ID: 1185075569

View in Genome Browser
Species Human (GRCh38)
Location 22:48680363-48680385
Sequence TGCATGGCGGGTACAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185075569_1185075580 13 Left 1185075569 22:48680363-48680385 CCTCCTGCTGTACCCGCCATGCA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1185075580 22:48680399-48680421 TCCCTGCTGCCGGGGCCCTGTGG 0: 1
1: 0
2: 9
3: 42
4: 419
1185075569_1185075577 5 Left 1185075569 22:48680363-48680385 CCTCCTGCTGTACCCGCCATGCA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1185075577 22:48680391-48680413 CTGCCCAGTCCCTGCTGCCGGGG 0: 1
1: 1
2: 2
3: 43
4: 368
1185075569_1185075576 4 Left 1185075569 22:48680363-48680385 CCTCCTGCTGTACCCGCCATGCA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1185075576 22:48680390-48680412 CCTGCCCAGTCCCTGCTGCCGGG 0: 1
1: 0
2: 5
3: 99
4: 706
1185075569_1185075574 3 Left 1185075569 22:48680363-48680385 CCTCCTGCTGTACCCGCCATGCA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1185075574 22:48680389-48680411 GCCTGCCCAGTCCCTGCTGCCGG 0: 1
1: 0
2: 6
3: 62
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185075569 Original CRISPR TGCATGGCGGGTACAGCAGG AGG (reversed) Intronic
900642625 1:3694701-3694723 TGCATGGCTGGGATTGCAGGAGG - Intronic
900642644 1:3694771-3694793 TGCATGGCTGGGATTGCAGGAGG - Intronic
900642663 1:3694842-3694864 TGCATGGCTGGGATTGCAGGAGG - Intronic
900642692 1:3694947-3694969 TGCATGGCTGGGATTGCAGGAGG - Intronic
900768857 1:4524651-4524673 TTCATGGTGGGTAGAGGAGGAGG + Intergenic
902700553 1:18169213-18169235 TCCATGGCGGATCCAGCTGGTGG - Intronic
902735640 1:18399009-18399031 GGCATAGGGGATACAGCAGGAGG + Intergenic
903469288 1:23574496-23574518 AGCATAGCGGGTACTGAAGGGGG - Intergenic
904752526 1:32749820-32749842 TGCAGGGAGGGTACAGTATGGGG - Intronic
906145853 1:43560070-43560092 TGCATGGTATGTACAGCAGATGG + Intronic
906172079 1:43734959-43734981 TGCATAGCAGGTACAGTAGCAGG + Intronic
906487508 1:46243154-46243176 TGCTTGGGAGGTACAGTAGGAGG - Intergenic
907914270 1:58854150-58854172 TGCATGGCAGGTCCAGGAGCTGG - Intergenic
911211416 1:95142623-95142645 TGCATGGGGTGTACAACAAGTGG - Intronic
914717122 1:150262427-150262449 TGCCTGCCGGGGACAGCGGGGGG + Intronic
920077000 1:203344502-203344524 AGCAGGGCGGGTACACCAGTAGG - Intronic
1063306701 10:4909322-4909344 TTCATGGCCTGTGCAGCAGGAGG + Intergenic
1063905057 10:10773021-10773043 TGAATGGGGGGGACAGCAGAAGG + Intergenic
1070435718 10:76390708-76390730 TGAATGCTGGGTACAGTAGGGGG + Intronic
1073669223 10:105568809-105568831 TGCATGGAGTGTACACCAAGTGG + Intergenic
1074926194 10:118074588-118074610 TGCATGACGGGAATAGCAGAAGG - Intergenic
1075712493 10:124538073-124538095 CGCATGGCGGGCCCCGCAGGTGG - Intronic
1076624957 10:131816075-131816097 TGCATGGCGGGGACACAGGGAGG - Intergenic
1077509000 11:2945878-2945900 TTCATGGCATGTTCAGCAGGAGG + Intronic
1080008800 11:27436892-27436914 TGCATTGCGGGGATAGGAGGGGG + Intronic
1080875959 11:36274508-36274530 AGGATGGTGGGGACAGCAGGGGG - Exonic
1081668609 11:44931065-44931087 GGACTGGCGGGCACAGCAGGAGG - Exonic
