ID: 1185074979

View in Genome Browser
Species Human (GRCh38)
Location 22:48678182-48678204
Sequence CCCTCTGCTGAGGGCTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185074964_1185074979 27 Left 1185074964 22:48678132-48678154 CCTCTTTCCTGAATTCTCTTTCC 0: 1
1: 0
2: 6
3: 82
4: 820
Right 1185074979 22:48678182-48678204 CCCTCTGCTGAGGGCTTCTGAGG 0: 1
1: 1
2: 1
3: 43
4: 316
1185074972_1185074979 6 Left 1185074972 22:48678153-48678175 CCTGGGGCGGCTGCTCTGGGCCC 0: 1
1: 0
2: 3
3: 55
4: 461
Right 1185074979 22:48678182-48678204 CCCTCTGCTGAGGGCTTCTGAGG 0: 1
1: 1
2: 1
3: 43
4: 316
1185074968_1185074979 20 Left 1185074968 22:48678139-48678161 CCTGAATTCTCTTTCCTGGGGCG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1185074979 22:48678182-48678204 CCCTCTGCTGAGGGCTTCTGAGG 0: 1
1: 1
2: 1
3: 43
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185074979 Original CRISPR CCCTCTGCTGAGGGCTTCTG AGG Intronic
900197889 1:1386323-1386345 CCTTCTGCCGAAGGCTTGTGAGG - Intronic
900357631 1:2272407-2272429 CCCCCAGCGGAGGGCTCCTGTGG - Intronic
900519910 1:3100528-3100550 GCCTCTGCTGGGGCCTCCTGAGG + Intronic
901808126 1:11750467-11750489 GACTCGGCTGAGGGCCTCTGTGG - Exonic
901941909 1:12668781-12668803 CCTTCTGGTAAGGCCTTCTGTGG - Intergenic
902220615 1:14962206-14962228 CCCTCAGCTGAGGACTTCCCAGG - Intronic
902570407 1:17343395-17343417 CCCTCTTCTGATAGCTTCAGGGG + Intronic
903240935 1:21982159-21982181 CCATCTTCACAGGGCTTCTGGGG + Intronic
903359529 1:22768062-22768084 CACACTGCTGAGGGCTGCGGAGG + Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904120484 1:28194516-28194538 CCTTCTGTTGAGGGCACCTGTGG - Intergenic
904449188 1:30600202-30600224 CCCTCTGATGATGGCTGATGTGG - Intergenic
905299324 1:36975723-36975745 CCCACTGCTGCGTGCTCCTGAGG + Intronic
905732137 1:40304555-40304577 ACCCCTGCTGAGAGCTGCTGAGG - Intronic
906656524 1:47552325-47552347 GCCTGGGCTGAGGTCTTCTGTGG + Intergenic
907579445 1:55558486-55558508 CCCTCTGATGAGGTGCTCTGTGG + Intergenic
909134497 1:71780867-71780889 CCCTCTTCTGAGCCCATCTGTGG + Intronic
911864708 1:103003130-103003152 CTCTCTACTGAGGGCTTTTATGG + Intronic
915003281 1:152613267-152613289 CCCTCAGCTGGGGGTGTCTGGGG + Intergenic
917511171 1:175670363-175670385 CCCTCTTCTGAGGGATGCTGTGG - Intronic
918625416 1:186651514-186651536 CACTCTGCTGTGTGCTGCTGGGG + Intergenic
918981442 1:191565216-191565238 CCCTCTCCTGAGAGCCTCAGAGG + Intergenic
919850328 1:201668057-201668079 CCTCCTGCTGAGGGATCCTGGGG + Intronic
920068766 1:203287747-203287769 CCCTCTGCTGAGGCTCTCAGAGG + Intergenic
920646777 1:207809514-207809536 ACCTCTGCTGAGGGTTCCTGAGG - Intergenic
921168967 1:212528700-212528722 CCATCTGCTGAGGATTTCAGGGG - Intergenic
921418255 1:214915858-214915880 CCCTCTGGTGATGTCATCTGGGG - Intergenic
921720646 1:218466821-218466843 CCATTTGCTGAGGGTTTCTCGGG + Intergenic
922795054 1:228335693-228335715 GCCCCTGCTCAGGGCTTCGGAGG + Intronic
1062768015 10:80207-80229 CCCTCTGCTCAGTGCCTGTGGGG - Intergenic
1064296199 10:14080923-14080945 CACTCTGCTGGGGGCCTATGTGG + Intronic
1065843631 10:29726788-29726810 CCCTGTGCTGAGGGCTTTGAGGG - Intronic
1067442628 10:46318143-46318165 CCCACTGCTGAGGGATCCTCCGG - Intronic
1069682735 10:70296756-70296778 GGCTCTGCCGAGGCCTTCTGGGG + Intergenic
