ID: 1185068161

View in Genome Browser
Species Human (GRCh38)
Location 22:48642255-48642277
Sequence GGACCCCAGAACCTCCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 207}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185068155_1185068161 -5 Left 1185068155 22:48642237-48642259 CCCTGCCAGAGCCCCAGGGGACC 0: 1
1: 1
2: 2
3: 56
4: 371
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068150_1185068161 0 Left 1185068150 22:48642232-48642254 CCCAGCCCTGCCAGAGCCCCAGG No data
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068157_1185068161 -10 Left 1185068157 22:48642242-48642264 CCAGAGCCCCAGGGGACCCCAGA 0: 1
1: 0
2: 8
3: 68
4: 494
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068147_1185068161 24 Left 1185068147 22:48642208-48642230 CCTGTGGGGAGGCCTCGCCACTG 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068156_1185068161 -6 Left 1185068156 22:48642238-48642260 CCTGCCAGAGCCCCAGGGGACCC 0: 1
1: 1
2: 6
3: 54
4: 433
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068146_1185068161 25 Left 1185068146 22:48642207-48642229 CCCTGTGGGGAGGCCTCGCCACT 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068152_1185068161 -1 Left 1185068152 22:48642233-48642255 CCAGCCCTGCCAGAGCCCCAGGG 0: 1
1: 0
2: 6
3: 107
4: 718
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068145_1185068161 30 Left 1185068145 22:48642202-48642224 CCAAGCCCTGTGGGGAGGCCTCG 0: 1
1: 0
2: 3
3: 32
4: 550
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068149_1185068161 7 Left 1185068149 22:48642225-48642247 CCACTGTCCCAGCCCTGCCAGAG 0: 1
1: 0
2: 4
3: 86
4: 613
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207
1185068148_1185068161 12 Left 1185068148 22:48642220-48642242 CCTCGCCACTGTCCCAGCCCTGC 0: 1
1: 0
2: 8
3: 103
4: 665
Right 1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG 0: 1
1: 0
2: 2
3: 17
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185068161 Original CRISPR GGACCCCAGAACCTCCCAAA TGG Intronic
900393864 1:2445149-2445171 AGACCCCAGACCCTCCCCTAGGG - Intronic
900495214 1:2973089-2973111 GGACCCCAGAACCTACTGAGAGG - Intergenic
900894536 1:5474063-5474085 TGACCTCATCACCTCCCAAAGGG - Intergenic
901947773 1:12717616-12717638 GGACCCTACAAGCTCCCTAAAGG - Intronic
902020131 1:13339639-13339661 GAACTGCAGAACCTCCAAAAGGG + Intergenic
906087498 1:43148450-43148472 GCACCCCAGAACTTTCCGAAGGG - Intronic
906459370 1:46025592-46025614 GGACCTCAGAAACTGCCAGATGG + Intronic
907400437 1:54221913-54221935 GTACCCCAGGAGCTCCCAGAGGG - Intronic
908663595 1:66464757-66464779 GGACCCCTGTTCCTCCCAACCGG - Intergenic
909994483 1:82262194-82262216 CTGCCCCAGAACCTCCCATATGG - Intergenic
911409045 1:97478605-97478627 GGGCCCTAGGACCTTCCAAATGG + Intronic
913217559 1:116633196-116633218 TGAACCCAGGACATCCCAAATGG - Intronic
915287376 1:154861609-154861631 GGACCCCCCAACCTCCTACAGGG + Intronic
917285922 1:173421428-173421450 GAACCCCAGACCCTCCGAACCGG + Intergenic
