ID: 1185070319

View in Genome Browser
Species Human (GRCh38)
Location 22:48652466-48652488
Sequence GCTCACAGGAGACCGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185070311_1185070319 30 Left 1185070311 22:48652413-48652435 CCTGCTTCCCTACAGTTGTTCAT 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 158
1185070313_1185070319 22 Left 1185070313 22:48652421-48652443 CCTACAGTTGTTCATACAACATG 0: 1
1: 0
2: 2
3: 15
4: 132
Right 1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 158
1185070312_1185070319 23 Left 1185070312 22:48652420-48652442 CCCTACAGTTGTTCATACAACAT No data
Right 1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185070319 Original CRISPR GCTCACAGGAGACCGCCTGC TGG Intronic
900294767 1:1943372-1943394 GCCCACAGGAGTCCGACAGCAGG + Intronic
900925802 1:5705454-5705476 GTGCACAGGACACAGCCTGCAGG + Intergenic
901463193 1:9404040-9404062 GCCCACAGGAGTCTGCCTTCTGG - Intergenic
902032704 1:13434384-13434406 GCTCAGAGGTGACAGCGTGCTGG - Intergenic
902623616 1:17664440-17664462 TCCCACAGGACACCTCCTGCAGG - Exonic
902797988 1:18811753-18811775 GCTCACACCAGACCCCCTGTCGG + Intergenic
904855546 1:33495438-33495460 GCTCACCGGAGAACCCATGCAGG + Exonic
906703531 1:47877289-47877311 GCTCACAGGAGGCCAGCTCCAGG + Intronic
911087132 1:93988422-93988444 GCTGACAGCAGCCAGCCTGCAGG - Intergenic
911980743 1:104562120-104562142 TCTCACAATAGACCGTCTGCAGG - Intergenic
915385491 1:155488022-155488044 GATTACAGGAGCCCGCCAGCAGG + Intronic
1063286540 10:4694719-4694741 GCTCTCAGGAGAACTCTTGCAGG - Intergenic
1063451333 10:6152284-6152306 TCACACTGGAGACCGGCTGCAGG - Intronic
1064023874 10:11831023-11831045 GCTCACACAAGACCTCCTGGTGG - Intronic
1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG + Exonic
1067714180 10:48673773-48673795 GCTCACTTGAAACCGCCTTCTGG - Intergenic
1071274916 10:84044742-84044764 ACTGACAGGAAACTGCCTGCTGG - Intergenic
1071430659 10:85603829-85603851 GCCAACATGAGACCACCTGCAGG - Intronic
1071921642 10:90357016-90357038 GCTCATTGGAGACCTCCTCCAGG - Intergenic
1074152697 10:110771692-110771714 GCTCACAGGACACCTCCTCCAGG - Intronic
1074485182 10:113869868-113869890 GATCACAGAAGACAGCCTGAAGG - Intronic
1075023882 10:118969671-118969693 GCTCACAGGAGCCCTCCGGGAGG + Intergenic
1076451670 10:130560857-130560879 GCTCAGAGGATAGCGGCTGCTGG + Intergenic
1077216284 11:1396488-1396510 GCAGACAGGAGACCCCCTCCAGG + Intronic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1081621144 11:44619825-44619847 GCTGTCAGGAGACTGCCTACTGG + Exonic
1083474768 11:62908808-62908830 GCTCACAGGAGAGAACCTGCTGG + Exonic
1084198733 11:67541381-67541403 GCTCACAGGCCACAGGCTGCAGG - Intergenic
1085683717 11:78602836-78602858 TCACACAGGAGAGCTCCTGCTGG - Intergenic
1086955200 11:92928510-92928532 GCTCACATGTGACCCCCTGTTGG + Intergenic
1089682949 11:120129665-120129687 GCTAACAGGGGACCTCCTGCAGG + Intronic