1069899020 10:71696357-71696379 GCCTCCCCTGAGGGCTTCTCAGG + Intronic
1070391804 10:75977433-75977455 CCCTCTGTCCAGGGCATCTGGGG + Intronic
1071600695 10:86957485-86957507 CCCTGGGCTGGGGGCTGCTGGGG - Exonic
1071603187 10:86968886-86968908 CCCTCTCCTGAGGGCCTGGGCGG - Intronic
1071606005 10:86990423-86990445 CCCTGGGCTCAGGGCTACTGTGG + Intergenic
1072536218 10:96365582-96365604 ACCTCTGCTGTTTGCTTCTGGGG + Exonic
1073588445 10:104733172-104733194 CCCACTTCTCAGGGCTCCTGGGG - Intronic
1075786926 10:125056469-125056491 CACTCTTCTGAAGGCATCTGGGG - Intronic
1076321762 10:129588266-129588288 TCCTCTGCTAAGGGTTTCTCCGG - Intronic
1076332336 10:129679298-129679320 CCCTCTGCTGTGGGACCCTGCGG + Intronic
1076434060 10:130427539-130427561 ACTTCTCCTGAGGGCTTCTGTGG - Intergenic
1076615622 10:131752287-131752309 CCCACTGAAGGGGGCTTCTGGGG - Intergenic
1077032552 11:476055-476077 CTCCCTGCTCAGGGCCTCTGTGG - Intronic
1077158869 11:1103607-1103629 CCCGCTGCTCGGGGCTGCTGTGG + Intergenic
1079837203 11:25350095-25350117 TCCTCTCCTGAGGGCAGCTGTGG + Intergenic
1080503050 11:32888290-32888312 CCCCCTGCTGTGGGCTCCTGTGG - Intergenic
1080824045 11:35832961-35832983 CAGTCTGATGAGGGCTGCTGAGG + Intergenic
1083818695 11:65153144-65153166 CCGTCTTCTGAGGGTTTGTGTGG - Intergenic
1084952276 11:72673434-72673456 CCCTCTACTAAGGGCTGCCGAGG - Intronic
1085018887 11:73192629-73192651 CCCTTGGCTGGGGGCTTCTTAGG - Intergenic
1086119828 11:83294335-83294357 CCCTTTGCTGAGTCCTTCAGCGG + Intergenic
1087369619 11:97266415-97266437 GCATCTGGTGAGGGCTTCAGGGG + Intergenic
1088107839 11:106225960-106225982 CCGTCTCCTGTGGGCCTCTGAGG + Intergenic
1088704117 11:112446235-112446257 CACTCTGGTGAGGGCTAGTGGGG - Intergenic
1089190450 11:116649489-116649511 CCCTTGGCTCAGGGCTTCTTGGG + Intergenic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1090124872 11:124075369-124075391 CTCTCTGCTGAGAGCTGCAGAGG - Intergenic
1090616327 11:128518828-128518850 CCCTCTGCTGAGGGCGGGTGGGG + Intronic
1096370851 12:51067807-51067829 GGCCCTGCTGAGGGCTTCTGGGG - Exonic
1096491477 12:52015281-52015303 CCCGCTGCTCTGGGCTCCTGGGG - Exonic
1099674640 12:85742949-85742971 CCCTCTGCTAGGGCCTTATGGGG - Intergenic
1100025381 12:90121962-90121984 TCCTCTGCAGAGTGCTTATGTGG + Intergenic
1101125466 12:101629270-101629292 CCCTCTACTGATGGCTGCTGGGG + Intronic
1104314237 12:127682040-127682062 CCCTGTGCAGATGGCTTCTAGGG - Intergenic
1104624832 12:130343020-130343042 CCCTCTGCTGGTGGCGGCTGAGG - Exonic
1105068378 12:133218928-133218950 GCCTCTGGTGATGCCTTCTGGGG - Exonic
1105306480 13:19172571-19172593 CACACTGCCAAGGGCTTCTGGGG + Intergenic
1106015251 13:25863206-25863228 ACCTCTGCTCTGGCCTTCTGTGG + Intronic
1106109474 13:26763662-26763684 CACACTTCTGAGGGCATCTGCGG - Intergenic
1106457770 13:29942433-29942455 CACTGTACTGAGAGCTTCTGAGG - Intergenic
1106504409 13:30358499-30358521 GCCTCTGCTGAGGGCATCTGTGG - Intergenic
1106948466 13:34855172-34855194 CCATCAGCTGAGAGCTCCTGGGG + Intergenic
1107174646 13:37386230-37386252 ATCTCTGCTCAGGGATTCTGGGG + Intergenic
1107538627 13:41362791-41362813 CCCACAACTGAGGGCTGCTGAGG - Intronic
1107853486 13:44592327-44592349 CTCTCTGCTGAGCACTTCAGAGG + Intergenic
1107891929 13:44921579-44921601 CCCTCTGAAGAGGGCTGCGGCGG - Intergenic
1108604698 13:52025969-52025991 CACTCTGCTGAGCGCTTGGGTGG + Intronic