917755259 1:178092831-178092853 GGACTAAAGAACCTCCCAAAAGG + Intergenic
919051111 1:192512573-192512595 CCACCCCAGAACCACCCACAGGG + Intergenic
919744399 1:200999683-200999705 GGACCCCACCTCATCCCAAACGG - Intronic
920181014 1:204131728-204131750 GGAGCTCAGCACCTCCCACATGG + Exonic
920277044 1:204814153-204814175 GGACCTCCCAAACTCCCAAATGG + Intergenic
920930021 1:210379180-210379202 GGACCCCAGAATCTCCAGCATGG + Intronic
922812983 1:228428391-228428413 GGACCCAAGCACCTCCCACCAGG + Intergenic
923214934 1:231839940-231839962 TGACACCAGCACCTCCCACAAGG + Intronic
1066320556 10:34299173-34299195 GGAGCCCAGTGCCTCCCAAAAGG + Intronic
1073452735 10:103619227-103619249 GGAGCCCTGAACTTCTCAAAGGG - Intronic
1073554602 10:104436658-104436680 GGACCCAAGCACCTCCCACCAGG + Intronic
1074120818 10:110493469-110493491 GTACCCCATGACCTTCCAAAAGG + Intergenic
1074814775 10:117135695-117135717 GGACCCAAGAACTTGCCAAGTGG - Intronic
1076076835 10:127540107-127540129 GGACCCCAGAAGCCACCAAAGGG - Intergenic
1076353992 10:129839343-129839365 GGGCCTCAGCACCTCACAAAGGG + Intronic
1076613704 10:131742892-131742914 GGTCCCCAGACCCTCCCACAAGG - Intergenic
1076698084 10:132256722-132256744 GCACCCCAGGACCACCCACAGGG + Intronic
1076764751 10:132627010-132627032 TCACCCCATCACCTCCCAAAGGG - Intronic
1077097595 11:805508-805530 GGCCCCGAGAACCTCGGAAAGGG - Intronic
1077349683 11:2086706-2086728 GGAACACAGAACCTCCGGAAAGG - Intergenic
1077384266 11:2261621-2261643 GGACCCAGGAGCCTCCCGAATGG + Intergenic
1077490981 11:2860870-2860892 GGACTCCAGCTCCTCCCAAGGGG - Intergenic
1080294104 11:30705364-30705386 TCACCCCATCACCTCCCAAAAGG + Intergenic
1080446717 11:32344604-32344626 GTACTCCAGGCCCTCCCAAAAGG - Intergenic
1081044072 11:38250258-38250280 GGAACTCAGGACCTGCCAAATGG - Intergenic
1082001408 11:47395380-47395402 GGGCCCCAGCCCCTCCCAACCGG + Intergenic
1082167219 11:48963474-48963496 GGACCCCAGGGCCTTCCAAGGGG + Intergenic
1082676021 11:56103608-56103630 GGTCCCCAGGGCCTACCAAAAGG + Intergenic
1082677258 11:56120898-56120920 GGCCCCCAGGGCCTACCAAAAGG + Intergenic
1084470723 11:69357538-69357560 GAGCTCCAGAGCCTCCCAAACGG - Intronic
1086111711 11:83206518-83206540 TGACCTAATAACCTCCCAAAAGG - Intronic
1087743437 11:101915235-101915257 CGCCCCCAGAACCTCCCTCATGG - Exonic
1088668856 11:112121772-112121794 GGACTCAAGAACCTCTCGAAAGG + Intronic
1089497642 11:118915895-118915917 TGGCCCCAGAAGCCCCCAAAGGG + Intronic
1091430964 12:434306-434328 TGACCCCAGAACCCCAGAAAGGG - Intronic
1091447577 12:552821-552843 CTAAACCAGAACCTCCCAAATGG - Intronic
1091610681 12:2004919-2004941 GGGTCTCAGAAACTCCCAAAGGG - Intronic
1096589988 12:52651758-52651780 GGCCCCCAAAACCTCCAAAGCGG + Exonic
1097522179 12:60682955-60682977 GGAGACCAGAAACTCCCAGAGGG - Intergenic
1099554387 12:84092254-84092276 AGAACTCAGAACCTACCAAATGG - Intergenic
1101363262 12:104047660-104047682 TGACCCAACCACCTCCCAAAAGG + Intronic
1101812232 12:108117631-108117653 GGACCCCGGACCCTGCCATATGG + Intergenic
