ID: 1185079190

View in Genome Browser
Species Human (GRCh38)
Location 22:48700369-48700391
Sequence ACACTCTCCCCGGCGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 55}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185079190_1185079200 17 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079200 22:48700409-48700431 GCTCCCGGGGCAGAGCAGGCCGG 0: 1
1: 0
2: 6
3: 49
4: 393
1185079190_1185079206 27 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079206 22:48700419-48700441 CAGAGCAGGCCGGCAGGGGCTGG 0: 1
1: 0
2: 12
3: 56
4: 602
1185079190_1185079207 28 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079207 22:48700420-48700442 AGAGCAGGCCGGCAGGGGCTGGG 0: 1
1: 0
2: 4
3: 53
4: 431
1185079190_1185079197 3 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079197 22:48700395-48700417 CAGGTACGACTAGAGCTCCCGGG 0: 1
1: 0
2: 1
3: 5
4: 107
1185079190_1185079208 29 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079208 22:48700421-48700443 GAGCAGGCCGGCAGGGGCTGGGG 0: 1
1: 0
2: 7
3: 76
4: 713
1185079190_1185079196 2 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079196 22:48700394-48700416 CCAGGTACGACTAGAGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 349
1185079190_1185079205 23 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079205 22:48700415-48700437 GGGGCAGAGCAGGCCGGCAGGGG 0: 1
1: 0
2: 8
3: 80
4: 602
1185079190_1185079209 30 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079209 22:48700422-48700444 AGCAGGCCGGCAGGGGCTGGGGG 0: 1
1: 0
2: 8
3: 77
4: 735
1185079190_1185079198 4 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079198 22:48700396-48700418 AGGTACGACTAGAGCTCCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1185079190_1185079204 22 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079204 22:48700414-48700436 CGGGGCAGAGCAGGCCGGCAGGG 0: 1
1: 0
2: 3
3: 34
4: 319
1185079190_1185079203 21 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079203 22:48700413-48700435 CCGGGGCAGAGCAGGCCGGCAGG No data
1185079190_1185079199 13 Left 1185079190 22:48700369-48700391 CCTGACCTCGCCGGGGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1185079199 22:48700405-48700427 TAGAGCTCCCGGGGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185079190 Original CRISPR ACACTCTCCCCGGCGAGGTC AGG (reversed) Intronic
901480258 1:9520250-9520272 CCACTGTCCCCGGCCAGATCTGG + Intergenic
912863368 1:113235082-113235104 ACACTCTTCCCTGGGAGGACGGG + Intergenic
916506112 1:165429330-165429352 TCACTCTCCCCATCGAGGTTTGG - Intronic
1063261339 10:4392628-4392650 ACACTATCCCCAGCCAGGTGCGG - Intergenic
1065104473 10:22368542-22368564 ACATTCTCCCCAGCTAGCTCAGG + Exonic
1068947643 10:62745397-62745419 ACACATTCCCCAGGGAGGTCTGG - Intergenic
1077299443 11:1840317-1840339 CCACGCTCCCTGGCCAGGTCAGG - Intronic
1082243353 11:49892710-49892732 ACACCCGCCCCTGCGAGCTCAGG + Intergenic
1085095020 11:73753422-73753444 CCACTGTGCCCGGCGAGGTCTGG - Intronic
1089217089 11:116841001-116841023 ACTCTGTCCCCTGCTAGGTCTGG + Intergenic
1099172716 12:79384646-79384668 ACACTCTCACCTGGGAGATCCGG + Intronic
1104928104 12:132324216-132324238 ACACTCTCCCTCGAGAGCTCCGG - Intronic
1106117364 13:26829350-26829372 ACTCTCTACCTGGCGAGATCAGG - Intergenic
1107400934 13:40068350-40068372 ACCCTATCCCTGGAGAGGTCAGG - Intergenic