1085711202 11:78830524-78830546 GGCATGGAGGGCTCAGCAGGGGG - Intronic
1090657049 11:128854193-128854215 TGCTTGGCTGGTGCAGTAGGAGG - Intronic
1091763633 12:3104124-3104146 TTCAAGGCTGGTACAGCTGGAGG + Intronic
1093917665 12:24823699-24823721 TACATGGTGGGAACAGGAGGAGG - Intronic
1101579256 12:106027103-106027125 TGCAGGGCAGGTTCAGCAAGAGG + Intergenic
1104850127 12:131868711-131868733 TGCAGGGGCGGCACAGCAGGTGG + Intergenic
1105871314 13:24507899-24507921 TGGATGGGGGATACAGCATGGGG - Intronic
1106457483 13:29939734-29939756 TGCATGGCAGGTACTGTAGCTGG - Intergenic
1107719131 13:43229641-43229663 TGTATGGAGGGTAGAGCAGAGGG + Intronic
1112271818 13:97976235-97976257 TGCGTCGCGGGGACAGCGGGAGG - Intronic
1112363947 13:98741242-98741264 TTCATGGCGGTCCCAGCAGGAGG - Intronic
1119676777 14:76561697-76561719 TGCATGGGGTGTACACCAAGTGG - Intergenic
1120286940 14:82515137-82515159 TGCATGGGGTGTACACCAAGTGG + Intergenic
1122797959 14:104215877-104215899 TGGATGGCGGGTATGGCAGATGG + Intergenic
1122862534 14:104588950-104588972 GACATGGGGGGCACAGCAGGCGG + Exonic
1123401273 15:19989623-19989645 ATCAGGGCAGGTACAGCAGGTGG - Intergenic
1123440797 15:20289712-20289734 TTCATGGCAGGGGCAGCAGGTGG + Intergenic
1125386542 15:39142721-39142743 TACATGGCTGGCAGAGCAGGAGG - Intergenic
1128638801 15:69320160-69320182 TCCAGGGTGGGTGCAGCAGGCGG - Intronic
1129339423 15:74875289-74875311 TGCATGGCTGGAACAGTGGGTGG - Intergenic
1131528106 15:93168226-93168248 AGCATGCAGGGTAGAGCAGGGGG - Intergenic
1132046630 15:98568147-98568169 TGCCTGGCCGGTACACCATGCGG - Intergenic
1132381069 15:101367070-101367092 TGCAAGGAGGGTACTGCTGGGGG - Intronic
1132876925 16:2144124-2144146 TGCCTGGCGGGAACAGGAGTAGG + Intronic
1134083974 16:11343835-11343857 TGAATGCCTGGTACTGCAGGAGG + Intronic
1136020312 16:27436014-27436036 TGAAAGGCGGGTACAGTGGGCGG - Intronic
1136431132 16:30197199-30197221 TGCAGGGCGGATACTGGAGGGGG + Intronic
1136726058 16:32358678-32358700 TTCATGGCAGGGGCAGCAGGTGG - Intergenic
1136844390 16:33564723-33564745 TTCATGGCAGGGGCAGCAGGTGG - Intergenic
1137070341 16:35899363-35899385 GGCATGGAGGGCATAGCAGGTGG + Intergenic
1137292455 16:47061218-47061240 CCCAGGGAGGGTACAGCAGGCGG - Intergenic
1137393716 16:48102291-48102313 TGCATGGGGCGTACACCAAGTGG + Intronic
1138435960 16:57000232-57000254 AGCCTGGCTGGGACAGCAGGTGG - Intronic
1138496752 16:57413525-57413547 TGCATGGTGGCTTGAGCAGGGGG - Intronic
1139490024 16:67280976-67280998 TGCTTCGCAGGTACAGCAGGAGG - Exonic
1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG + Intronic
1142157047 16:88537416-88537438 TGCATGGTGGGGACAGTAGGGGG - Intergenic
1203000373 16_KI270728v1_random:159078-159100 TTCATGGCAGGGGCAGCAGGTGG + Intergenic
1203131975 16_KI270728v1_random:1695481-1695503 TTCATGGCAGGGGCAGCAGGTGG + Intergenic
1203154557 16_KI270728v1_random:1865022-1865044 TTCATGGCAGGGGCAGCAGGTGG - Intergenic
1142872277 17:2828637-2828659 GGCATGGCTGGGAGAGCAGGTGG + Intronic
1144579546 17:16450679-16450701 AGCAAGGCGGGTGAAGCAGGAGG + Intronic
1149348102 17:55758944-55758966 TGTATGGCGATTACAGGAGGTGG + Intronic
1150347478 17:64415319-64415341 TGCATGGAAGGTAAAGCTGGGGG - Intergenic
