ID: 1185070667

View in Genome Browser
Species Human (GRCh38)
Location 22:48654111-48654133
Sequence CCGCGGCTCTGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185070661_1185070667 -9 Left 1185070661 22:48654097-48654119 CCGTCACGTTGGCGCCGCGGCTC 0: 1
1: 0
2: 0
3: 6
4: 27
Right 1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 208
1185070658_1185070667 -3 Left 1185070658 22:48654091-48654113 CCTGTCCCGTCACGTTGGCGCCG 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 208
1185070660_1185070667 -8 Left 1185070660 22:48654096-48654118 CCCGTCACGTTGGCGCCGCGGCT 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185070667 Original CRISPR CCGCGGCTCTGGAGGGAAGA GGG Intronic
900385323 1:2407955-2407977 CAACGGCTGTGGAGGGGAGAAGG + Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900571725 1:3361931-3361953 CCGCGGCCCAGGAGGGCAGGTGG + Intronic
901869280 1:12128072-12128094 CCACGGCTCAGGAGGGAAAGGGG - Intronic
902445286 1:16459338-16459360 CCCCTCCTCTGGAGGGCAGATGG - Exonic
902983992 1:20144281-20144303 CCGGGGCTCTGGGGGAAAGCTGG + Intronic
903384241 1:22916335-22916357 CCTCGGCCCTGGAGGGTGGAGGG - Intergenic
903684353 1:25120090-25120112 AGGGGGCTCAGGAGGGAAGAAGG - Intergenic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
913259952 1:116988812-116988834 CCGGGCCTGTGGTGGGAAGACGG + Exonic
913681123 1:121187340-121187362 CCGCTTCTCTCGAGGGCAGAAGG - Exonic
914032953 1:143974980-143975002 CCGCTTCTCTCGAGGGCAGAAGG - Intergenic
914156493 1:145092986-145093008 CCGCTTCTCTCGAGGGCAGAAGG + Exonic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915650524 1:157307299-157307321 CCTCAGCTCTTGAGGGAGGAAGG - Intergenic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
920096908 1:203492307-203492329 CCCAGGCTGTGGAGAGAAGATGG + Intergenic
920468437 1:206205864-206205886 CCGCTTCTCTCGAGGGCAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1065328503 10:24570640-24570662 CAGCGCCTCTCCAGGGAAGAGGG - Intergenic
1069753469 10:70759823-70759845 CAGCTGCTCTGGATGGAAGTGGG - Intronic
1070327317 10:75397183-75397205 TCCCGACTCTGGAGGGAGGAAGG + Intergenic
1070595507 10:77830181-77830203 CCCAGGCTCTGGAGGCAAGGTGG - Intronic
1073058967 10:100721898-100721920 CCACAGCTCTGGAAGGAAGAGGG + Intergenic
1074197765 10:111204380-111204402 GCTCAGTTCTGGAGGGAAGAGGG + Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075969511 10:126640532-126640554 CCACGGTCCTGGAGGGAAAAAGG + Intronic
1076011015 10:126988332-126988354 CCAGGGCTCTGGAAGGAAGTCGG + Intronic
1076343594 10:129766012-129766034 CCGCCCCTCTGGAGGGAACAGGG + Intronic
1077055000 11:587188-587210 CCGCGGCACTGGAGGCAAGCGGG - Intronic
1077101054 11:822584-822606 CAGGGGCTCCGGCGGGAAGAGGG - Exonic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083439150 11:62664781-62664803 CCGGAGCTCTGCAGGGAGGAAGG + Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1085095959 11:73760854-73760876 CCGCGGCTGGGAAGGGAAGGAGG + Exonic
1085297056 11:75437255-75437277 TGGCGGCTCTGGAGGTAAGAGGG - Intronic
1085339138 11:75719975-75719997 TCTCGGCTGGGGAGGGAAGAAGG - Exonic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1088173097 11:107018792-107018814 CGGCGGCGCTGGTGGGGAGAAGG + Intergenic
1090168953 11:124581404-124581426 CCTTGGCTCTGGATGGAGGAGGG + Intergenic