1102543713 12:113639861-113639883 GGACTCCACAGCCTCCCAGAGGG + Intergenic
1103589814 12:121983650-121983672 TGACCCCACCACTTCCCAAAAGG + Intronic
1104407033 12:128526453-128526475 GGACCTAATCACCTCCCAAAAGG + Intronic
1106314201 13:28578979-28579001 TGACCAAAGCACCTCCCAAAAGG - Intergenic
1109387133 13:61645392-61645414 TGACCCAAACACCTCCCAAAAGG - Intergenic
1113216241 13:108043760-108043782 GGACCCAAACACCTCCCATAAGG + Intergenic
1113588245 13:111480350-111480372 GGACCTCAGAAGCTCCAAACTGG - Intergenic
1114466119 14:22924007-22924029 GGAGCCCAGCACTTCCTAAAAGG - Exonic
1119424511 14:74527085-74527107 GGGCCCCAGCCCATCCCAAATGG + Intronic
1121046360 14:90791128-90791150 GGATGCCAGAACATTCCAAAGGG - Intronic
1122102460 14:99424392-99424414 AGACCCCAGGCCCTCCCAGAGGG + Intronic
1124006205 15:25797456-25797478 GGAGCACAGAACCTCTGAAAGGG - Intronic
1127518924 15:59723895-59723917 TGACCTCAGCACCTCCCAGAAGG - Intergenic
1128659081 15:69484736-69484758 GGACCCCAGAGCCTCCTCCATGG + Intergenic
1129226784 15:74174801-74174823 GATCCCGAGAACCTGCCAAAGGG - Intronic
1131522263 15:93125559-93125581 TAATCCCAGCACCTCCCAAAAGG + Intergenic
1132546979 16:537716-537738 AGACGCCGGAACCACCCAAACGG - Intronic
1132780445 16:1621537-1621559 GGGACCCAGGTCCTCCCAAATGG - Intronic
1132829207 16:1919274-1919296 GGAGCCCAGGACCTCCCCCAGGG + Intergenic
1133201350 16:4206479-4206501 GGGCCCCAGAACCTCCCCTTAGG - Intronic
1133660643 16:7913539-7913561 CTCCCCCAGAACCTCCAAAAAGG + Intergenic
1133676997 16:8082630-8082652 GGACCCAAGCACCTCCCACTAGG - Intergenic
1136092939 16:27933723-27933745 GAACCCCAGAACCTCCCTTCTGG + Intronic
1137421980 16:48342635-48342657 GGACCCCAACACCTCTCCAAGGG + Intronic
1139245869 16:65443016-65443038 AGACCCCAGAATCCCCCAGATGG - Intergenic
1139406470 16:66722968-66722990 GGACCCCAGTACCTCTCACGAGG + Exonic
1140626111 16:76796184-76796206 AGACCACAGAACCACCCAACTGG - Intergenic
1141111848 16:81276375-81276397 GGATCCCAGAAGCTCCTGAAGGG + Intronic
1141213281 16:82000834-82000856 GGACCCCAAAAGATCTCAAAAGG - Exonic
1141763223 16:86042845-86042867 GGAAGCCAGCACCTGCCAAAAGG - Intergenic
1142104124 16:88292951-88292973 AGACCCCAGGGCCTCCCCAAGGG - Intergenic
1142709842 17:1716977-1716999 AGCCCCCAGAGCCTCCCAAGAGG + Intronic
1144067130 17:11634655-11634677 TGACCCTAGATCCTCCCCAATGG + Intronic
1145211447 17:21016245-21016267 GGACACCAGCACCTCCGCAAAGG + Intronic
1147117348 17:38311329-38311351 GGACCTCATCACCTCCCAGAGGG - Intronic
1147625057 17:41894808-41894830 GGAGCTCAGAACCTCCCTGAGGG - Intronic
1147898075 17:43764818-43764840 GGATCCCAGATCCTCCCCAGGGG - Intergenic
1148606262 17:48931580-48931602 GGAACCCACATCCTCCCAACTGG + Intronic
1149604380 17:57914544-57914566 GACTCCCAGACCCTCCCAAATGG - Intronic
1150505172 17:65691335-65691357 GGAGTCTAGAACCTCCCAAAAGG - Intronic
1151205920 17:72506706-72506728 GGAGCAAAGAACATCCCAAATGG + Intergenic
1151879393 17:76885983-76886005 GCAGCCCAGAAGCTTCCAAAAGG - Intronic
