ID: 1185068431

View in Genome Browser
Species Human (GRCh38)
Location 22:48643475-48643497
Sequence CACACCAAAGTGCACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185068431_1185068434 -5 Left 1185068431 22:48643475-48643497 CCTCCAGTGTGCACTTTGGTGTG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1185068434 22:48643493-48643515 GTGTGGCCCTGCCCAGTGCGTGG 0: 1
1: 0
2: 1
3: 24
4: 240
1185068431_1185068440 19 Left 1185068431 22:48643475-48643497 CCTCCAGTGTGCACTTTGGTGTG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1185068440 22:48643517-48643539 ACCTGTGCCCCTTACAGAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 138
1185068431_1185068439 16 Left 1185068431 22:48643475-48643497 CCTCCAGTGTGCACTTTGGTGTG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1185068439 22:48643514-48643536 GGCACCTGTGCCCCTTACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185068431 Original CRISPR CACACCAAAGTGCACACTGG AGG (reversed) Intronic
900276501 1:1833023-1833045 CTCACCAAAGTGCACACATGTGG + Intronic
900694532 1:4001646-4001668 CCCATCAGAGTGCCCACTGGCGG - Intergenic
903153858 1:21430947-21430969 CACACCAATCTGCTCTCTGGGGG - Intergenic
906296421 1:44651613-44651635 CACACCACAGGGCCCACGGGAGG - Exonic
906562531 1:46769544-46769566 CACATCACAGTGCACACTGGAGG + Intronic
907237947 1:53064105-53064127 CACACTAATTTGCAAACTGGGGG + Intronic
914919007 1:151835090-151835112 CAGAGCAATCTGCACACTGGAGG + Intergenic
915473003 1:156136989-156137011 CCCACCAAAGTTCACCCTGAAGG + Exonic
917846100 1:179021528-179021550 CACAACAAAGTGTACACTTTGGG + Intergenic
920031014 1:203037429-203037451 CACAGCAATAGGCACACTGGAGG - Intronic
922209131 1:223474163-223474185 CTCACCACAGTGTAAACTGGTGG - Intergenic
922507137 1:226133127-226133149 CACAGCAGCCTGCACACTGGTGG - Intergenic
924637258 1:245799938-245799960 CACACCAATGTGCAAACAGTTGG + Intronic
1069572610 10:69503592-69503614 GACACCAGAGGGCACGCTGGGGG + Intronic
1070190917 10:74111446-74111468 CAGAACAAAGTGAACACTGCTGG - Intronic
1076307001 10:129472517-129472539 CACACCCAAGCCCTCACTGGGGG + Intronic
1077573605 11:3359634-3359656 CACACCTCAGTGAACACAGGAGG - Exonic
1082777639 11:57259708-57259730 CAAACAAAAGTGCTCATTGGGGG + Intergenic
1086935346 11:92739714-92739736 AACACCACAGTGCACACTCACGG - Intronic
1087036263 11:93758910-93758932 CACACCAGAGTGGAAACTTGTGG + Intronic
1089198731 11:116710719-116710741 CATACAAATGTGCACACTGGAGG + Intergenic
1091644034 12:2260011-2260033 CACACCAGTGTGCAGTCTGGTGG - Intronic
1094021383 12:25917888-25917910 CACACCAATGTTCACAGTGCTGG + Intergenic
1095288274 12:40442306-40442328 CACACGAGAGCACACACTGGAGG + Intronic
1095702781 12:45207769-45207791 CAAACCATAGTGCCTACTGGTGG - Intergenic
1097828022 12:64194500-64194522 CACACCAAACTGCAGACGTGGGG - Exonic