1108680917 13:52779457-52779479 CCCTTTGTGGAGGGCTGCTGTGG + Intergenic
1111354493 13:87080357-87080379 CCCTCTGGTAACTGCTTCTGAGG - Intergenic
1112288682 13:98126013-98126035 ACCTCAGCTGAGGGCTTCTCCGG + Intergenic
1113345623 13:109475231-109475253 CCCTATGCTGAGGAATTCTTTGG - Intergenic
1113525223 13:110969328-110969350 CCATCTCCTGTGGACTTCTGAGG + Intergenic
1113536094 13:111067356-111067378 GCCGCTGCTGAGCGCCTCTGCGG + Intergenic
1113935840 13:113995283-113995305 GCCTCTCCTGGGGGATTCTGGGG + Intronic
1114574500 14:23700022-23700044 CCCTCTGCTGATGGGGCCTGGGG + Intergenic
1114634328 14:24178831-24178853 CTCTCGCCTGAGGGCTTTTGGGG - Exonic
1114709785 14:24766717-24766739 CCCTCTGCTGAGTGCTCAAGCGG + Intergenic
1115364821 14:32546145-32546167 ACCTCTTCTGAGGTCTTGTGTGG - Exonic
1117496819 14:56313700-56313722 CACTCTGTTGAGAGTTTCTGAGG + Intergenic
1118006033 14:61564779-61564801 GCCTCTGCTGAGGCCTTCTTTGG - Intronic
1118805981 14:69237336-69237358 CCACCTGCTGTGGGCTTCAGTGG - Intronic
1119323751 14:73746509-73746531 CCCTCTGGTGAGGGCCTCCTGGG + Intronic
1121655445 14:95592173-95592195 CCCTGTGCTGAGGGGACCTGAGG - Intergenic
1122550430 14:102546167-102546189 CTCTCTGCTGGGGGCTGCTAAGG + Intergenic
1123626467 15:22230147-22230169 CCCTGTGCTGAGGGCGTCCCAGG + Intergenic
1124136809 15:27042472-27042494 CCCTCTGCTGCCAGCTTCAGAGG + Intronic
1124350824 15:28954472-28954494 CCTTCTGCAGGTGGCTTCTGCGG + Intronic
1125690031 15:41588569-41588591 CCATCTCCTGTGGACTTCTGAGG + Intergenic
1125744385 15:41988784-41988806 CCGTGGGCTGGGGGCTTCTGGGG + Intronic
1127774494 15:62254538-62254560 CCCCCTGCTGGGGGCTCCAGGGG + Intergenic
1128319858 15:66685525-66685547 CCCTCTTCTGTGGGCTTCCCTGG + Exonic
1128548472 15:68582960-68582982 CCCTCTCCTAAGGCCTTCTAAGG - Intronic
1128979415 15:72175627-72175649 CCCTCTGCTGGGGGAAACTGAGG - Intronic
1129071775 15:72957459-72957481 CCGTCTACTAAGGGTTTCTGGGG - Intergenic
1129186916 15:73913549-73913571 CCCTATGCTGAGGCTTTCTCAGG + Intergenic
1129652873 15:77504127-77504149 TCCTCAGCCGAGGCCTTCTGGGG + Intergenic
1131791904 15:95974131-95974153 CCCTCTGCTGCGGGGCCCTGAGG - Intergenic
1132456910 16:29163-29185 CCCTCTGCTCAGTGCCTGTGGGG - Intergenic
1132567025 16:628221-628243 CCCTCTCCTGAGTGCTGCTTGGG - Exonic
1133460938 16:5985599-5985621 CCCTCCCCTGGGGGCTGCTGGGG - Intergenic
1136067122 16:27766791-27766813 GCCTCTGCTGAGGGCTTCACGGG + Intronic
1136104290 16:28018497-28018519 GACTCTGCTGGGGGCTTTTGGGG - Intronic
1137532595 16:49289954-49289976 CCCTCTGTGGAAGGCATCTGAGG + Intergenic
1139824313 16:69745157-69745179 CCCTTTGCTGACAGCTTCAGTGG - Intronic
1140419536 16:74807272-74807294 CTCTTTGCTGAGAGCTTCAGAGG - Intergenic
1140925159 16:79575541-79575563 ACCTCTGCTGAGGGTTTCAAAGG + Intergenic
1141832847 16:86519386-86519408 CCCTCTGCTAAGGACATTTGTGG - Intergenic
1141977507 16:87527236-87527258 CCCTGTGCTGAGGGCGTCCCAGG - Intergenic
1141995987 16:87636575-87636597 CCCTCTGCTGTGGGGTGATGAGG + Intronic
1142004484 16:87682963-87682985 CCCTCTGCTGAGTCCTGCAGGGG - Intronic
1142031079 16:87838930-87838952 CCCTCTGCAGAGGACCTCTCAGG + Intronic
1142314723 16:89336414-89336436 CTGTTTGCTGTGGGCTTCTGTGG + Intronic
1142881065 17:2883031-2883053 CCCTCTTCTGAGGGAGGCTGCGG + Intronic