1152470100 17:80486377-80486399 TGACCCCAAGACATCCCAAAAGG - Intergenic
1152579530 17:81159949-81159971 GGACCCCACACCCTCCCCGAGGG + Intronic
1156246991 18:35310431-35310453 GTACTACAAAACCTCCCAAAAGG - Intergenic
1157573900 18:48731019-48731041 GGCCCCCAGACCCTTCCAAATGG - Intronic
1157772825 18:50364720-50364742 TGACCCAATAACCTCCCAAAGGG + Intergenic
1158743118 18:60166030-60166052 GGACCCTACAACCACCCAATGGG - Intergenic
1160523643 18:79522918-79522940 TGCCCCCAGATCCTCCCAGATGG - Intronic
1161567508 19:5011815-5011837 GCCCCCAAGAACCCCCCAAAAGG - Intronic
1162473868 19:10888297-10888319 GGCCCCCAGTACCTCCCAGCTGG + Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1167313997 19:48753277-48753299 GGACCCTAGAATTCCCCAAAAGG - Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
925456046 2:4017508-4017530 GCACCACAGAACCTACCAATAGG - Intergenic
925655162 2:6139110-6139132 TGACCCAAGCACCTCCCAACAGG - Intergenic
927851599 2:26503343-26503365 CGGCCCCAGGACCTCCCCAAAGG + Intronic
928444500 2:31320911-31320933 CATCCCCAGAAACTCCCAAAAGG + Intergenic
932862480 2:75308795-75308817 GCACCCCAGAATTTTCCAAATGG - Intergenic
933783671 2:85820442-85820464 GGACCTAATCACCTCCCAAAGGG + Intergenic
933869729 2:86554019-86554041 GGACCTAATAACCTCTCAAAAGG - Intronic
934603808 2:95679323-95679345 GCTTCCCAGATCCTCCCAAAGGG - Intergenic
936080621 2:109430136-109430158 GGACCCCAGAACCAACTAAAAGG + Intronic
937687364 2:124712965-124712987 GGACCTAATCACCTCCCAAAGGG + Intronic
938098221 2:128477064-128477086 AGATCCCAGCACCTCCCGAAGGG - Intergenic
938656866 2:133443397-133443419 GGACCCCAAAACCTCCCACTTGG + Intronic
939196091 2:138974326-138974348 TGACCCAAGCACCTCCCACAGGG + Intergenic
939688944 2:145233978-145234000 TGACCCAAGAACCTCCCATAAGG + Intergenic
939834483 2:147111991-147112013 TGACCCCAGCACCTCCTACAAGG - Intergenic
944176183 2:196831288-196831310 ACACCCCAGAACCTTCGAAAAGG + Intergenic
945909991 2:215637462-215637484 GGACTCCAGAACCTCTCTATTGG - Intergenic
947461450 2:230307478-230307500 GAACCTCAGAGCCTCCAAAAGGG - Intronic
948599046 2:239097629-239097651 CAGCCCCAGCACCTCCCAAAGGG - Intronic
1169124336 20:3116190-3116212 GGACCCCACCACCCCCCAGAGGG + Intronic
1171286069 20:23938845-23938867 GGAACTCAGGACCTGCCAAATGG + Intergenic
1172186017 20:33031537-33031559 GGACCCCAGAAACACCCAGGGGG + Intergenic
1172188146 20:33044296-33044318 AGACCCCAAAACCCACCAAAAGG - Intergenic
1176241366 20:64077278-64077300 GGCTCCCAGCCCCTCCCAAAGGG + Intronic
1178125583 21:29512285-29512307 GGACCCCAGAGCCCCCCACGAGG - Intronic
1179487946 21:41722743-41722765 GGACACCAGGGACTCCCAAAGGG + Intergenic
1180012858 21:45062747-45062769 TGACCACACCACCTCCCAAAAGG - Intergenic
1180092432 21:45539942-45539964 GGACCCTAGAAGTTCTCAAAGGG + Intronic
1181358312 22:22315756-22315778 TGACCCAAGTACCTCCCACAAGG + Intergenic
1181966381 22:26658918-26658940 GGCTCCCAGATGCTCCCAAATGG - Intergenic
1182104858 22:27682013-27682035 GGACCCCAGCTCCTCCCAAGGGG + Intergenic
