:68302616-68302638 GAGGGGGCTGGGCTTTTCTCCGG + Intergenic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057800920 9:98191324-98191346 GTGGGGCCTCCGCTTTCCTGGGG - Intronic
1058899709 9:109431306-109431328 GAGGGTCCAGCCCTTGTCTGTGG + Intronic
1059497563 9:114722036-114722058 GGGAGGCCTGCACTCATCTGGGG - Intergenic
1185820709 X:3200979-3201001 GTGGGGCACTCACTTTTCTGTGG - Intergenic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1188443968 X:30237736-30237758 GAGGGACCTGCACTTTCCTTAGG - Intergenic
1191224803 X:58031663-58031685 GAGGTGGCTGCATTTTTCTGGGG + Intergenic
1193613477 X:83659852-83659874 GAGGGGCCTGCTCTTCCTTGTGG - Intergenic
1196144700 X:112304086-112304108 GAAGGACCTGGACCTTTCTGTGG + Intergenic