1143024989 17:3936298-3936320 GCCACTGATGAGGGCTTCTCGGG + Exonic
1144778165 17:17795272-17795294 CCCTTTGCTGATGCCATCTGAGG - Exonic
1145746395 17:27323397-27323419 CCCTATGTTAAGTGCTTCTGGGG - Intergenic
1146565023 17:33905475-33905497 TCCTCTGCTGCTGGCTTCAGAGG + Intronic
1146665845 17:34702828-34702850 CAATCTGCTGATGGCTTCTAGGG - Intergenic
1148002246 17:44396373-44396395 CAGTCAGCTGGGGGCTTCTGAGG - Intronic
1148049801 17:44764259-44764281 CCCACCGTGGAGGGCTTCTGGGG - Intronic
1149257846 17:54847509-54847531 TCCACTGCGGATGGCTTCTGTGG + Intergenic
1149290416 17:55213091-55213113 CTCTCTGCTGGAGGCTGCTGTGG - Intergenic
1149354752 17:55828336-55828358 TCCTCTGCTGAAGGATTCAGTGG - Intronic
1151964710 17:77425369-77425391 CCCGCACCTGAGGGCTTCAGAGG + Intronic
1151996446 17:77612262-77612284 CCCTCTGCCGAGTGCTGCAGGGG - Intergenic
1152288407 17:79425310-79425332 CCCACTGCAGAGGGTTACTGCGG - Intronic
1152395291 17:80029274-80029296 CTCTCTCCTTAGGGCTTCTGAGG - Intronic
1152599646 17:81255639-81255661 CCCTCTGCTGGGTGTTCCTGGGG - Intronic
1152605196 17:81286089-81286111 CCCTGGGCTGTGGGCTGCTGAGG - Intronic
1152852243 17:82644261-82644283 CCCACTGCAGGGGCCTTCTGTGG + Intronic
1157608458 18:48940835-48940857 CCATCTCCTGAGGGCTTCACAGG + Intronic
1157975556 18:52323326-52323348 CCCTGTGTTGAGAGCTGCTGAGG - Intergenic
1159001104 18:62975876-62975898 CACTCTGCAGAGGGCTGCTTTGG + Intronic
1160460118 18:79032752-79032774 GCCTGTGCTGATTGCTTCTGCGG + Intergenic
1160509147 18:79443693-79443715 CCTTCTGCCGACGGCATCTGTGG + Intronic
1160514980 18:79473188-79473210 CCAGCTGCCGAGTGCTTCTGGGG + Intronic
1160803125 19:979686-979708 CCCGCAGCTGAGGGCCTCAGAGG + Intergenic
1160942678 19:1627722-1627744 CCCCCTGGGCAGGGCTTCTGTGG - Intronic
1160953451 19:1678816-1678838 ACCACAGCTGAGGGCTCCTGAGG - Intergenic
1160955003 19:1687062-1687084 CCCTGGGCTGGGGGCTTCGGGGG + Intergenic
1163765397 19:19160815-19160837 CCCTCTCCTGGGGGCTCCAGCGG + Intronic
1165166866 19:33863233-33863255 GCCTCTGCTGAGGCCTTCCTGGG + Intergenic
1166276902 19:41760470-41760492 CCCTCTGCGGAGGGCAGGTGAGG - Intronic
1166742157 19:45121171-45121193 CTCTCTGCTGAGTGCCACTGGGG + Intronic
1167235097 19:48309379-48309401 CTCTCTGCTGAGAGCTTCAGAGG + Intronic
1168009912 19:53521724-53521746 CCCTCTGGTGTGAGCGTCTGTGG + Exonic
1168666440 19:58208514-58208536 CCCTCTCCTAAGGGCCCCTGTGG - Intronic
1168713013 19:58512429-58512451 CCCTCTCCTCAGGGTTTCAGTGG - Intergenic
925526523 2:4808957-4808979 GCCTCTGCTGTGGGCTTCAGTGG - Intergenic
925769409 2:7267548-7267570 CCCTTTGCTCAGGACTCCTGGGG - Intergenic
926117662 2:10223609-10223631 CTCTGTGGTGGGGGCTTCTGGGG + Intergenic
926778777 2:16448061-16448083 CCCTCTATTGAAGGCTTCTGGGG - Intergenic
928241684 2:29592133-29592155 CCAGCAGCTGATGGCTTCTGGGG + Intronic
928299547 2:30113197-30113219 CCCTCTCCTGAGATCTTATGGGG + Intergenic
928411613 2:31058534-31058556 CTGACTGCTGAGTGCTTCTGTGG - Intronic
928413504 2:31072148-31072170 CCCTCTGCTGTGGGGTGCAGAGG + Intronic
930897070 2:56458818-56458840 CCCTCTGCCAATGACTTCTGAGG + Intergenic
932443003 2:71749685-71749707 CCCTCTGCTGAGGTGCCCTGGGG + Intergenic
933389748 2:81654542-81654564 CCATCTCCTGTGGTCTTCTGAGG - Intergenic
933832763 2:86224189-86224211 CTGTCTGCTGAGGGATCCTGGGG + Intronic