1183901727 22:41010767-41010789 GGACGCCAGCACCTGCCAGAGGG - Intergenic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG + Intronic
1185285737 22:49999344-49999366 TGACCCCAGCCCCTCCCACAGGG - Exonic
949926656 3:9047349-9047371 GGAACGCAGCACCTCCCAGAGGG + Intronic
954152412 3:48664029-48664051 GGACCCCAGAACGCTCCACAGGG + Intergenic
954356832 3:50088973-50088995 GCGCCCCAGAACCTCCAACAAGG - Exonic
955148749 3:56346009-56346031 GGAAGCCAAAACCACCCAAAGGG + Intronic
955316248 3:57941562-57941584 TGACCCAAGAACCTCCCACTAGG + Intergenic
955922642 3:63973791-63973813 GGGCCCCAGAACCAGCCACATGG - Intronic
956582189 3:70826331-70826353 GGAACCCAGAACCACCCATTTGG - Intergenic
959995848 3:112679456-112679478 TGACCTCATCACCTCCCAAAAGG + Intergenic
961448932 3:126993666-126993688 TGACCCCAGATGCTCCCAAAGGG - Intronic
961592486 3:127991189-127991211 AGAACCCAGAACCTCCCAAGTGG - Intergenic
961599250 3:128046410-128046432 GGGCCACAGCACCACCCAAAAGG + Intergenic
962852737 3:139319894-139319916 GGATCCCAGAACATCACAGAGGG - Intronic
968646972 4:1746065-1746087 GGACCCCAGCACCAGCCAGAGGG + Intergenic
968649013 4:1753094-1753116 GGACCCCAGAGCCCCCCACCTGG - Intergenic
973110848 4:46396185-46396207 GGACCTAAGTATCTCCCAAAAGG + Intronic
974797924 4:66778419-66778441 GCACCCCTCAGCCTCCCAAAGGG - Intergenic
982494840 4:156077689-156077711 AGAACCCAGAACCCACCAAACGG - Intergenic
982578820 4:157152657-157152679 TGACCCCAGAACATCTCATAGGG + Intronic
983021449 4:162681091-162681113 TGACCTAATAACCTCCCAAAAGG + Intergenic
984884682 4:184440025-184440047 GGTCCCCACAAACTCTCAAAGGG + Intronic
987031863 5:13983605-13983627 GGACCCCAGATCCTTTCAGACGG - Intergenic
987619187 5:20318458-20318480 GGATCCCATCACCTCCCACAAGG - Intronic
987815947 5:22901358-22901380 AGAACCCAGGACCTGCCAAATGG - Intergenic
988583465 5:32489084-32489106 AGACCTCAGAACCTTCAAAAGGG - Intergenic
989718292 5:44492618-44492640 AGAACCCAGAACCCACCAAATGG + Intergenic
990450688 5:55929475-55929497 GGACCCCAGAACCTCACGGCAGG + Intergenic
991036672 5:62134490-62134512 TGACCTCATCACCTCCCAAAGGG + Intergenic
993043208 5:82838460-82838482 GGACCCCAGCACTTACCCAAAGG - Intergenic
993227188 5:85182324-85182346 AGAACCCAGAACTTACCAAATGG + Intergenic
997625365 5:135327382-135327404 GGACCCCAGCAAAGCCCAAATGG - Intronic
998401911 5:141852719-141852741 GGACCCCTGACCCTGACAAAGGG + Intergenic
999252654 5:150191772-150191794 GGACCCAAGAGACTCACAAATGG - Intronic
999499622 5:152133662-152133684 TGACCCAAACACCTCCCAAAAGG + Intergenic
999979413 5:156943703-156943725 GGCCCCCAGTTTCTCCCAAAAGG - Intronic
1000661233 5:163941180-163941202 CGACCCAAGAACTTTCCAAATGG - Intergenic
1001542455 5:172549190-172549212 GGACCCCAGGACTTCCCAAAGGG + Intergenic
1002129013 5:177068096-177068118 GGACCAGAGTACCTCCCACATGG + Intronic
1004880501 6:20002682-20002704 GGACCCAAACACCTCCCAAAAGG - Intergenic
1005782031 6:29202153-29202175 GAACCACAGAACCACCCAAAAGG - Intergenic
1006807519 6:36798194-36798216 GGACCCCACAATCTCTCCAAGGG + Exonic