1112659473 13:101491218-101491240 ACATTCTCCTCTGCAAGGTCAGG + Intronic
1113427590 13:110222194-110222216 ACACCCTCCCCGGCGGGCCCTGG + Intronic
1114808114 14:25861580-25861602 ACACTCTCTCCTTCCAGGTCTGG + Intergenic
1132569799 16:639069-639091 ACATTCTCCAAGGAGAGGTCAGG - Intronic
1135392143 16:22102826-22102848 TCACTCTGCCCGGTGAGGGCAGG - Intronic
1135419829 16:22298030-22298052 AGCCTCTGCCCGGCGAGGCCAGG + Intronic
1138449197 16:57083082-57083104 ACACTCTCCCCTCCCAGCTCGGG - Exonic
1139003875 16:62547519-62547541 ACACTCACCATGGCTAGGTCAGG - Intergenic
1142475809 17:188822-188844 AAACTCTCCCTGGCCAGGTGTGG - Intergenic
1142603579 17:1069759-1069781 ACACTCACCCCGCAGAGGTCAGG + Intronic
1142603596 17:1069808-1069830 ACACTCACCTCGCAGAGGTCCGG + Intronic
1142603612 17:1069857-1069879 ACACTCACCCCGCAGAGGTCAGG + Intronic
1142603629 17:1069905-1069927 ACACTCACCCCGCAGAGGTCCGG + Intronic
1151478349 17:74356048-74356070 GCACCCTCCCAGGAGAGGTCAGG + Intergenic
1157572368 18:48721504-48721526 ACACTGTCCCCGGGGAGGGCTGG - Intronic
1160584241 18:79903903-79903925 ACCCTCCCCGCGGGGAGGTCAGG + Exonic
1160745458 19:709129-709151 TCCATCTCCCCGCCGAGGTCCGG - Exonic
1164564441 19:29315797-29315819 AGACTCTCCCTGGGGAGGTAAGG - Intergenic
926168663 2:10536916-10536938 ACAATGTCCCAGGCGAGGCCGGG - Intergenic
927507009 2:23621248-23621270 AGTCTCTCCCCTGGGAGGTCTGG - Intronic
927934565 2:27069044-27069066 AAACTCTCCTCGGACAGGTCTGG - Intronic
937863755 2:126732859-126732881 ACCCTCTTCCCAGTGAGGTCGGG + Intergenic
1172096250 20:32461969-32461991 GCACTCACCCCGGCGAGCCCAGG - Intronic
1176179619 20:63743145-63743167 ACCCTCCCCCCCGCCAGGTCGGG + Exonic
1178367272 21:31998336-31998358 TCACTCTCCCCACAGAGGTCGGG - Intronic
1179647789 21:42785781-42785803 ACTCTGTTCCCTGCGAGGTCTGG - Intergenic
1183378658 22:37479711-37479733 ACACTCGCCCTGGCCAGGTGTGG + Intronic
1184975565 22:48059027-48059049 ACACACTCCTGGGGGAGGTCAGG - Intergenic
1185079190 22:48700369-48700391 ACACTCTCCCCGGCGAGGTCAGG - Intronic
954154372 3:48677096-48677118 ACACTCTCCCTGGCCAGGCACGG + Intronic
956659462 3:71583692-71583714 ACGCACTCCCGGGCGAGGGCCGG + Intronic
968594921 4:1477313-1477335 AATCTCTACCCGGGGAGGTCAGG - Intergenic
968613194 4:1566318-1566340 CCACTCTCCCGGGAGAGGTGAGG + Intergenic
970823876 4:20251780-20251802 CCCCTCTCCCCAGCGAGGTGCGG + Intergenic
973855728 4:55008517-55008539 CCTCTCTCCCCAGCGAGGGCTGG + Intergenic
981718710 4:147777543-147777565 ACACCCTACCCGGCCAGGTGTGG - Intronic
985131822 4:186746243-186746265 TCACTCTCCCTGGCCAGCTCCGG + Intergenic
987697235 5:21347951-21347973 TCACTCTCTCTGGCGAGGTTAGG + Intergenic
1005508920 6:26494724-26494746 ACATTCTCCCGCGCGAGGACAGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019681141 7:2350317-2350339 CCTCTCTCCCCAGCCAGGTCAGG + Intronic
1019707445 7:2503243-2503265 ACAGTCTCCCCGGAGAGTTCTGG - Intergenic
1028135638 7:87220396-87220418 CCACTCTCCCCGGCGCGGCCAGG - Exonic
1052357406 9:27519279-27519301 GCTCTCTCACAGGCGAGGTCTGG + Intronic
1059533840 9:115062957-115062979 TCACCCTGCACGGCGAGGTCAGG - Exonic
1060055919 9:120412908-120412930 CCACTCTCCCCTGCGAACTCTGG + Intronic
1060194967 9:121617616-121617638 CCACCCTCCCCGCTGAGGTCTGG + Intronic
1060666876 9:125436943-125436965 ACAGTCTCCCCGGCACGGGCTGG - Intergenic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1062327935 9:136021493-136021515 GCACTCTCCCCAGTGAGGTCAGG - Intronic