1151886128 17:76924263-76924285 GGCCTGGGGGGTCCAGCAGGAGG + Intronic
1157164113 18:45342360-45342382 TGGAAGGCAGGAACAGCAGGGGG + Intronic
1160990420 19:1858091-1858113 TGTTTGGCGGGAACAGCAGGGGG - Intronic
1161014098 19:1974927-1974949 TGCATCGCGAGTACTGCCGGAGG + Intronic
1164450777 19:28362444-28362466 TGCAGGGCAAGTACAGCTGGAGG + Intergenic
1164457702 19:28422124-28422146 TGCATGGGGTGTACACCAAGTGG - Intergenic
925084683 2:1099070-1099092 TGCATGGAGTTTACCGCAGGGGG - Intronic
925379368 2:3414547-3414569 TGCACAGCGGGGACAGCTGGGGG - Intronic
926081985 2:9994779-9994801 GGCATGGAGGGTCCAGCAGGTGG - Intronic
927072314 2:19543514-19543536 TGCATGGCTGGAGGAGCAGGTGG - Intergenic
927708294 2:25310465-25310487 TGGATGGCGGGTAGGGCAGGCGG + Intronic
930063648 2:47311128-47311150 TGCATGGCAGGACCAGGAGGTGG + Intergenic
930768302 2:55107528-55107550 TGCCTGGCTGGTACATCTGGGGG + Intronic
931794178 2:65693522-65693544 TGCTTGGCGTGGATAGCAGGAGG + Intergenic
932797913 2:74713605-74713627 AGCATGGAGGGGGCAGCAGGAGG - Intergenic
933265164 2:80173745-80173767 TGCATGGCGTCTGCATCAGGAGG + Intronic
934319829 2:91961903-91961925 TTCATGGCAGGGGCAGCAGGTGG + Intergenic
934899718 2:98149458-98149480 TGCATGGGGTGTACATCAAGCGG - Intronic
936041023 2:109149583-109149605 TGCATGCAAGGTCCAGCAGGAGG + Intronic
937231633 2:120401376-120401398 GGCAAGGTGGTTACAGCAGGAGG + Intergenic
938228976 2:129641518-129641540 CACATGGCAGGGACAGCAGGAGG + Intergenic
945802317 2:214448984-214449006 TGGATGACGGGAACAGCAGGAGG - Intronic
946417840 2:219549506-219549528 GGCTTGGCGGGTCCAGCTGGTGG + Intronic
947845874 2:233243360-233243382 TGCATGGAGGGCAGAGCAGCCGG + Intronic
948209414 2:236181471-236181493 TGCCTGGCGTGGACAGGAGGTGG + Intergenic
948718222 2:239879983-239880005 TCCAAGGCAGGTACAACAGGGGG + Intergenic
1168792136 20:585139-585161 TGCAGGGCGGGCAGAGCTGGGGG + Intergenic
1169908912 20:10631157-10631179 TGCATGGAGGGCAAGGCAGGTGG - Intronic
1169981618 20:11391213-11391235 TGCATGATGAGTACACCAGGAGG + Intergenic
1172047656 20:32092049-32092071 TGCAAGGGGTGGACAGCAGGGGG - Intronic
1173110316 20:40181346-40181368 TCCATGGGGGATACAGAAGGGGG + Intergenic
1173270334 20:41528294-41528316 TACATGGCTGGTATAGCTGGAGG - Intronic
1174627549 20:51927926-51927948 TGCAGGGAGAGGACAGCAGGGGG + Intergenic
1175910837 20:62404805-62404827 CCCATGGTGGGTACGGCAGGAGG + Intronic
1180308079 22:11145947-11145969 TTCATGGCAGGGGCAGCAGGTGG + Intergenic
1180546555 22:16507760-16507782 TTCATGGCAGGGGCAGCAGGTGG + Intergenic
1182212628 22:28689594-28689616 TTCATGGCAGGGGCAGCAGGTGG - Intronic
1185075569 22:48680363-48680385 TGCATGGCGGGTACAGCAGGAGG - Intronic
1185269189 22:49920850-49920872 TGCATGCCAGGGACAGCAGCAGG - Intronic
952919214 3:38273492-38273514 TGAATGGTGGGTACTTCAGGGGG + Intronic
953982309 3:47418891-47418913 TGGCTGGCGAGCACAGCAGGAGG - Intronic
956653862 3:71530545-71530567 TGTATGGAGAGTATAGCAGGAGG + Intronic
960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG + Exonic
965543866 3:169896050-169896072 AGCATGCCTGGTACTGCAGGTGG + Intergenic