934251791 2:90360923-90360945 CCCGCTGCTGCGGGTTTTTGCGG - Intergenic
934257646 2:91442031-91442053 CCCGCTGCTGCGGGTTTTTGCGG + Intergenic
934604504 2:95683484-95683506 ACCTCTGCCAAGGGCCTCTGAGG - Intergenic
934687587 2:96333212-96333234 CTCTCTGCTGAATGCATCTGAGG - Intergenic
937052241 2:118901962-118901984 CCATCCGCAGAGGGCTTCAGTGG - Intergenic
937262238 2:120594026-120594048 CCCTGAGCTCATGGCTTCTGCGG - Intergenic
938297975 2:130190268-130190290 CACACTGCGAAGGGCTTCTGGGG + Intronic
938407094 2:131038757-131038779 CCCTCTTCCCAGGGCTGCTGAGG + Intronic
938458790 2:131484397-131484419 CACACTGCCAAGGGCTTCTGGGG - Intronic
938586407 2:132694977-132694999 GTGTCTGGTGAGGGCTTCTGGGG + Intronic
938598456 2:132812599-132812621 CTCTCGGCAGAGGGGTTCTGGGG + Intronic
938641761 2:133288590-133288612 CACTCTGCTTATAGCTTCTGTGG + Intronic
940352529 2:152705268-152705290 CCATCTCCTGTGGACTTCTGAGG + Intronic
943857869 2:192821657-192821679 ACATCTGGTGAGGGCTTCAGGGG - Intergenic
945717452 2:213377548-213377570 CCCTCAGCTGAGGACTTCTTTGG + Intronic
946467031 2:219921178-219921200 CCCTCTGCTGAGGCATGCGGTGG - Intergenic
948825872 2:240573268-240573290 CCTCCTGCTGGGGCCTTCTGGGG + Intronic
948907476 2:240986704-240986726 CCCTCTGCTGTGTGCTGCTGAGG + Intronic
1168823896 20:795875-795897 CCGTCTCCTGTGGACTTCTGAGG + Intergenic
1169278327 20:4248218-4248240 CCCCCTGACGAGCGCTTCTGCGG - Exonic
1173037333 20:39424888-39424910 TCCTCTGCTGAGGTCTCATGGGG + Intergenic
1174465364 20:50713011-50713033 GCCTCTGCTGAGGGCTACAGGGG - Intergenic
1175253929 20:57627454-57627476 CCATCTGCTGATGACTTCTGCGG + Intergenic
1175403032 20:58711323-58711345 CCCTGTGCTGAGGCCTCCTGTGG - Intronic
1175518257 20:59583050-59583072 CCCCCGGCTGAGGACTTCTCAGG - Intronic
1175689376 20:61054567-61054589 CTCTCTGCAGTGGGCCTCTGAGG - Intergenic
1175931050 20:62493854-62493876 GCCTCTGCGCAGGGCCTCTGTGG + Intergenic
1175941620 20:62539975-62539997 CACTGTGCCAAGGGCTTCTGGGG + Intergenic
1176240690 20:64074592-64074614 CCATGTGCTGAGGGCCTGTGTGG - Intronic
1176374833 21:6081871-6081893 CGCTGTGCTGAGCGCCTCTGTGG + Intergenic
1177424859 21:20909387-20909409 CCCTCTGCTCAGTGCAGCTGGGG + Intergenic
1178429664 21:32508330-32508352 GGCCCTGCTGTGGGCTTCTGGGG + Intronic
1178799655 21:35780715-35780737 CCCACTGCAAAGGGCCTCTGGGG + Intronic
1178908884 21:36658515-36658537 TCCTCAGCTCAGGGCTTCTGAGG - Intergenic
1179065826 21:38024134-38024156 CCCAGTGCTCAGAGCTTCTGTGG + Intronic
1179261571 21:39762784-39762806 CCCTCTGATGAGGGTTTGTAGGG + Intronic
1179414516 21:41187305-41187327 CTCTCTGCAGATGGCTTCTTTGG - Intronic
1179445219 21:41426140-41426162 CCCTGTGCTGAGGGCGGCTCCGG - Intronic
1179447800 21:41445353-41445375 CCCTCTGCAGAGGAGTTGTGTGG - Intronic
1179480910 21:41678101-41678123 GTCTCTGCTGGGGGCTTCTGAGG + Intergenic
1179748642 21:43456374-43456396 CGCTGTGCTGAGCGCCTCTGTGG - Intergenic
1180246737 21:46553498-46553520 CTCTCTGCTGAGGGGCACTGGGG - Intronic
1181041575 22:20194994-20195016 CCAGGAGCTGAGGGCTTCTGGGG - Intergenic
1182068061 22:27444151-27444173 CCCTATGCAGGGGGCTTCTAAGG - Intergenic
1182626203 22:31648376-31648398 TCCCCTACTGAGGGCTTCTGAGG - Intronic
1182754333 22:32666594-32666616 CCCTCTCATGAGGCCTTCTCTGG + Intronic
1183653923 22:39174398-39174420 CCCTCTACTGAAGGCTTTGGGGG - Intergenic