1103197905 12:119061313-119061335 CACACCCAAGTGCACACGCAGGG - Intronic
1103593190 12:122006706-122006728 CACACCCAAGGGCGCACAGGTGG - Intergenic
1106024658 13:25945578-25945600 CACACCAAAGTTCATGGTGGTGG - Intronic
1106710210 13:32322929-32322951 CACACCAAAGAGCACGATTGTGG + Intronic
1112682746 13:101786102-101786124 ACCACCAAAGTGCCCACTGCTGG + Intronic
1119462244 14:74816493-74816515 CACACCAAAGTTCCCTCTTGTGG - Intronic
1119765165 14:77183237-77183259 GCCACCAAAGGGCAGACTGGAGG + Intronic
1120861934 14:89262344-89262366 CACACAAATATGCAAACTGGAGG + Intronic
1122666223 14:103332393-103332415 TACACCAAGGTACACACTGCGGG + Intergenic
1122744396 14:103889422-103889444 CAGACCAACGTGTGCACTGGCGG - Intergenic
1125182949 15:36897974-36897996 CCCACCAGAGTGCTCACAGGAGG - Intronic
1126987638 15:54331141-54331163 AACACCAAATTGCACTTTGGAGG - Intronic
1130438199 15:83924100-83924122 CCCACCTAAGTGCAGACTTGTGG + Intronic
1132246941 15:100304713-100304735 CAGACCAAAATGCACAAAGGCGG - Intronic
1132994235 16:2814772-2814794 CTCACCCAAATGCACACTGGAGG + Intergenic
1133377267 16:5298126-5298148 CACACCTAAGTGCCCATTGATGG + Intergenic
1137515248 16:49137892-49137914 CAGCCCAAAGGGCACACTGATGG + Intergenic
1139972178 16:70783070-70783092 CTCAGCAAACTTCACACTGGAGG + Exonic
1141099080 16:81184008-81184030 CAGACCAAAGGGGAAACTGGGGG - Intergenic
1142114529 16:88349416-88349438 CACACCCAAGTGCACACACCAGG + Intergenic
1142205362 16:88780239-88780261 CACACCCAAGATCACACTGGTGG - Intronic
1143564077 17:7711056-7711078 AACACCCAATTGCACACTAGAGG - Exonic
1144358757 17:14470826-14470848 CACACATAAGTGAACACTGAGGG - Intergenic
1149249638 17:54753776-54753798 CACACCAACATGTATACTGGAGG + Intergenic
1149744623 17:59084007-59084029 CTCCCCAAAGTGCACACTGATGG + Exonic
1155258387 18:24018200-24018222 CACCTCAAAGTGCATAATGGTGG - Intronic
1156534288 18:37847868-37847890 CACTACAAACTGCACACTTGTGG - Intergenic
1158396460 18:57082114-57082136 CACACCAAAATGCAGACGGAAGG + Intergenic
1158528865 18:58240306-58240328 GACACCAAAATGCACCCTGAAGG - Intronic
1158535163 18:58301919-58301941 CACTTCCAAGTGCACACTGGTGG - Intronic
1160152519 18:76405994-76406016 CACACCAACATCCACACGGGAGG + Intronic
1160189407 18:76703085-76703107 CACACCAACATGCATGCTGGGGG + Intergenic
1160233843 18:77069821-77069843 CACACCAAAGCGGCCACAGGTGG + Intronic
1160711137 19:551436-551458 CACACGAAAACGCACACAGGCGG - Intergenic
1161807409 19:6452660-6452682 CCTACCAAAGTGCACACATGTGG + Intronic
1162678421 19:12318856-12318878 CACATGATAATGCACACTGGAGG - Exonic
1164683079 19:30149019-30149041 CACACACATGTGCACACAGGCGG + Intergenic
1167589162 19:50393808-50393830 GAAGGCAAAGTGCACACTGGGGG - Intronic
925048185 2:790191-790213 CAAACCAAAGTGAAAACTTGTGG + Intergenic
926592577 2:14755663-14755685 GCAACAAAAGTGCACACTGGTGG + Intergenic
