ID: 1185076851

View in Genome Browser
Species Human (GRCh38)
Location 22:48687756-48687778
Sequence TAAGTGCCCCACCTCTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185076842_1185076851 2 Left 1185076842 22:48687731-48687753 CCCTGCTGGCCTCAGGTCACCTC 0: 1
1: 0
2: 6
3: 48
4: 398
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1185076837_1185076851 18 Left 1185076837 22:48687715-48687737 CCCAGCTCCATACACACCCTGCT 0: 1
1: 0
2: 2
3: 21
4: 265
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1185076843_1185076851 1 Left 1185076843 22:48687732-48687754 CCTGCTGGCCTCAGGTCACCTCC No data
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1185076840_1185076851 11 Left 1185076840 22:48687722-48687744 CCATACACACCCTGCTGGCCTCA 0: 1
1: 0
2: 1
3: 22
4: 326
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1185076836_1185076851 27 Left 1185076836 22:48687706-48687728 CCAACAGCACCCAGCTCCATACA 0: 1
1: 0
2: 1
3: 23
4: 266
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1185076844_1185076851 -7 Left 1185076844 22:48687740-48687762 CCTCAGGTCACCTCCCTAAGTGC 0: 1
1: 0
2: 1
3: 28
4: 233
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1185076838_1185076851 17 Left 1185076838 22:48687716-48687738 CCAGCTCCATACACACCCTGCTG 0: 1
1: 0
2: 3
3: 30
4: 319
Right 1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185076851 Original CRISPR TAAGTGCCCCACCTCTGAGG GGG Intronic
900197793 1:1385902-1385924 TCAGTTCCCCAATTCTGAGGGGG + Intronic
900806033 1:4769061-4769083 TACCTGCCCCACTTCTGAAGTGG + Intronic
901234008 1:7657735-7657757 GAAAAGCCCCTCCTCTGAGGTGG - Intronic
902097132 1:13955860-13955882 TTAGTACCCCTCCTCTGGGGTGG + Intergenic
902833451 1:19032665-19032687 TAAGTTCCTCACCTGTAAGGAGG - Intergenic
904907452 1:33908482-33908504 TAAGTGCCTCATCTGCGAGGCGG - Intronic
906013531 1:42552354-42552376 TAAGTGTCCCTCCTCTTTGGTGG - Intronic
911028445 1:93459886-93459908 TAAGTGCCCCTTCTCTGAAATGG + Intronic
912372822 1:109186943-109186965 TCAGTGCTCCTCCTCTGAGCTGG - Intronic
920256596 1:204659430-204659452 GAAGTGCTCCAGCTCAGAGGAGG + Intronic
1063543167 10:6955025-6955047 TCAGTGCCACACTGCTGAGGAGG - Intergenic
1065390650 10:25177239-25177261 GAAGTGCCTGACCTTTGAGGCGG + Intronic
1065787039 10:29225858-29225880 TAAGTGACCCAGGTATGAGGAGG - Intergenic
1068687987 10:59889015-59889037 CAAGGGCCCCAGCTCTGATGAGG - Intronic
1074718866 10:116247603-116247625 TCAGTGCCCAGCCTCAGAGGTGG - Intronic
1075361673 10:121842045-121842067 TGAGTGCCTCAGCTCTGAGAAGG + Intronic
1077290050 11:1784882-1784904 TAAGGGCCCCAGCTCTGCAGAGG - Intergenic
1083146787 11:60766004-60766026 GAAGTGTCCCAGCTATGAGGCGG - Intronic
1083603468 11:63962672-63962694 CAGGTGCCCCACCCCAGAGGCGG - Intergenic
1085040335 11:73323123-73323145 GAAGTGCCCTGCCTCTCAGGGGG + Intronic