1183896418 22:40973019-40973041 CTCTGTACTGTGGGCTTCTGAGG + Exonic
1184064675 22:42111157-42111179 CCGTCTCCTGTGGACTTCTGAGG - Intergenic
1184187497 22:42874602-42874624 GGCTCTCCTGAGGGCTTCTCTGG + Intronic
1184978965 22:48082467-48082489 CCCGCTGCTGAGGGCTTGGGTGG + Intergenic
1185041544 22:48506950-48506972 CCCTCTGCTGTGGGCTGGAGGGG - Intronic
1185074979 22:48678182-48678204 CCCTCTGCTGAGGGCTTCTGAGG + Intronic
1185086394 22:48743168-48743190 CCCTCTGCTGCTGCCTCCTGCGG - Intronic
949856331 3:8464804-8464826 GGCCCTGCTGAGGGCTTCTGGGG - Intergenic
950763805 3:15258330-15258352 CCATTTGCTGAGTGCTTCTTGGG + Intronic
950849091 3:16045037-16045059 CCCTCTGCTAAGTGCTTCATAGG + Intergenic
951648679 3:24923624-24923646 CCCTAAGCAAAGGGCTTCTGTGG - Intergenic
952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG + Intergenic
952652037 3:35738514-35738536 TCCCATGCTGAGTGCTTCTGTGG + Intronic
952998148 3:38905098-38905120 TCCTTTGCAGAGGGCTTCTAGGG + Intronic
954621776 3:52000566-52000588 CCCTCACCTGAGGCCTTGTGGGG - Intergenic
954639633 3:52090343-52090365 AACTTTGCTGTGGGCTTCTGAGG + Intronic
956391615 3:68779500-68779522 CCCTCTGCTGTGTGCATCTAGGG + Intronic
957593567 3:82231447-82231469 CACTCTAATGAGGGATTCTGGGG + Intergenic
957845144 3:85722092-85722114 CTCTCTGCTGAGAGCTGCGGAGG - Intronic
959638455 3:108603129-108603151 CCCTCTGCTAAGCTCTTCTTTGG - Intronic
961582576 3:127894712-127894734 CCCTCTCCTGTGGACTTCTGAGG + Intergenic
961639207 3:128354358-128354380 CCTTCTGAGGAGGGCCTCTGGGG - Intronic
962713124 3:138103934-138103956 GCCACTGCTGAGGGCCTCAGTGG - Exonic
964430977 3:156605799-156605821 TCCTCTGCTGAGGGCTGGAGAGG + Intergenic
964616561 3:158672675-158672697 CCCTGGGCTGACTGCTTCTGAGG + Exonic
965322995 3:167270404-167270426 CCATCTCCTGTGGACTTCTGAGG + Intronic
965468739 3:169064181-169064203 CCCTCTCCTCAGGGATTATGAGG + Intergenic
966491522 3:180532340-180532362 CTCTCTGCTGAGAGCTGCAGAGG + Intergenic
966945655 3:184775474-184775496 CTCTCTGCTGTGGCCTTGTGAGG + Intergenic
969337664 4:6521241-6521263 CCTGCTGGTGAGGGCTTTTGGGG + Intronic
969429571 4:7146277-7146299 CCCATTGCTGTGGGCTCCTGAGG + Intergenic
969686164 4:8675487-8675509 CTCTCTGGTGAGGGCTGTTGAGG + Intergenic
971938762 4:33188432-33188454 CTCTCTGCTGAGAGGTTCAGAGG - Intergenic
972694869 4:41435204-41435226 CCCTCTTATAAGGACTTCTGTGG - Intronic
974640345 4:64622846-64622868 AAGTCTGCTGAGGGCTTTTGTGG + Intergenic
975454872 4:74578243-74578265 TCCTCTGGTAAGGGCGTCTGAGG - Intergenic
976675453 4:87697674-87697696 CTCTCTGCTGAGAGCTTCAGAGG - Intergenic
978460826 4:108950134-108950156 CCCTTTGCTTAGGGCCTCAGAGG + Intronic
979649473 4:123114086-123114108 CTCTCTGCTGAGAGCTGCTGAGG - Intronic
984342215 4:178471621-178471643 GCCTCTGGTGAGGTGTTCTGAGG - Intergenic
984616836 4:181907694-181907716 CCCTCCTCTGAGAGCTTGTGGGG - Intergenic
984647253 4:182233067-182233089 CCCTCTCCTGTGCACTTCTGAGG - Intronic
984993324 4:185403365-185403387 CCCTGTGTGGAGGCCTTCTGAGG - Intronic
985650734 5:1106033-1106055 CCATCAGCTGAGTGTTTCTGAGG - Intronic
987088142 5:14488050-14488072 CCTTCTGCAGGGGGCTGCTGGGG - Exonic
987993202 5:25242174-25242196 CCCTCTGCAGGGGTCTTTTGTGG + Intergenic
988020482 5:25614638-25614660 CCCCCTGCAGTGGGCTCCTGTGG - Intergenic
988489617 5:31695264-31695286 CCCCCGGCTCAGGGCTGCTGAGG + Intronic