1091301285 11:134509757-134509779 GCTCACAGGAGACAGCTAGGAGG - Intergenic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1092272847 12:7037241-7037263 GCTGAGAGGAGACAGCGTGCTGG + Intronic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1100310135 12:93387004-93387026 GCTCACTGCAAACCGCCTCCTGG + Intronic
1100367029 12:93931400-93931422 GCACACAGGAGAGCCCGTGCTGG + Intergenic
1100672764 12:96834909-96834931 GCTCACAGGAGACCTGCAGCAGG + Intronic
1103947043 12:124532479-124532501 GCTCCCAGGAGCCCCCTTGCAGG - Intronic
1104719812 12:131039025-131039047 GCTCAGAGGGAACTGCCTGCGGG + Intronic
1104965674 12:132507874-132507896 GCTTACTGGAGACTCCCTGCTGG + Intronic
1109245993 13:59955371-59955393 GCAGACAGGAGACCGTGTGCAGG - Intronic
1109364548 13:61338982-61339004 GCTGAGAGGTGACAGCCTGCTGG + Intergenic
1112197362 13:97238817-97238839 GCTCATTGGAGGCTGCCTGCTGG + Intronic
1113674639 13:112198821-112198843 GCTGACAGGAGCCATCCTGCTGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115321347 14:32082612-32082634 GCTCACTGCAGTCCGCCTCCTGG + Intronic
1116575211 14:46565688-46565710 GCTAACAGGAAACTGCCTTCTGG - Intergenic
1116775801 14:49179215-49179237 GCACACAGGAGAGCTCCGGCTGG + Intergenic
1117008963 14:51450996-51451018 TGTCACAGAAGACCTCCTGCAGG + Intergenic
1118473068 14:66093372-66093394 GCTCACAGGAGACCCGCAGTGGG + Intergenic
1118573478 14:67218439-67218461 GCTCACTGGGGACAGCCTGTGGG + Intronic
1119442436 14:74637338-74637360 CCTCTCTGGAGACCCCCTGCTGG + Intergenic
1121077160 14:91078481-91078503 ACTCAAAGGAGACCCGCTGCAGG - Intronic
1121437566 14:93929217-93929239 CCTCACAGGAGAGCGCCTCGGGG - Exonic
1122785552 14:104161801-104161823 CCTCACAGGACACCTCCTCCAGG - Intronic
1123475640 15:20591280-20591302 GCTCACAGGGCTCCTCCTGCAGG - Intergenic
1123642371 15:22409083-22409105 GCTCACAGGGCTCCTCCTGCAGG + Intergenic
1124212538 15:27775523-27775545 CCTCACAGGGGTCCACCTGCAGG - Intronic
1124884601 15:33673271-33673293 GCTCACAGCAGAGGGACTGCGGG - Intronic
1128092597 15:64929063-64929085 GCTCGCAGCAGCCAGCCTGCAGG + Intronic
1130022390 15:80242321-80242343 GCTCACAGGAGCCCCCTTGCGGG - Intergenic
1130069038 15:80630981-80631003 GCTCACTGCAGACCCCCCGCGGG + Intergenic
1131865104 15:96700045-96700067 CCTCACAGGAGGCCACCTGTAGG + Intergenic
1135947627 16:26878610-26878632 GCTTAGAGGAGACAGCCTGATGG - Intergenic
1138533875 16:57649487-57649509 GCTCAGAGGACACCTCCTCCAGG - Intronic
1140675357 16:77323230-77323252 TCTCACAGGAGACCTTCTGTGGG + Intronic
1141034449 16:80615549-80615571 GCTTACAGGAGACCCACAGCAGG - Intronic
1141834876 16:86532076-86532098 GCAAGCAGGAGACGGCCTGCTGG + Exonic
1142590917 17:1005622-1005644 GCTGCCAGGAGACCGCCATCTGG + Exonic
1143283281 17:5771060-5771082 GCTGAGAGGTGACAGCCTGCTGG + Intergenic
1146143206 17:30387939-30387961 GCTCAGAGGAGACCGGCAGTGGG + Intronic
1146797794 17:35795177-35795199 GCTCACAGGGGACTGCCGGGTGG + Intronic
1147149109 17:38503627-38503649 GCTCACAGGCCACTGCCTCCCGG + Intronic
1148545698 17:48517315-48517337 GCTCACTGCAGACTGCCTCCTGG + Intergenic
1150282691 17:63938588-63938610 GTACAAAGGAGCCCGCCTGCTGG + Exonic
1156490590 18:37493633-37493655 CCTCAGAGGAGGCAGCCTGCAGG + Intronic