1092146952 12:6221383-6221405 CCAGGGCTCTGGAGAGAGGATGG - Intronic
1092264516 12:6970559-6970581 CGGCGGCACTGGAGGTCAGAAGG + Exonic
1092350096 12:7749224-7749246 CCTTGGCTCTTGAGGGAGGATGG + Exonic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093435335 12:19129736-19129758 CCGCGGCTGCCGAGGGAGGAGGG - Intronic
1094325518 12:29233793-29233815 GCCTAGCTCTGGAGGGAAGAAGG - Intronic
1096521318 12:52186299-52186321 CCTCAGTGCTGGAGGGAAGAGGG - Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096978766 12:55716510-55716532 GAGCGACTCTGGAGGGAGGAGGG + Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1101736203 12:107465198-107465220 TCGGGGCACTGGAGGGCAGACGG - Intronic
1104930823 12:132338603-132338625 CCTCGGATCTGGAGAGAACAGGG + Intergenic
1105525793 13:21176786-21176808 CCGCTTCTCTGGAGGGGAGGCGG + Intronic
1105922891 13:24982157-24982179 CCTCGGCACTGGAGGACAGAAGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1109620552 13:64899897-64899919 CAGCTGCTCTGGAGTGAAGTAGG + Intergenic
1109721679 13:66283449-66283471 CCACTGCTCTGGAGGGCACAAGG - Intergenic
1110664659 13:78102364-78102386 CAGCTGCTCTGAAGGGAAGTTGG - Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113736078 13:112679941-112679963 CCGAGGCTCTGGAAGGTAAAGGG - Intronic
1116928613 14:50668064-50668086 CGGCGGCTCGGGAGGGAAGGAGG - Exonic
1118298223 14:64590157-64590179 ACACGGCTCTGGATGGAATAGGG - Intergenic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1122298562 14:100719044-100719066 CCCCAGCTCTGGAGCGATGAAGG + Intergenic
1123021469 14:105399688-105399710 CCACGGTTCTGGAAGCAAGAAGG - Intronic
1126179670 15:45772959-45772981 CAGCGGATCTGGAAGGACGAAGG - Intergenic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1132397984 15:101488798-101488820 CCGCGGCTCCCGGGGGTAGATGG - Intronic
1132733846 16:1376067-1376089 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733867 16:1376129-1376151 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733899 16:1376227-1376249 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733923 16:1376299-1376321 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733946 16:1376369-1376391 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1134849709 16:17470386-17470408 CCGCGGCGAGGGAGGGAGGAAGG - Intronic
1137392342 16:48092098-48092120 CCGAGCCTCCGGAGGGAAGCTGG + Intronic
1137821872 16:51453679-51453701 CCCCAGCTCAGGAGGGAAAAAGG - Intergenic
1140224467 16:73066864-73066886 CCGCGGGGCTGGGGGGAGGAGGG - Intergenic
1140270722 16:73464337-73464359 CGGCTCTTCTGGAGGGAAGATGG + Intergenic
1140906834 16:79416135-79416157 CCGCGGCACAGGATGGAAGTGGG + Intergenic
1141665300 16:85462694-85462716 CCGCGGCGCGGGAGGGAGGCGGG + Intergenic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1143134444 17:4703819-4703841 CCGCGGCCCTGTGGGGAGGATGG - Intronic
1143150794 17:4806954-4806976 CCGCGGCCCTGCAGGGCACAGGG + Intergenic
1143983895 17:10894609-10894631 CCGAGGCTCTGCAGAGAATATGG + Intergenic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1146406098 17:32539506-32539528 TAGAGGCTCTGGAGGGAACATGG - Intronic
1146565649 17:33910735-33910757 CTGCCTCTCTGGAGGGAAGTAGG + Intronic
1148851710 17:50558800-50558822 CGGCCTCTCGGGAGGGAAGAAGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1150227904 17:63533758-63533780 CCACGGCTCTGGTGGGCAGAGGG - Intronic
