ID: 1185079533

View in Genome Browser
Species Human (GRCh38)
Location 22:48701981-48702003
Sequence ATGTACACACAGAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185079524_1185079533 19 Left 1185079524 22:48701939-48701961 CCTTGGAGCGGGAGCTGGCCTCT No data
Right 1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG 0: 1
1: 0
2: 1
3: 10
4: 166
1185079529_1185079533 1 Left 1185079529 22:48701957-48701979 CCTCTGTCTGGGGAGGCAGCTTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG 0: 1
1: 0
2: 1
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185079533 Original CRISPR ATGTACACACAGAGGGGACC TGG Intronic
900715727 1:4142304-4142326 TTGTACCCCGAGAGGGGACCTGG - Intergenic
902402488 1:16165855-16165877 ATGGACAGACAGAGGGAAACAGG - Intergenic
902451909 1:16501562-16501584 CTCTACACAGAGAGGGGAGCTGG - Intergenic
905253889 1:36667508-36667530 AAGCACAGACAAAGGGGACCAGG - Intergenic
905731313 1:40301114-40301136 ATGTCCACCCAGAGGGGACCTGG + Exonic
906162405 1:43660069-43660091 ATGTACACACAGATGTAAACCGG - Intronic
906346046 1:45015014-45015036 ACAGACACACAGAGGGGCCCTGG - Intronic
911704008 1:100989826-100989848 ATGTACACATAAAGCAGACCAGG - Intronic
915252850 1:154602811-154602833 AGGAACACAGAGAGGGGAGCAGG + Intronic
919803909 1:201369507-201369529 ATGTGGCCATAGAGGGGACCTGG - Intronic
921327903 1:214005919-214005941 ATACACACACAGAGAGAACCAGG - Intronic
921826598 1:219679086-219679108 ATGTAGAAACAGTGGGAACCCGG + Intergenic
922035668 1:221845761-221845783 ATAAACACTCAGAGGGGACAAGG + Intergenic
1066099815 10:32107703-32107725 ATGTGCAAACAGAGGAGTCCAGG - Intergenic
1067047596 10:42993258-42993280 ATGTACACAGAGTGGGGAGATGG - Intergenic
1067080689 10:43210746-43210768 ATGTAGGCACAGACGGGGCCGGG + Intronic
1068990816 10:63148561-63148583 AAGGGCAAACAGAGGGGACCTGG + Intronic
1070799912 10:79239281-79239303 ATGCACACATACCGGGGACCTGG - Intronic
1071929121 10:90446025-90446047 ATGGACACATAGAGGGGAACAGG - Intergenic
1075342310 10:121657005-121657027 ATGAAGACACAGAGAGGGCCGGG - Intergenic
1076853492 10:133104312-133104334 ATTTATACACCCAGGGGACCTGG - Intronic
1078056821 11:8015903-8015925 ATGCACATGCAGAGGAGACCAGG - Intergenic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1079267745 11:18950986-18951008 ATGTAAGCCCAGAGAGGACCAGG - Intergenic
1081613708 11:44578444-44578466 ATGTACAGACAGAGGTGAGAAGG - Intronic
1083768410 11:64853266-64853288 ATGTCCAGACAGCGGGGACCAGG - Exonic
1085033149 11:73284701-73284723 ATGTCTACACAGAGAGGACTGGG - Intronic
1087840687 11:102917899-102917921 ATGTCCTCACAGAGGGGAAGAGG - Intergenic
1089930005 11:122300305-122300327 ATGTACACACAAAGTGGAATAGG - Intergenic
1090071727 11:123549979-123550001 AGGTACACCCAGACAGGACCTGG + Intronic
1091520289 12:1233108-1233130 CTCTACACACAGAAGAGACCAGG + Intronic
1092003607 12:5050671-5050693 ATGTGCACACAGAGGCCACCCGG - Intergenic
1092644482 12:10554699-10554721 ATGTTCAAACAGAGAGGAGCAGG - Intergenic
1093875915 12:24349231-24349253 AAGTACAGACAGAGGGGAACTGG - Intergenic
1094716686 12:33021060-33021082 ATATGCACACTGAGGGGAACAGG - Intergenic
1100361376 12:93882766-93882788 ATGCACACAAAGAGGGAAGCAGG + Intronic
1103102213 12:118187956-118187978 ATATACACACAGAGTAGCCCTGG + Intronic