1090068661 11:123525421-123525443 AAAATGCCCCACCCCTGCGGGGG - Intergenic
1092292392 12:7169555-7169577 TCAGTCCCCCAGTTCTGAGGGGG + Intergenic
1098841568 12:75484213-75484235 TGAGTGCCCCTCTTCTGAAGTGG - Intronic
1102464645 12:113121400-113121422 GAAGTGCCCCAGGACTGAGGAGG + Intronic
1104296350 12:127518159-127518181 TAAGTGGCACACTTCTGAAGTGG - Intergenic
1105531158 13:21221820-21221842 TAAGTTCCCCATTTCTGAAGGGG + Intergenic
1110289705 13:73789994-73790016 TAGGTTCCTCATCTCTGAGGTGG + Intronic
1111942985 13:94632803-94632825 TATTAGCCCAACCTCTGAGGTGG + Exonic
1113673228 13:112189223-112189245 AAAGTCCCCAACCTCAGAGGAGG + Intergenic
1114039752 14:18666426-18666448 TGAGAACCCCATCTCTGAGGGGG + Intergenic
1114044793 14:18864978-18865000 TGAGACCCCCATCTCTGAGGGGG + Intergenic
1114119430 14:19654547-19654569 TGAGACCCCCATCTCTGAGGGGG - Intergenic
1115812961 14:37130978-37131000 TAAATGCCCCACCACTGGGAAGG + Intronic
1118388612 14:65277850-65277872 TAAGGGGCCCGCCTCTGGGGAGG - Intergenic
1119447203 14:74675740-74675762 TGAGTGCCACACCCCTGAGAAGG - Exonic
1120335920 14:83154910-83154932 TAAGTGCCTGAGGTCTGAGGTGG - Intergenic
1122300665 14:100729237-100729259 TAAAGTCCCTACCTCTGAGGAGG - Intronic
1148683618 17:49488381-49488403 GAAGTCCCCCTGCTCTGAGGAGG - Intergenic
1149423464 17:56532716-56532738 TAAGTGCCCTAACTTTAAGGAGG - Intergenic
1158296953 18:56008748-56008770 TTAGGGCCACACCTCTGAAGAGG + Intergenic
1161732878 19:5972824-5972846 TGTGTGCTCCTCCTCTGAGGTGG - Intronic
1163785077 19:19270818-19270840 TAGGAGCCCCAGCTCTGAAGGGG + Intronic
1163953454 19:20612606-20612628 AAAGTTCTCAACCTCTGAGGGGG - Intronic
1165806892 19:38585895-38585917 TCAGTGCCCGACCTCTGACCTGG - Intronic
1167798554 19:51726364-51726386 CAAATGCCCCACTTCTGGGGAGG - Intergenic
1168523445 19:57070559-57070581 TGAGTGCCCCATCCCTGACGTGG + Intergenic
937683586 2:124670624-124670646 CAAGTGCAACACCTCTAAGGTGG - Intronic
937683589 2:124670684-124670706 CAAGTGCAACACCTCTAAGGTGG - Intronic
937867824 2:126767219-126767241 TCTGTGCCCCACCCCAGAGGAGG + Intergenic
938453609 2:131444566-131444588 TCAGTGACTCAGCTCTGAGGAGG - Intergenic
944063566 2:195595459-195595481 TAAGTGTCCAACCTCTGATCAGG + Intronic
944529006 2:200649419-200649441 TGAGTGCCCCAGCTGTGAGGGGG - Intronic
1170052211 20:12158625-12158647 TAAGTGTCCCACCCATGAGCAGG + Intergenic
1170809674 20:19663957-19663979 TCTGTGCCCCACCTATGGGGAGG + Intronic
1171424728 20:25042406-25042428 TAGCTGCCCCACCTGAGAGGAGG - Intronic
1173851391 20:46220619-46220641 TCAGTGTCCCAGCTCTGAGTGGG + Intronic
1177651955 21:23968931-23968953 TTCCTGCTCCACCTCTGAGGTGG - Intergenic
1180463316 22:15587535-15587557 TGAGACCCCCATCTCTGAGGGGG + Intergenic
1180711526 22:17842475-17842497 CACGTGCCCCACCACTGAGGGGG + Intronic