988507790 5:31839017-31839039 CTTTCTGGTGAGAGCTTCTGGGG - Intronic
989613822 5:43319877-43319899 CCGTCTCCTGTGGACTTCTGAGG - Intergenic
991924890 5:71695390-71695412 ACCTCACCTTAGGGCTTCTGTGG + Intergenic
992423170 5:76627105-76627127 CCCTCTGTAGAGGGCCACTGTGG + Intronic
993721195 5:91323337-91323359 CCCTATCCTGTGGTCTTCTGTGG - Intergenic
995023800 5:107396513-107396535 CACCCAGCTGAGGGCTTCTGAGG + Intronic
995696502 5:114883907-114883929 CTCTCAGCTGAGGCCTCCTGTGG + Intergenic
995863850 5:116669824-116669846 CCCTCTGCTGAGGGCATCCCAGG + Intergenic
996540881 5:124629333-124629355 CCCTCTGCTGAGGGCTGCTGAGG - Intergenic
996800388 5:127396621-127396643 CACTGTGCTGCGGGCTTCCGGGG + Exonic
997732232 5:136190234-136190256 CCTTGGTCTGAGGGCTTCTGAGG - Intergenic
999014759 5:148089674-148089696 CTCTCTGCTGAGTGATTCTCGGG - Intronic
999859955 5:155634070-155634092 CCCTCTGCTGAGAGCTGCAGAGG + Intergenic
1000388874 5:160701930-160701952 CCCTCTCCCGAGGGCCTCTTGGG + Intronic
1001090430 5:168736310-168736332 CCATCTGCTGAGGTCTTCTCTGG + Intronic
1001419164 5:171573862-171573884 AGCTCTCCTGAGGGCTCCTGTGG - Intergenic
1001754390 5:174157224-174157246 TCCTCTGCTTTGGGCCTCTGTGG + Intronic
1003714310 6:8629528-8629550 CCCTCTTCTGAAGGATGCTGGGG + Intergenic
1005030094 6:21500543-21500565 CCCTCTGCTAATCACTTCTGTGG - Intergenic
1006250604 6:32780260-32780282 CCCTCTGCTGAGTTCTGATGAGG + Intergenic
1006347994 6:33498445-33498467 CTCTCTGCTGAGACCTTCAGAGG + Intergenic
1007176840 6:39902955-39902977 CCCTCTGCTGAGGGGCTGTAGGG - Exonic
1012298624 6:97556074-97556096 CCCTCTTCTGAGGGGTTGAGTGG + Intergenic
1017444653 6:154496407-154496429 GCCTCTCCTGCGGGCTGCTGTGG - Intronic
1018529181 6:164744653-164744675 ATCTCTGCTGTGTGCTTCTGGGG + Intergenic
1018969472 6:168516579-168516601 CGCTTTGCTGAGGGCTGTTGAGG - Intronic
1019017536 6:168890792-168890814 GCCCCTGCTGAGGGCTTCAGGGG + Intergenic
1019134417 6:169899293-169899315 CGCTCTGCTGAGGCCCTGTGGGG + Intergenic
1019322848 7:423456-423478 GCGTCTGCTGAGGGCTTCCTGGG - Intergenic
1020354696 7:7263648-7263670 CCCTCAGCTGAGTTCTTCTCAGG - Intergenic
1021133910 7:16943270-16943292 CCCACTGCTGTGGGCTCCTGTGG + Intergenic
1022088499 7:27092156-27092178 CCCTCAGCTGCTGGGTTCTGAGG - Intergenic
1023640062 7:42248583-42248605 CCCTCTGCTGAGTTCTTCCTTGG + Intergenic
1023869039 7:44252788-44252810 CCCCCTGCTCTGAGCTTCTGGGG - Intronic
1024308145 7:47945381-47945403 CCCTCTGGTGGCGGCTTCTTGGG - Intronic
1024575373 7:50759329-50759351 CCATCTGCTGCCCGCTTCTGTGG - Intronic
1026887817 7:73964753-73964775 CCCTCTGATTGGGGCTTCTCAGG - Intergenic
1026907341 7:74070033-74070055 GCCCCTGCTGCTGGCTTCTGGGG + Intergenic
1027202914 7:76074202-76074224 CCTGCTGCTGATGGCCTCTGCGG - Intergenic
1027241933 7:76336339-76336361 CCCTCTGGTGGGGGCTGCTGAGG + Intronic
1027247960 7:76379992-76380014 CGCACTCCTCAGGGCTTCTGGGG - Intergenic
1029220891 7:98989384-98989406 CCCTGAGCTCAGGGCTGCTGGGG - Intronic
1029280668 7:99433457-99433479 CTCTCTGCTGAGGGTCTCTGGGG - Intronic
1030075879 7:105736130-105736152 CCCTCTTCTGTGGGCTTCCCAGG + Intronic
1032559617 7:132874973-132874995 TCCTAATCTGAGGGCTTCTGAGG - Intronic
1033097820 7:138446263-138446285 CCATCTCCTGTGGACTTCTGAGG - Intergenic