931104032 2:59034729-59034751 CCCCACAAGGTGCACACTGGAGG - Intergenic
933777295 2:85778911-85778933 CAGACCAATGGGCAGACTGGTGG - Intronic
936039241 2:109137011-109137033 TACACTACAGTGGACACTGGGGG + Intronic
937717139 2:125045528-125045550 CACTGCAAAGTGCAGACTGCAGG - Intergenic
942726715 2:179017155-179017177 CAAAAGAAAGTGCATACTGGTGG + Intronic
945177033 2:207053233-207053255 GAAACCAAATTGTACACTGGTGG + Intergenic
946123166 2:217534538-217534560 CAGACCAAAGTCCAAACTGTTGG - Intronic
947612190 2:231531103-231531125 CACACCAAAGTCTAGCCTGGGGG + Intergenic
1169654897 20:7912015-7912037 AACACCAATGTGCACTCTGAGGG + Intronic
1172108922 20:32534084-32534106 CACACTAAATGGCACCCTGGTGG - Intronic
1172275236 20:33675740-33675762 CAAATCAAAGTGCAGATTGGAGG + Exonic
1174342128 20:49904577-49904599 ACCCCCTAAGTGCACACTGGAGG + Exonic
1174926962 20:54770898-54770920 CCAATCAAAGTGGACACTGGGGG - Intergenic
1176512010 21:7755755-7755777 CCTATCACAGTGCACACTGGTGG + Intronic
1178646123 21:34386281-34386303 CCTATCACAGTGCACACTGGTGG + Intronic
1185068431 22:48643475-48643497 CACACCAAAGTGCACACTGGAGG - Intronic
953215303 3:40912676-40912698 GACCCCAAAGTTCACACTGTTGG - Intergenic
957014204 3:75044061-75044083 CAGACCACAGGGCTCACTGGGGG + Intergenic
960018023 3:112915219-112915241 CACACCAATTTCCACAATGGCGG - Intergenic
964304994 3:155330073-155330095 CACACCACACTGCAGCCTGGTGG + Intergenic
969263333 4:6047211-6047233 GACATCAAAGCGGACACTGGTGG + Intronic
969882235 4:10184522-10184544 CAAACCATAAAGCACACTGGTGG + Intergenic
971846160 4:31921238-31921260 CACATGAAAGTGCAAATTGGTGG + Intergenic
972089030 4:35257254-35257276 CTAACCAAAGTGCACAATGTTGG - Intergenic
974235375 4:59174039-59174061 CACACAAAAGTGCAGTATGGTGG - Intergenic
976040899 4:80884027-80884049 CACACACCAGTGCATACTGGAGG - Intronic
978617664 4:110612571-110612593 GACACCAAAGTGGACAGAGGTGG - Intergenic
978756845 4:112311951-112311973 CACACCAAAATACACACAGGGGG + Intronic
981307473 4:143262227-143262249 CACACAAAAGGAGACACTGGTGG - Intergenic
982553485 4:156831891-156831913 CAAATCAAAGTGCTCACTGTGGG - Intronic
984963507 4:185120929-185120951 CACATCAAAGTGGACAGTGCTGG - Intergenic
986293133 5:6416340-6416362 CACAGCAAAGGCCCCACTGGAGG - Intergenic
987756532 5:22104342-22104364 CACACAAAAGTGGACATTTGTGG - Intronic
988157868 5:27477687-27477709 GAGCCCAAAATGCACACTGGAGG + Intergenic
988473524 5:31563182-31563204 ACCACCAAAGTGCCCTCTGGAGG - Intergenic
990403508 5:55464713-55464735 CACAACAAAGTACTCACTGTAGG + Intronic
990594755 5:57301571-57301593 CACATGCAAATGCACACTGGGGG - Intergenic
991187213 5:63823792-63823814 CAAATGAAAGTGGACACTGGTGG + Intergenic
994095429 5:95843340-95843362 CTCACCAAAGAGGAAACTGGAGG - Intergenic