1181348464 22:22238166-22238188 GAGTTGCCCCATCTCTGAGGTGG - Intergenic
1181787938 22:25241117-25241139 AAAATGCCCCATCTGTGAGGAGG + Intergenic
1184665127 22:45984427-45984449 TAAATGTCCCACATCAGAGGGGG + Intergenic
1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG + Intronic
949797078 3:7863059-7863081 TGAGCTGCCCACCTCTGAGGGGG - Intergenic
950359331 3:12439396-12439418 AAAGTGCCCCACCTTTAAGGAGG + Intergenic
951062693 3:18228324-18228346 TAAGTGCAACAGCACTGAGGTGG - Intronic
951595302 3:24312193-24312215 TAGGTGCCCCACCCATGTGGGGG + Intronic
951651622 3:24957155-24957177 TGAGTGCCTCACTTCTGAAGTGG + Intergenic
951858802 3:27227496-27227518 TATGTGCCCGATGTCTGAGGAGG - Intronic
952204993 3:31172398-31172420 TAAGTGAGACCCCTCTGAGGAGG + Intergenic
953461832 3:43087615-43087637 GAAGTTCCCCACCCCTCAGGAGG - Intronic
953469406 3:43154337-43154359 AAAGTGCTCCACTGCTGAGGGGG - Intergenic
953767520 3:45755000-45755022 TCAGAGCCTCACCTCAGAGGGGG - Intergenic
962493586 3:135917804-135917826 CAGGTGCCCTAACTCTGAGGAGG - Intergenic
963018737 3:140851048-140851070 TAAGAGCACCACCTCTGCTGGGG - Intergenic
968441666 4:627540-627562 TGGGTGCCCCACTTCTTAGGAGG - Intronic
970588510 4:17537578-17537600 TAAGTGGCCCACCTGAGAGGTGG + Intergenic
971396867 4:26236500-26236522 TGAGTGCCCCACCTTGGAAGTGG - Intronic
985700803 5:1371235-1371257 TCAGTTCCCCAATTCTGAGGGGG + Intergenic
989641681 5:43589152-43589174 TCAGTCCCCCAGTTCTGAGGAGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1003391501 6:5717101-5717123 TAAGTTCCCCATTTCTGAAGGGG - Intronic
1003610984 6:7614851-7614873 CCTGTGCCCCATCTCTGAGGAGG - Intergenic
1006577612 6:35057665-35057687 GAAGTGCCCCACCCCAGAGCAGG - Intronic
1012644034 6:101657382-101657404 TAAGTTCCCCATGGCTGAGGAGG - Intronic
1013138578 6:107307488-107307510 GAAGTGCCCCATCTGTGAGTTGG - Intronic
1014113190 6:117644314-117644336 TAAGTTCCCCATTTCTAAGGTGG - Intergenic
1014276378 6:119394631-119394653 TCATTTCCCCACCTCTGAAGAGG + Intergenic
1017822087 6:158056894-158056916 TATGTGCTCCATATCTGAGGAGG + Intronic
1027907678 7:84207152-84207174 TAAGAGCCTCACCACTGAAGAGG - Intronic
1033163395 7:139017028-139017050 TAAGTTCACCTCCTCTGAAGTGG + Intergenic
1038612490 8:29069235-29069257 TAAGTGCCCCAGCCAGGAGGTGG + Exonic
1044321615 8:90808471-90808493 TAATTTCCCCACCTGTGAAGTGG + Intronic
1044693453 8:94900457-94900479 TAAGGGCCCTCCCTCTGAGGTGG - Intronic
1046516793 8:115272526-115272548 CAAGTGCCAAAGCTCTGAGGTGG - Intergenic
1054767611 9:69055237-69055259 TAACTCCCCCACCTCTGATCAGG - Intronic
1189587744 X:42477985-42478007 TAAGTGCCCTCCTTTTGAGGAGG + Intergenic
1189600720 X:42622121-42622143 GAAATGCCTCACCTATGAGGAGG + Intergenic
1195856592 X:109338700-109338722 AAAGTGCCCCATCACTGTGGTGG - Intergenic
1199497081 X:148464504-148464526 TAAGTGCCTCACCTATGAAGTGG - Intergenic