1007731067 6:43947054-43947076 GCATCCCAGAATCTCACAAATGG + Intergenic
1016243636 6:141958977-141958999 TGACCCAAGCACCTCCCAATAGG + Intergenic
1016438990 6:144064485-144064507 GGACTCCAGAACTTTCCAAGCGG - Intronic
1018081394 6:160262078-160262100 GGATCGCAGAGCCTCCCAGAGGG + Intronic
1018207157 6:161446323-161446345 GGACCTCGAAACCTCCCCAAAGG - Intronic
1019739194 7:2664356-2664378 GGACCCCAGAACCCCAGACAAGG + Exonic
1020002471 7:4763664-4763686 GGACCCCAGAACCACCCAACTGG - Exonic
1020591649 7:10146682-10146704 GGACCCAAATACCTCCCAATAGG + Intergenic
1026325457 7:69305546-69305568 GGACCCCAGGACCTCCCCCAAGG - Intergenic
1027547197 7:79542381-79542403 TGACCCAATCACCTCCCAAAAGG - Intergenic
1027711052 7:81601766-81601788 TGACCCCAGTACCTCCCACTAGG - Intergenic
1028370009 7:90080771-90080793 GTACCACAGAGCCTCACAAATGG - Intergenic
1029636520 7:101788117-101788139 TGACTCCACAATCTCCCAAATGG - Intergenic
1034968203 7:155404228-155404250 GGTCACCAGCACCTCCCAGAAGG + Intergenic
1035031616 7:155864731-155864753 GGGCTCCAGGATCTCCCAAATGG + Intergenic
1036021530 8:4852267-4852289 CAACCCCAGCACCTCCCACAAGG - Intronic
1039878950 8:41611523-41611545 AAACCCCAGAACTTCCCAAAGGG - Intronic
1041289347 8:56294047-56294069 GGACCCCAAACTCTGCCAAAAGG - Intergenic
1048130877 8:131695464-131695486 GGACCCAAACACCTCCTAAAAGG + Intergenic
1049668471 8:143859217-143859239 GGACGCCAGCACGTCCCACACGG + Exonic
1049668889 8:143860825-143860847 GGACGCCAGCACGTCCCACACGG + Exonic
1049669304 8:143862427-143862449 GGACGCCAGCACGTCCCACACGG + Exonic
1049669716 8:143864020-143864042 GGACGCCAGCACGTCCCACACGG + Exonic
1049670131 8:143865628-143865650 GGACGCCAGCACGTCCCACACGG + Exonic
1049812432 8:144581493-144581515 GGGGCCCAGGACCCCCCAAAGGG - Intronic
1049830536 8:144698884-144698906 GGACCCCCCAACCCCCCCAAGGG - Intergenic
1052787647 9:32844486-32844508 AAGCCCCACAACCTCCCAAAAGG - Intergenic
1054710438 9:68505607-68505629 AGAACCCAGAACCAGCCAAATGG + Intronic
1055670102 9:78595933-78595955 GGACCTCAACGCCTCCCAAAAGG - Intergenic
1057267988 9:93631417-93631439 GAATCCCAGAACCTCCCCACAGG - Intronic
1057739825 9:97701423-97701445 CGACCCCAGCTCCTCCCACAAGG + Intergenic
1058382305 9:104390522-104390544 GGACCCCTGCACCCCTCAAAAGG - Intergenic
1061203046 9:129148204-129148226 GGAGCCCAGCACCTACCCAAAGG - Exonic
1062154473 9:135038989-135039011 GGACCCAAGCACCTCCCACCAGG - Intergenic
1062696022 9:137877026-137877048 GGTCCTCACAACCTCCAAAAAGG - Intergenic
1185533953 X:843606-843628 GGACCCCAAACCCGCCCTAAGGG - Intergenic
1190144841 X:47881059-47881081 GGACTCCACACCCTCCAAAATGG - Intronic
1193406621 X:81108697-81108719 TGTCCCCAGAAACACCCAAATGG - Intergenic
1196254255 X:113497345-113497367 GGACCCCATTGCCTCCCAACTGG - Intergenic
1198299605 X:135322217-135322239 GGACCCCCGCAGCTGCCAAAAGG + Intronic
1199649804 X:149939771-149939793 CGACCCCAGACCCTCCCCAGTGG - Intergenic
1199865321 X:151842917-151842939 TGACCCCAACACCTCCCACAAGG - Intergenic