1033648083 7:143320423-143320445 CCCTCTGCTGATTGCTGCTCCGG - Intronic
1033823998 7:145167162-145167184 CCCTCTGCTGAGTAGATCTGTGG + Intergenic
1034943621 7:155248174-155248196 CCCTGAGCTGAGGACATCTGGGG - Intergenic
1036224130 8:6943867-6943889 CCTTCTTCTAGGGGCTTCTGAGG + Intergenic
1037463796 8:19139423-19139445 TCCCCTGCTTGGGGCTTCTGGGG - Intergenic
1037639880 8:20732816-20732838 ACCTCTGCTGGGGGTTTGTGGGG + Intergenic
1037954365 8:23042622-23042644 CCCTCTGCTGAAAACTTCTCAGG + Intronic
1038014027 8:23498122-23498144 CCCTCTGCTGTGGTCTACTCAGG + Intergenic
1038598788 8:28916222-28916244 ACATCTGCTGAGGGATTCTGGGG - Intronic
1038643020 8:29342465-29342487 ATCTCTGCTGAGGGCATCCGAGG - Intronic
1039220943 8:35329947-35329969 CACCCTGCTGAGTGCTTCAGTGG + Intronic
1041453496 8:58032837-58032859 CCCTAAGCTGAGAACTTCTGTGG + Intronic
1041720417 8:60970290-60970312 CCCTCTGCTGAGCTCTCCTCAGG + Intergenic
1042916255 8:73878656-73878678 CCCTCAGCTCAGGGCGTCGGGGG - Intronic
1047172215 8:122504684-122504706 GCTTCTGCTGAGAGCTTCAGTGG + Intergenic
1048477222 8:134754639-134754661 GCCTCTGCTGTGGTCCTCTGTGG + Intergenic
1048872675 8:138812291-138812313 CACCCGGCTCAGGGCTTCTGTGG - Intronic
1048965846 8:139613945-139613967 GCCTCTGCAGAGGGCTTCAAAGG + Intronic
1049353050 8:142174502-142174524 CCCTCTGCTGCCTGCTTCTCAGG + Intergenic
1049412687 8:142480398-142480420 TCCTCTGCTCAGAGCTGCTGTGG + Intronic
1054858917 9:69929938-69929960 CCATCTCCTGTGGACTTCTGAGG - Intergenic
1056808701 9:89747702-89747724 CCATTTGCTGCTGGCTTCTGTGG + Intergenic
1056931740 9:90883447-90883469 ACCACTGCTGAGGGCTGCTGTGG + Intronic
1057885529 9:98826843-98826865 CCGGCTGCTGGGGGCGTCTGCGG + Exonic
1058111697 9:101037429-101037451 CTCTCTGTCGAGGGGTTCTGGGG + Intronic
1059041389 9:110819074-110819096 CCTTCTGGTGAGTGCTTCTGGGG - Intergenic
1059700945 9:116775195-116775217 TCCTCTGCTGAGGGACTCAGTGG - Intronic
1059955909 9:119515744-119515766 CCCTCAGCACAGGGCTTGTGGGG + Intronic
1060210998 9:121710329-121710351 GGCTCTGCTGGGGGCTGCTGTGG + Intronic
1060402568 9:123357056-123357078 GCCTGTGCTGAGGGCTGCTGGGG + Intronic
1060819911 9:126655285-126655307 CCCTTCGATGAGGGCATCTGAGG + Intronic
1061882476 9:133575152-133575174 CCCTCGGCTGGGGGCTGCTGGGG - Exonic
1186416430 X:9386893-9386915 CAATCTGCTGGGGACTTCTGGGG - Intergenic
1186474889 X:9849528-9849550 CTCTCTGCTGAGTGCTCCTGGGG + Intronic
1188245340 X:27830966-27830988 CCCTCTGCTCGGGGGTTCGGGGG - Intergenic
1189096777 X:38148856-38148878 TCCTCTGCTGAGATCTTATGGGG + Intronic
1192064627 X:67868755-67868777 CCGTGTGCTGTGTGCTTCTGTGG + Intergenic
1192503652 X:71668377-71668399 CCTTCCGCGGAGGGCTGCTGGGG - Intergenic
1193914716 X:87351228-87351250 TCCTCTGCTGAGGTCATCTTTGG + Intergenic
1193953996 X:87835757-87835779 GATTCTGCTGAGGGCTTCTATGG - Intergenic
1196763910 X:119225731-119225753 CCCTCTGTTATGGGCTTCTGGGG + Intergenic
1198871491 X:141180580-141180602 CCCTCTGCTGTGGGGTTGTAGGG - Intergenic
1199359995 X:146906983-146907005 CTCTCTGCTGAGAGCTTCAGAGG - Intergenic
1199871405 X:151901953-151901975 CCCTCTTCTCAGTGTTTCTGTGG - Intergenic
1200399450 X:156010560-156010582 CCCTCTGCTCAGTGCCTGTGGGG + Exonic
1200977326 Y:9227199-9227221 CCCTCCACTAAGGGCTTCAGAGG - Intergenic
1202592191 Y:26497223-26497245 CTTTCTGCTGAGGGCTCCTCTGG - Intergenic