1103295850 12:119886360-119886382 AAGTATACAGAGTGGGGACCCGG - Intergenic
1103565405 12:121812782-121812804 ATGTGTGCACAGAGGGGACCTGG + Intronic
1110849947 13:80233427-80233449 ATTTACACACAGAGGTGTGCTGG - Intergenic
1112563900 13:100536146-100536168 AGTCACACACACAGGGGACCTGG - Intronic
1112957632 13:105080796-105080818 GTGTACACAAAGAAGGGAACAGG - Intergenic
1113167443 13:107458291-107458313 CTTTACTCAGAGAGGGGACCAGG + Intronic
1115453693 14:33577540-33577562 ATGGAAACACAGAGAGAACCAGG + Intronic
1117410133 14:55442892-55442914 ATGTTCACACAGAGAAGGCCAGG + Intronic
1122916788 14:104863145-104863167 AGGAACCCACAGAGGAGACCAGG - Intergenic
1126420162 15:48464164-48464186 ATTTACACAGAGAGAGGACACGG - Intronic
1127151393 15:56079220-56079242 ATGGACACACAGAGGGCTTCTGG - Intergenic
1128220066 15:65962796-65962818 ATGCAGACTCAGAGGAGACCAGG + Intronic
1132769279 16:1551988-1552010 GTTTCCACACATAGGGGACCTGG - Intronic
1133071857 16:3251919-3251941 ATATAAATACAGTGGGGACCTGG + Intronic
1133601654 16:7345619-7345641 ATGTAGACAGAGAGGGGACTCGG - Intronic
1135698551 16:24611328-24611350 ACGTACACACAGCGGGAACTGGG - Intergenic
1136599909 16:31278134-31278156 ATGTGCAAACAGAGGCGCCCTGG + Intronic
1136680362 16:31957632-31957654 CTGAACACACAGAGGGCAGCAGG - Intergenic
1136780706 16:32899177-32899199 CTGAACACACAGAGGGCAGCAGG - Intergenic
1136889706 16:33960493-33960515 CTGAACACACAGAGGGCAGCAGG + Intergenic
1138531206 16:57635328-57635350 GTGTGCACACCTAGGGGACCAGG + Intronic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1139956473 16:70695613-70695635 CTGCACACCCAGTGGGGACCTGG - Exonic
1139967315 16:70752962-70752984 ATAAAGACACAGAGGGAACCTGG + Intronic
1140406699 16:74716304-74716326 ATGAACACACATAGGGGGCTGGG + Intronic
1141796038 16:86274936-86274958 ACATACACAGAGAGGGGACATGG - Intergenic
1203083360 16_KI270728v1_random:1163205-1163227 CTGAACACACAGAGGGCAGCAGG - Intergenic
1142748448 17:1972852-1972874 ATGAACCTCCAGAGGGGACCAGG + Intronic
1143401221 17:6644641-6644663 GTGTAAACACTGAGGGTACCTGG + Exonic
1144702720 17:17349384-17349406 CTGTCCACAAAGAGGGGAGCAGG + Intergenic
1146034299 17:29391575-29391597 ATGTATACACAGAAGGGAGGGGG + Intronic
1146653189 17:34619880-34619902 ATGTGCACACAGAGGTGAGCAGG + Intronic
1148822251 17:50366451-50366473 ATCTACACAAAGAGGTGAACTGG - Intergenic
1148985697 17:51619088-51619110 ATGTACACAGCCAGGGAACCTGG - Intergenic
1149127648 17:53254828-53254850 ATGGACACACAGAGGAAAACCGG + Intergenic
1149459325 17:56814328-56814350 ATCTACTCACAGAGGGAGCCTGG + Intronic
1150211006 17:63441475-63441497 AGGGCCACACAGAGGGGGCCTGG + Intronic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1152722290 17:81928945-81928967 AGGTCCACACAGCGGGGACCTGG + Intergenic
1152846117 17:82600798-82600820 ATTTCCACACAGAAGGGAGCGGG - Intronic
1152912900 17:83015591-83015613 ATGCACACACAGTGTGTACCAGG + Intronic
1154971380 18:21413163-21413185 CTGGACACACAGAGGGCAGCAGG - Intronic
1156648339 18:39194755-39194777 ATATACACACATACTGGACCTGG - Intergenic
1161828502 19:6585935-6585957 GTGTACACACAGGGGCCACCCGG - Exonic
1162731084 19:12719382-12719404 AGGTACATAATGAGGGGACCTGG - Intronic