1150657896 17:67052368-67052390 CCCTGGCTCTGGGGGGAAGGAGG + Intronic
1151278768 17:73056108-73056130 TCGGGGCTCTGTGGGGAAGATGG - Intronic
1151701947 17:75748067-75748089 CCACGGCACTGAAAGGAAGATGG + Intronic
1152335084 17:79696135-79696157 CACCGGCTCTCCAGGGAAGAGGG - Intergenic
1152776297 17:82204113-82204135 ACGAGGCTCTGGAGCAAAGACGG + Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1159122519 18:64187295-64187317 CCATGGCTCTGGAGGGACGAGGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160323686 18:77920086-77920108 CCGGGGCTCAGCAGGGAAGGTGG + Intergenic
1160696982 19:489516-489538 CCTCGGCTCTGCAGGGAGGACGG - Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1161984319 19:7645358-7645380 CCGGGGCTCTGCAAGGCAGAGGG + Intronic
1162312234 19:9914137-9914159 CCGCGGCTCAGGCTCGAAGAGGG - Intronic
1162755731 19:12858451-12858473 CCGGGGCTCTGGCGGGGGGAGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163369921 19:16896319-16896341 CCGCTGCTCTGGAAGGAAGGGGG + Exonic
1165020188 19:32917804-32917826 CCGCAGCTCTGAAGGAAGGAAGG + Intronic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1168266014 19:55224475-55224497 CCCCGGCTTGGGAGGGAAGATGG + Intergenic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
926722486 2:15971494-15971516 ACGAGGGTCAGGAGGGAAGAAGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
934893124 2:98087703-98087725 CCTGGGCTTTGGAGGGAACATGG + Intronic
934926892 2:98388448-98388470 CTTCGGCCCTGGAGGGGAGAGGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
936578183 2:113672565-113672587 CCCCGTCACTGGAGGGATGATGG - Intergenic
938271895 2:129979861-129979883 CCGCGGCTGGGAAGGGAAGGAGG - Exonic
938444106 2:131363939-131363961 CCGCGGCTGGGAAGGGAAGGAGG + Intergenic
938619077 2:133030827-133030849 CCGCTGCATTGGAGGGAATATGG - Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
945922820 2:215773302-215773324 CCTGGGCTCTGGAGTGAGGATGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946362459 2:219227694-219227716 CCGGGGCTCTGGTGGGAGGTGGG - Intronic
1168965451 20:1895422-1895444 CCGCGGCTGCGGAGCGAGGAGGG - Exonic
1169236570 20:3934409-3934431 GGGAGGCTCTGGAAGGAAGAGGG - Intronic
1170601488 20:17844783-17844805 CCGAGGCTGAGGTGGGAAGATGG - Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1173821530 20:46022892-46022914 CCTCGGGTCTGGAAGGAACAAGG + Intronic
1174305877 20:49614009-49614031 CCCAGGCTCTGGGGGGAAGGTGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176078978 20:63262283-63262305 CCTGGGCTCTGGCAGGAAGAGGG - Intronic
1176162230 20:63653672-63653694 CCGCGGCTCTCAGGGGGAGAGGG + Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179675073 21:42975213-42975235 CGGCGGCGCAGGCGGGAAGATGG + Intronic
1179999685 21:44989755-44989777 CAGCGGCTCTGGAGGGCATCGGG - Intergenic
1180998562 22:19977421-19977443 CAGCTGCTTTGGAGGCAAGAAGG - Exonic
1181295759 22:21837312-21837334 GCAGGGCTCTGGAGGAAAGAAGG + Intronic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1183591077 22:38779606-38779628 GCGGCGCTCTGGAAGGAAGAGGG + Exonic
1184711250 22:46250647-46250669 CCGCGGCGCGGGAGGGCAGGTGG - Exonic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1185394904 22:50581927-50581949 TCGCAGCTCTGGTGGGAGGAAGG - Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