1157196428 18:45623807-45623829 ACTGAGAGGAGACCGCATGCAGG + Intronic
1157252165 18:46104503-46104525 GCGCACAGGAGACCCGCTGTCGG - Intronic
1159767670 18:72509729-72509751 GCCCACAGGAGAACCTCTGCTGG - Intergenic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1161801784 19:6420359-6420381 GCTCACAGGACACTTCCTCCTGG + Intronic
1162142465 19:8592855-8592877 GCTCGCTGCAGACCTCCTGCGGG + Exonic
1164158304 19:22609983-22610005 TCTCCCAGGAGTCAGCCTGCTGG + Intergenic
1167013223 19:46822400-46822422 GCTCAGAGGAGACCGTCAGTGGG - Intergenic
1167620269 19:50556503-50556525 GCTCAAAGAAGACCTCCTGGAGG - Intronic
925073385 2:988673-988695 GCTCCCAGGAGTGTGCCTGCTGG + Intronic
925540741 2:4964863-4964885 GGTCGCAGGAGCCCGCCTGGTGG + Intergenic
926730388 2:16031634-16031656 GCTGTCAGGAGACCTCCTGGTGG - Intergenic
927490115 2:23515651-23515673 GTTCACAGGAGACCTTCTGTGGG - Intronic
930575601 2:53142993-53143015 GCACACAGGTGAGTGCCTGCAGG - Intergenic
931452416 2:62379337-62379359 GATCACAGGAGAGAGCCTGGAGG - Intergenic
931827355 2:66015492-66015514 GCTCACAGGAGAAGGCCCTCAGG + Intergenic
932440734 2:71733091-71733113 GCTCACAGTGGACCTCCCGCTGG + Intergenic
932497908 2:72155940-72155962 GCTCACAGGGGCCCTGCTGCTGG + Intergenic
934102253 2:88664487-88664509 GCTCACCGCAAACCACCTGCTGG + Intergenic
937059937 2:118973685-118973707 TCTCACTGGAGGCAGCCTGCCGG + Intronic
937944698 2:127322191-127322213 ACTCACAGGAGACCGTAAGCTGG + Exonic
937971500 2:127552596-127552618 CCTCACAGGAGACCCCATGTTGG - Intronic
946115854 2:217461447-217461469 GCCCACAGGAGACTGCTTGCTGG - Intronic
947854070 2:233311503-233311525 GCTCAGAGGAGGCCGGCTCCAGG - Intronic
1170612945 20:17929129-17929151 GCTCACTGAAGAACGCCAGCAGG - Intergenic
1170874039 20:20234269-20234291 GCAGACAGGAGACCCCTTGCAGG + Intronic
1172004760 20:31811450-31811472 GGTCACAGGAGAGTGGCTGCTGG - Intergenic
1175811189 20:61858874-61858896 GTTCACACGAGACCCCATGCAGG - Intronic
1175824114 20:61927435-61927457 CCTCCAAGGAGACCTCCTGCCGG + Intronic
1179442167 21:41402938-41402960 GCTCACTGCACACCTCCTGCCGG + Intronic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1181041594 22:20195032-20195054 GCTCCCAGGGGAGGGCCTGCAGG - Intergenic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1185014725 22:48336208-48336230 GCACACAGGAGACCCCCTGGTGG - Intergenic
1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG + Intronic
954644579 3:52123122-52123144 GCTCACAGGAGACAGCCTGGTGG + Intronic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
959864093 3:111246301-111246323 GCTCTCAGGAGAATGCCTGAAGG + Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
966734498 3:183178393-183178415 GCTCACTGCAAACCGCCTCCCGG - Exonic
968762571 4:2450230-2450252 GCTCACGGGAAAGCACCTGCAGG + Intronic
969712608 4:8852596-8852618 GCTCACGGGAGTCAGCCTCCGGG + Intronic
971478131 4:27091079-27091101 GCCCACAGGAGACCACCAGTGGG - Intergenic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
981933241 4:150212121-150212143 GCTCACAGCAGAGAGCCTCCAGG - Intronic