1163929843 19:20378360-20378382 ATGAACACAAAGAGGAGAACAGG - Intergenic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
930735160 2:54770962-54770984 ATGGAAACACAGAGAGGAGCAGG + Intronic
931059081 2:58505978-58506000 TTTTACACCCAGATGGGACCAGG + Intergenic
931759539 2:65404640-65404662 CTGTGCAGAGAGAGGGGACCTGG + Intronic
932306003 2:70704704-70704726 ATTTAGACACAGAAAGGACCTGG - Intronic
932941468 2:76171716-76171738 ATGGACACAGAGAGGGAAACAGG - Intergenic
940778323 2:157907196-157907218 ATGTACACATAGTGGGGAGAGGG + Intronic
945855845 2:215068738-215068760 ATGAATACAGAGAGGGGAGCAGG - Intronic
1170940578 20:20845076-20845098 GTGTAAACACAGAAGGGATCTGG + Intergenic
1171057607 20:21922634-21922656 ATGGACACATCGAGGGGAACTGG - Intergenic
1172106078 20:32518045-32518067 AGGGACACACAGTGGGGAACAGG + Intronic
1175498976 20:59435966-59435988 ATGTACCCACAGTGGGGGGCGGG - Intergenic
1175774804 20:61646402-61646424 AGGGACACACACAGAGGACCAGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176135210 20:63519559-63519581 ATGAACACACAGAGCGGTGCAGG + Intergenic
1176687275 21:9862177-9862199 CTGCACACAGAGAGGGGCCCTGG - Intergenic
1179721626 21:43319442-43319464 CTGTACACACAGAGGGGGTGGGG + Intergenic
1181173041 22:21020944-21020966 ATGTCGACACAGAGGGGGCTTGG + Intronic
1183124920 22:35767780-35767802 ATGTGCACAAAGAGGCGAACTGG + Intronic
1183715186 22:39529283-39529305 ATTTACACACAGACCGGAGCTGG - Exonic
1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG + Intronic
952577732 3:34795000-34795022 ATGTACACACTGAGGAGCACAGG + Intergenic
953526417 3:43693388-43693410 ATGTAAACCCAGTGGGGAGCTGG - Intronic
953905254 3:46865395-46865417 AGGGCCACACAGAGGGGCCCCGG + Intronic
955655431 3:61240303-61240325 CTGTACACACAGAAAGGCCCTGG - Intronic
958061535 3:88489040-88489062 ATGGACACAGGGAGGGGAACAGG + Intergenic
960396971 3:117149681-117149703 AGGCAGACACAGAGGGGACTTGG + Intergenic
961162201 3:124737761-124737783 ATGTACACACTGAGTGGAGGCGG - Exonic
961671564 3:128535760-128535782 ATGGACCCACAGATGGGGCCAGG - Intergenic
962005227 3:131342933-131342955 ATGTATACAAAGAAGTGACCAGG + Intronic
962328024 3:134451898-134451920 ATGTGCTCACAGAGGGGGCTGGG + Intergenic
963678409 3:148343918-148343940 ATGTACAGACAGAGGGTGCATGG - Intergenic
966489125 3:180506771-180506793 ATGTACAGTCAGAGAGGAACTGG - Intergenic
967984670 3:195086055-195086077 TTGTACACACAGAGCACACCTGG + Intronic
969186337 4:5477507-5477529 ATGGACTCAGAGAGGGGATCTGG - Intronic
969587171 4:8101032-8101054 ATATACACCCAGATGGGAACAGG + Intronic
970316928 4:14838102-14838124 ATATACACACAGAGGTGAAAGGG - Intergenic
975639610 4:76486636-76486658 ATGTCCACACAGGGTGGTCCTGG - Intronic
975707510 4:77125789-77125811 ATGTCCACAGAGTGGGGAGCTGG - Intergenic
977086406 4:92604497-92604519 ATGGACACAGGGAGGGGAACAGG + Intronic
977740203 4:100470842-100470864 ATGAACACATAGAGGGGTCAAGG + Intronic
978582609 4:110247356-110247378 ATGTAGACACAGAGAGGAAAGGG - Intergenic
980350677 4:131680284-131680306 CTGCACACAGAGAGGGGCCCTGG - Intergenic
980636275 4:135508220-135508242 GTGTTCACACAGAATGGACCAGG - Intergenic
981223896 4:142269067-142269089 ATGTCCACAGGGAGGGGACAAGG + Intronic
982148458 4:152425410-152425432 AAGTACTATCAGAGGGGACCTGG - Intronic