968955767 4:3718295-3718317 TTCACGTCAGGTACAGCAGGTGG + Intergenic
969293046 4:6252801-6252823 TGCCTGGGTGATACAGCAGGTGG + Intergenic
969525928 4:7704091-7704113 TGCCCGGCGGGTCCAGCTGGAGG - Intronic
969618512 4:8267341-8267363 TGCAGGGCGGGAGCAGCAGGGGG + Intergenic
970175278 4:13333154-13333176 TGCATGGGGTGTACATCAAGTGG + Intergenic
971289309 4:25321931-25321953 TGCATGGCTGGAACTACAGGTGG - Intronic
975668097 4:76754021-76754043 TGCATGGTGTGTACAGGATGTGG + Intronic
975692864 4:76983085-76983107 TGCAGAGCGTGTACACCAGGGGG - Intronic
977676801 4:99757114-99757136 TGAAGCGCGGGTAAAGCAGGAGG + Intergenic
983750680 4:171265630-171265652 TGCAGGGTGGATTCAGCAGGAGG + Intergenic
985660499 5:1154855-1154877 TGCCAGGCGGGAACAGCAGATGG + Intergenic
985908610 5:2862170-2862192 TGGATGGCAGGTCCAGCTGGAGG - Intergenic
986284347 5:6348637-6348659 TGCTTGGCGGGGGCTGCAGGAGG + Intergenic
986898590 5:12402890-12402912 TGCATAGTGGGAACACCAGGAGG - Intergenic
998648326 5:144089574-144089596 TGCATGTAAGGTACAGCAGTAGG + Intergenic
1000296357 5:159916460-159916482 TGCACGGCGGTGACATCAGGCGG - Intergenic
1001121625 5:168985593-168985615 TGCATGGTGGGCGCAGCATGTGG + Intronic
1002082887 5:176748079-176748101 TGCATCTGGGGTGCAGCAGGGGG - Intergenic
1005754320 6:28911933-28911955 TGGATGGTGGGTACTGAAGGAGG - Intronic
1011083626 6:83515272-83515294 TGCATGGCGGAGTTAGCAGGTGG + Intronic
1015956661 6:138606120-138606142 TGGGTGGCAGGCACAGCAGGGGG - Intronic
1017799562 6:157881322-157881344 TGGCTGGCGGGTAGAACAGGCGG - Intronic
1018646612 6:165954667-165954689 TGCAAGGCGGGCACAGCAACAGG + Intronic
1019186947 6:170226129-170226151 TGAATGCCCGGTACTGCAGGAGG + Intergenic
1023424436 7:40020480-40020502 TACATTGGGGGAACAGCAGGAGG - Intronic
1029843419 7:103389496-103389518 GGCATGGGGAGGACAGCAGGAGG - Intronic
1034546112 7:151790514-151790536 TGCCTGCCGGGTACAGTATGAGG - Intronic
1035201793 7:157272477-157272499 TGGATGGCACGTACAGCTGGAGG - Intergenic
1036757842 8:11483178-11483200 TACATGGCGGGGGGAGCAGGAGG + Intergenic
1036760561 8:11505986-11506008 TGCCTGGCGGGGACAGGAGCAGG - Intronic
1037137158 8:15476788-15476810 TGCATGGGGTGTACACCAAGTGG - Intronic
1037788141 8:21914965-21914987 TCCATGGCATGTACAGCAGAAGG - Intergenic
1038283980 8:26190478-26190500 TGCACGGCGGGTAGAGCAGCGGG - Intergenic
1048441741 8:134464494-134464516 TGCAGGGCGAGTACTCCAGGGGG - Intergenic
1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG + Intronic
1058884444 9:109312864-109312886 TGGGTGGAGGGAACAGCAGGTGG - Intronic
1059442372 9:114315746-114315768 TGCATGGACGGCACACCAGGTGG + Intergenic
1061762594 9:132860758-132860780 TGCAAGCCTGGCACAGCAGGTGG + Intronic
1062412861 9:136433608-136433630 GTCATGGCGGGAACAGCAGGTGG - Intronic
1186104636 X:6192768-6192790 TGCATGGCTGGGAGAGCAGTAGG - Intronic
1187464583 X:19515588-19515610 TGCCTGGAGGGGGCAGCAGGGGG - Intergenic
1194195917 X:90892723-90892745 TGCATGGAGGGAAAGGCAGGAGG - Intergenic
1197229641 X:123990212-123990234 TGCATGGGGTGTACACCAAGTGG - Intronic
1200163760 X:154022332-154022354 TGCATGCCGGGTGCAGCATCTGG - Intronic
1200541765 Y:4466916-4466938 TGCATGGAGGGAAAGGCAGGAGG - Intergenic