994849073 5:105030276-105030298 CACACACATGTGCACACAGGTGG - Intergenic
998760920 5:145430905-145430927 CAACCCAGAGTGCTCACTGGAGG + Intergenic
1001624886 5:173123496-173123518 TACACTAAAGTGCAAACTGCAGG - Intronic
1001921949 5:175607515-175607537 CAGAGCAAAGTACACACTGTGGG - Intergenic
1004280402 6:14275447-14275469 CAGGCCCAAGAGCACACTGGGGG - Intergenic
1006259375 6:32854888-32854910 CACTCCCATGTGCCCACTGGGGG + Intronic
1007097381 6:39221859-39221881 CAGTCCAAAGTGCTCAGTGGTGG - Intronic
1010297275 6:74213811-74213833 CAGACTGAAGAGCACACTGGGGG + Intergenic
1013610734 6:111792695-111792717 CACAAGACAGTGCAAACTGGGGG + Intronic
1013775116 6:113670808-113670830 CACCCCAAAGAGCAGAGTGGGGG + Intergenic
1013850218 6:114504871-114504893 CACACCATAGCTCTCACTGGTGG + Intergenic
1018079695 6:160248132-160248154 AACTCCAAATTGCACACTGGGGG - Intronic
1022155923 7:27662278-27662300 CAACCCAAGGTGCACCCTGGGGG + Intronic
1023870070 7:44258593-44258615 CACAGAACAGGGCACACTGGAGG - Intronic
1024551810 7:50568313-50568335 CAGAGCAAAGTGGGCACTGGGGG + Intergenic
1024577813 7:50779174-50779196 GACACTAAAGTGAACACAGGGGG + Intronic
1025830393 7:65044086-65044108 CATACCCAAGTCCACACTGTGGG + Intergenic
1028646016 7:93097543-93097565 CACTGCACATTGCACACTGGTGG - Intergenic
1029627521 7:101729636-101729658 CACACCCTGGTGCACACTGGGGG + Intergenic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1033033384 7:137847364-137847386 CACTCCAAGGTTCCCACTGGCGG - Intergenic
1033491336 7:141846517-141846539 CAAAACAAAGTATACACTGGAGG + Intergenic
1033903993 7:146178588-146178610 CACACAGAATTGCACACTGGAGG - Intronic
1034724710 7:153324750-153324772 CACACCAAAGGGCAGCCTGGGGG - Intergenic
1037782986 8:21883748-21883770 CTCACCAAAGTGCACAAACGAGG - Intergenic
1038491726 8:27976548-27976570 CAAACCAAAGTGGACCCAGGAGG - Intronic
1039823502 8:41154304-41154326 CACCCCAAAGTGCACTCTTGAGG - Intergenic
1041309869 8:56505351-56505373 CACACCAAATTGAGTACTGGAGG + Intergenic
1041963017 8:63641381-63641403 CATACAAATGAGCACACTGGGGG - Intergenic
1044848193 8:96402296-96402318 CACATCAAAGGGCCCACTGCTGG + Intergenic
1049657903 8:143806858-143806880 CCCACCACAGTTCACACTGATGG - Intronic
1057180472 9:93027026-93027048 CACACCCAAGACCACAGTGGGGG - Intronic
1059669211 9:116477297-116477319 CTCTCCAAAGTGCACAGTTGGGG - Intronic
1060338813 9:122754050-122754072 CATCCCAAAGTGCACTCTCGTGG - Intergenic
1062454583 9:136629552-136629574 GAAACCAAAGTGCAGAGTGGTGG - Intergenic
1186918687 X:14252499-14252521 CACACACACGTACACACTGGAGG + Intergenic
1187416576 X:19098405-19098427 CACAGCAAAATGCCAACTGGAGG + Intronic
1188219379 X:27522325-27522347 CATACAAAAGTACACACTGGGGG - Intergenic
1190606818 X:52151530-52151552 CACACCAACTTCCACAATGGTGG + Intergenic
1196646238 X:118120007-118120029 CACACCAAAGTACACAGAGCTGG + Intergenic