983442452 4:167803825-167803847 ATGTACCCACAGAGTTAACCAGG + Intergenic
983472524 4:168174333-168174355 ATGTCCAGACAAAGGGGACATGG - Intronic
983885927 4:172980589-172980611 ATGAACACACAGAGAGGAGGTGG - Intronic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
987259356 5:16187956-16187978 ATGTAGACATGGAGGGGACGTGG + Intergenic
992984410 5:82212829-82212851 ATGTAGACACAGAAGAGAACAGG - Intronic
994409200 5:99384964-99384986 ATGAACACAAAGAGGGGAAGAGG + Intergenic
995599493 5:113780158-113780180 CTGAACACACAGAGGGTTCCTGG + Intergenic
998579002 5:143350394-143350416 ATGTGCACAGAGAGGGGAAAAGG + Intronic
1001704615 5:173732912-173732934 ATGAAAAGACAGACGGGACCTGG - Intergenic
1002000004 5:176192117-176192139 ATGGAGACACAGGAGGGACCTGG + Intergenic
1007487779 6:42194301-42194323 AAATACACAAAGAGAGGACCTGG + Intronic
1010127170 6:72446495-72446517 ATGTAGGCACTCAGGGGACCAGG + Intergenic
1014630871 6:123788442-123788464 ATGTTCACAGAGAGAGGACAAGG + Intergenic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1020568990 7:9833623-9833645 ATGTACACTCAGAGGGTTTCTGG + Intergenic
1020769995 7:12378753-12378775 ATGTACACACAGTAGGAACCAGG - Intronic
1023075367 7:36476554-36476576 ATGGACACAAAGAAGGGAACAGG - Intergenic
1023575415 7:41621373-41621395 ATGTACACGCAGAAGGGCACAGG + Intergenic
1026314635 7:69217546-69217568 AAATACACACAAAGGGGAACAGG + Intergenic
1032303220 7:130709094-130709116 ATGTACACACATAAGGGAAATGG - Intergenic
1038055652 8:23855283-23855305 ATGTACACACAGAGAAGATAGGG - Intergenic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1039802719 8:40973945-40973967 ATGCACACAGAGGGAGGACCAGG - Intergenic
1040853072 8:51922229-51922251 ATGAAAACAAAAAGGGGACCTGG - Intergenic
1042048391 8:64680914-64680936 ATTTACAGATAGAGTGGACCTGG - Intronic
1042879312 8:73469749-73469771 ATATCCAGACAGAGGGCACCTGG + Intronic
1045844078 8:106613168-106613190 ATGTTCACACAGAGGGAAAGAGG + Intronic
1049319438 8:141988160-141988182 AGGAACACAGAGAGGGGTCCAGG - Intergenic
1053782030 9:41619424-41619446 CTGCACACAGAGAGGGGCCCTGG + Intergenic
1054169982 9:61829578-61829600 CTGCACACAGAGAGGGGCCCTGG + Intergenic
1054667556 9:67751237-67751259 CTGCACACAGAGAGGGGCCCTGG - Intergenic
1054818373 9:69497437-69497459 TGGGCCACACAGAGGGGACCTGG + Intronic
1054966700 9:71036336-71036358 ATTTACAGACATAGGTGACCTGG - Intronic
1056532892 9:87502569-87502591 GTGTACACAGAGAGGTGCCCAGG - Intronic
1058394449 9:104534482-104534504 ATGTACACACACAGATGTCCTGG + Intergenic
1058606745 9:106731163-106731185 ATGTACATACAGAGATGAACAGG - Intergenic
1059595529 9:115716052-115716074 ATGTAAAAACAAAGGGAACCAGG + Intergenic
1060402769 9:123357907-123357929 GTGTGCACTCACAGGGGACCTGG + Intronic
1062399425 9:136365922-136365944 ATGTAGGCACAGAGGCGAGCAGG - Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1193986021 X:88241469-88241491 ATGGACACATAGAGGAGAACAGG + Intergenic
1194455246 X:94095248-94095270 ATGTCCCCTTAGAGGGGACCAGG + Intergenic
1196288411 X:113910357-113910379 TTGGACACACAGAGGGGTACAGG + Intergenic
1196540742 X:116904039-116904061 ATGAACACAAAGAAGGGAACAGG + Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1200980835 Y:9261871-9261893 ATGTACAGTCAGAGCCGACCTGG - Intergenic