985863897 5:2496324-2496346 GCTCAGAGGTGGCCTCCTGCAGG - Intergenic
986436856 5:7742695-7742717 ACTCACAGGAGTGCACCTGCAGG + Intronic
988489216 5:31692508-31692530 GCTGAGAGGTGACAGCCTGCTGG - Intronic
992160933 5:74000960-74000982 GATCCCAGGAGACAGCCTACTGG - Intergenic
993225654 5:85165386-85165408 GAGCACAGGAGACACCCTGCTGG - Intergenic
997847269 5:137298256-137298278 GCTCTCAGGAGACCCCATTCTGG - Intronic
998755972 5:145379767-145379789 GGTCACAGGAGCCAACCTGCAGG + Intergenic
999363390 5:151005237-151005259 GCTCACAGGACTCATCCTGCTGG - Intergenic
1001593984 5:172886103-172886125 TCCCACAGTAGACCGCCCGCCGG + Intronic
1003366211 6:5477307-5477329 GCTCACAACAGACCTCCTTCAGG + Intronic
1003956592 6:11170891-11170913 GCTGAGAGGTGACAGCCTGCTGG + Intergenic
1005021413 6:21422997-21423019 GCTCAGAGGAGACCGACAGTGGG + Intergenic
1012095376 6:94951125-94951147 GCTCACTGGAGACTTCCTTCAGG - Intergenic
1013990561 6:116250677-116250699 GCTCACAGGAAAGAACCTGCAGG - Exonic
1015894088 6:137999528-137999550 GCTCCCTGGAGGCCTCCTGCAGG - Intergenic
1018022364 6:159773495-159773517 GCACACAGGAGGCAGCCTACGGG + Intronic
1019184291 6:170212185-170212207 GCTCATAGGAGACAACCCGCAGG - Intergenic
1019490892 7:1312748-1312770 GCTCACAGGAATGCGCCTGGAGG - Intergenic
1019663455 7:2239180-2239202 CCTCGCATGAGACCGCCCGCAGG - Intronic
1019707500 7:2503571-2503593 GGGGACAGGAGACCACCTGCAGG - Intergenic
1019734046 7:2641732-2641754 CCCCGCAGGAGACCGTCTGCTGG + Intronic
1023042508 7:36184322-36184344 GCCCACAGGACACAGCCAGCTGG - Intronic
1023870607 7:44261259-44261281 GCTCAGAGGGGCCAGCCTGCTGG - Intronic
1035042663 7:155941670-155941692 GCTCAGTGGAGACTGTCTGCAGG + Intergenic
1035146895 7:156828027-156828049 GCTTGCTGGAGACCGCTTGCTGG - Intronic
1036621869 8:10429574-10429596 GATCTCAGGAGACCTCCTTCAGG + Intergenic
1040551803 8:48443782-48443804 GCTCAAAGGACACCTCCTGAGGG - Intergenic
1040581341 8:48701051-48701073 GCTTACAAGTGACAGCCTGCAGG - Intergenic
1041794604 8:61733647-61733669 GCTTACAGGAGGCCGCCTTAAGG - Intergenic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1044325489 8:90853158-90853180 CCTCACAGGAGGCAGCATGCAGG - Intronic
1044909125 8:97038337-97038359 GCTTACAGGAGAGTGCCTTCTGG + Intronic
1048811862 8:138295583-138295605 GCTCACAGGCTACTCCCTGCAGG - Intronic
1055422747 9:76161298-76161320 GCCCTCAGCAGGCCGCCTGCAGG + Intronic
1055785075 9:79863237-79863259 GCTCAGAGGCCACAGCCTGCAGG - Intergenic
1058133820 9:101285071-101285093 GCTCACAAGATCCCTCCTGCAGG - Intronic
1062140833 9:134957959-134957981 GCCCACAGGTGACAGCATGCAGG + Intergenic
1062191613 9:135250752-135250774 GCTCAGAGGAGCCTGCCTGGAGG + Intergenic
1062637041 9:137497032-137497054 GCTCACAGCAAAGCGGCTGCGGG + Intronic
1185963074 X:4567043-4567065 GATCACGGGAGACCACTTGCAGG - Intergenic
1187051205 X:15697317-15697339 ACTCAGAGGAGACTACCTGCTGG + Intronic
1187059943 X:15776427-15776449 ACTCAGAGGAGACTACCTGCTGG + Intronic
1188113646 X:26219466-26219488 TCTCACAGGGCACCACCTGCCGG + Intergenic
1201489466 Y:14524858-14524880 GCGTCCAGGAGACCGCCTGAAGG - Intronic