956452403 3:69387237-69387259 CCGTGGCTGAGGTGGGAAGATGG - Intronic
957810077 3:85210644-85210666 CCGAGGCTCAGGTGGGAGGATGG - Intronic
960671364 3:120157866-120157888 CCGCAGTTCTGGAGTGATGAGGG + Intergenic
962810008 3:138951584-138951606 ACGGGTCTTTGGAGGGAAGAGGG - Exonic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
969392748 4:6901971-6901993 CAGCGGCTCTGGAGGGAGACAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
977574156 4:98658969-98658991 GCGCAGCTCTGGAGGGACGCGGG + Intergenic
978500606 4:109405532-109405554 TCGCTGCTTCGGAGGGAAGAGGG + Intergenic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
981366672 4:143912162-143912184 CGGCGGCTCCGGAGGGAAGGAGG - Intergenic
982982955 4:162164321-162164343 GCACAGCTCTGGAAGGAAGACGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
987374376 5:17219276-17219298 CCTCGGCTCGGGAGGGGAGTGGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
993507876 5:88733327-88733349 CAGAGGCTCTGGAGGGATGCAGG + Intronic
995355984 5:111238208-111238230 CCTAGGCTCTGGAGAGATGAAGG - Intronic
996531643 5:124533548-124533570 CAGCCACTCAGGAGGGAAGAAGG - Intergenic
998150780 5:139756338-139756360 CCGCGGCGCTGGAGGGAGTGGGG + Intergenic
999119807 5:149200509-149200531 CCACGGGCCTGGAGGGAAGTGGG + Intronic
999737123 5:154521236-154521258 GCGCTGCTCTGGAGGGAGCAGGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002255906 5:177958543-177958565 CCCCGGCTGTGGAGGCACGAGGG + Intergenic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1004923978 6:20402025-20402047 TCGGGGCTCTGGAGAGAGGAGGG - Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1013078722 6:106793828-106793850 TCAAGGCTCTGGAGGGAGGAAGG - Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1016032308 6:139350608-139350630 CCCCAGCTCTGGAAGCAAGAAGG - Intergenic
1016586022 6:145686981-145687003 CCATGGCCCTGGAAGGAAGATGG - Intronic
1019512737 7:1426116-1426138 CCGGGGCTCTGCAGGGACGTGGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020013581 7:4818791-4818813 GCGGGGCACTGGTGGGAAGAGGG + Intronic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022715312 7:32892565-32892587 AAGCGGCTCTGGAGAGAGGAGGG - Intronic
1024113913 7:46174077-46174099 CCCTGGCTCTGGAGTGAGGATGG + Intergenic
1027414306 7:77958694-77958716 CAGCCTCTCTGGAGGGAAGGTGG + Intergenic
1029124393 7:98286616-98286638 CCCCAGCACTGGAGGGCAGAAGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036815777 8:11902047-11902069 CCGAGGCTCAGGTGGGAGGATGG - Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1039546303 8:38413694-38413716 CAGCGGCTCATGAGAGAAGACGG + Exonic
1040857438 8:51962369-51962391 CAGCTGCTCTGGAAGGCAGAAGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042235939 8:66613269-66613291 CGGCGGCTCTTGAGGGAGGCTGG - Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1044771582 8:95641194-95641216 CCACAGCTGTGGAGGGCAGAGGG - Intergenic
1046021844 8:108674832-108674854 ACGCAGCTCTGGAGGGGAGGTGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1061249820 9:129420230-129420252 GCGGGGCCCTGGAGGGGAGATGG + Intergenic
1062000658 9:134214173-134214195 CCAGGGCCCTGGAGGGAAGGAGG + Intergenic
1062393774 9:136344381-136344403 TCACGGCTCTGGAGGCCAGAAGG + Intronic
1192141170 X:68647956-68647978 CCGCTGCTCAGGGGGGAAGGAGG + Intronic